... increase the competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand ... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its ... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together...
Ngày tải lên: 24/09/2012, 17:19
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
Ngày tải lên: 19/02/2014, 17:20
Cancer Research UK’s strategy 2009–2014: Cancer Research UK’s aim is to reduce the number of deaths from cancer. Our future plans are ambitious, but they are in line with the challenge and the responsibility we face. docx
... earlier diagnosis of cancer a major focus and to act as a catalyst for action We are co-chairing the National Awareness and Early Diagnosis Initiative (NAEDI), which brings together a wide range of ... made in basic biology over the last several decades have led to an array of discoveries that can be translated into clinical practice to benefit the public As a result, the way cancer is managed ... prevention as few other research organisations, at least in the UK, are playing a substantial role in this area The UK already has considerable strengths in the area of basic science We have a responsibility...
Ngày tải lên: 22/03/2014, 16:21
báo cáo hóa học:" A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries" pptx
... performed data cleaning and data analysis SM contributed to data analysis, writing of the manuscript, and editing for important content All authors read and approved the final version of the manuscript ... School of Government, Cambridge, MA, USA Page of Authors’ contributions BW designed and coordinated the study, participated in data cleaning and data analysis, and was the lead author on this paper ... systematically cleaned and validated all transactional data, we cannot be confident that we have identified all reporting errors in publicly available data Prices are inconsistently reported to the...
Ngày tải lên: 20/06/2014, 08:20
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
... (Table 2), and their transcripts content analysed This generated conceptual ideas about the main areas of relapse management, with around 100 0 statements on people’s Riazi et al Health and Quality ... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the scales Finally, although patients’ perceptions of care delivery are crucial,...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo toán học: "A LOWER BOUND FOR THE NUMBER OF EDGES IN A GRAPH CONTAINING NO TWO CYCLES OF THE SAME LENGTH" pptx
... inf n→∞ the electronic journal of combinatorics (2001), #N9 Acknowledgment The author thanks Prof Yair Caro and Raphael Yuster for sending reference [7] The author also thanks Prof Cheng Zhao for ... vertices, and (G) denote the number of edges In this paper, we construct a graph G having no two cycles with the same length which leads to the following result Theorem Let t = 27720r + 169 (r ≥ 1), then ... Chunhui Lai, On the size of graphs with all cycle having distinct length, Discrete Math 122(1993) 363-364 [6] Chunhui Lai, The edges in a graph in which no two cycles have the same length, J Zhangzhou...
Ngày tải lên: 07/08/2014, 06:22
Báo cáo toán học: "A closed formula for the number of convex permutominoes" pot
... collaborators in [3], is a constructive method to produce all the objects of a given class, according to the growth of a certain parameter (the size) of the objects Basically, the idea is to perform ... parallelogram permutominoes of size n is equal to the nth Catalan number, 2n , n+1 n and moreover, that the number of directed-convex permutominoes of size n is equal to half the nth central binomial ... Proposition The operator ϑ satisfies conditions and of Proposition Proof We have to prove that any convex permutomino of size n ≥ is uniquely obtained through the application of the operator ϑ to a convex...
Ngày tải lên: 07/08/2014, 15:22
Báo cáo toán học: "A short proof for the number of permutations containing pattern 321 exactly once" ppt
... or π ′′ onto a disjoint union of special points and objects enumerated by Catalan numbers) Therefore, the generating function for the number of permutations containing pattern 321 exactly once ... · x = x3 C , 2n and hence the number of such permutations is n n−3 , as desired The two factors of x2 C correspond to π ′ and π ′′ , the factor of x−2 corresponds to the fact that |π| − |f (π)| ... with additional restrictions and an auxiliary parameter However, it was not apparent from those proofs why the above result was so simple and compact We will use the block decomposition method of...
Ngày tải lên: 08/08/2014, 14:23
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association ... breast ductal carcinoma: pathologic correlations and prognostic implications Hum Pathol 2001, 32(1):89-94 Sasano H, Frost AR, Saitoh R, Taniyama Y, Nagura H, Matsunaga G, Takehana K, Kimura M, ... node spread and vascular invasion were still significant in a stepwise multivariate analysis for all invasive carcinomas and the subgroup of IDC (Table 2) Further univariate analyses revealed no...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc
... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and ... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... organizational pockets that seemed to a better job than others Research was not being adapted, however, on a regular basis In many cases, the roadblock was having a stakeholder partner accept the...
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and ... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument ... organizational pockets that seemed to a better job than others Research was not being adapted, however, on a regular basis In many cases, the roadblock was having a stakeholder partner accept the...
Ngày tải lên: 11/08/2014, 16:20
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps
... Several useful SNP databases are available on the World Wide Web (see Table 1); these databases are constantly updated and are growing rapidly However, the data contained in them are far from infallible ... emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based on association and haplotype analysis [31–34] Association analyses are ... Shimazu S, Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa T, Deichmann KA: Genetic variants of IL-13 signalling and human asthma...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: " A method to estimate the efficiency of gene expression from an integrated retroviral vector" potx
... resistant the calculation An example ofto puromycin to estimate the proportion of An example of the calculation to estimate the proportion of cells resistant to puromycin Data from table was plotted ... comparison of the growth curves gave an estimate bounded by the two calibration curves adjacent to the growth curve of the sample A more Table 2: An example of the data used to estimate the proportion ... was estimated by the cell count, C of the sample The proportion P0 was calculated on each day where usable data of the sample culture were available and then averaged Competing interests The author(s)...
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: " Inflammation: a way to understanding the evolution of portal hypertension" ppsx
... Histamine and serotonin stand out among mediators released by mast cells and cause vasodilation and edema due to increased vascular permeability [71] Neutral proteases may also regulate the tone ... tone of the splanchnic vascular bed and provoke edema and matrix degradation Particularly RMCP-II, considered a specific marker of rat mucosal mast cell degranulation, can modulate the vascular function ... Duran HJ, Llamas MA, Arias J: Evolutive types of prehepatic portal hypertension of the rat An Med Interna 2002, 19:341-351 Aller MA, Nava MP, Duran M, Alvarez E, Arias JL, Sỏnchez-Patan F, Llamas...
Ngày tải lên: 13/08/2014, 16:21
Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 1
... by carbon atoms VI Calculations indicate that boron atoms preferentially bind at the step sites and at octahedral sites just below the surface Boron and carbon atoms hence show similar a relative ... sites (∆) and the octahedral sites of the first (□) and second (x) subsurface layer of the Ni(111) surface as a function of the coverage and the concentration The symbols indicate calculated binding ... preferred adsorption sites for carbon atoms and can act as nucleation sites for the formation of graphene islands On-surface carbon atoms are relatively unstable with binding energies of around...
Ngày tải lên: 11/09/2015, 16:06
Design of a promoter to enhance the stability of catalysts for hydrocarbon reactions 2
... and the origin of catalyst promotion, as well as to the design of a new, improved catalyst The starting point to the design of an ammonia catalyst is the volcano-shaped relation between the ammonia ... equivalent to 1 /10 of the total diffusion path To simplify the notation, we will use carbon concentration to indicate the fraction of the octahedral sites in a particular subsurface layer that are ... and participation of other surface metal atoms that can assist the reaction on the surface The transition state takes place over two metal atoms to form a more “five-center like” intermediate The...
Ngày tải lên: 11/09/2015, 16:06
A study to investigate the involvement of nadph oxidase 5 (NOX5) in resveratrol (RSV) induced reactive oxygen species (ROS) production in u937 cells
... reduction of cellular and nuclear volume In the biochemical aspect of apoptosis, there are major types of apoptotic signaling pathways They are namely mitochondrial/intrinsic pathway and extrinsic death ... modulate signal transduction pathways such as the MAP kinase signaling pathways, JAK/STAT signaling pathways, PI3K/Akt pathway and cAMP/cGMP signaling pathway (Holme and Pervaiz, 2007; Pervaiz and Holme, ... Schematic representation of the various mechanisms of activation The cofactors/subunits required for the activation are highlighted Diagrammatic representation of the transmembrane topology and...
Ngày tải lên: 26/09/2015, 10:44
Exact modeling of multiple access interference, ber derivation and a method to improve the performance of UWB communication systems
... where the MAI is modeled as a Gaussian random variable (generally known as Gaussian Approximation (GA)) As it was clearly stated in [27], GA was taken on the decision variable (i.e the correlator ... receiver The MAI model in chapter is used as a basis to derive the CF of the MAI in fading channels A new form of numerical approximation for the CF of a lognormal variable is used to derive the CF of ... gain and τlu is the total delay of the l th signal path of user u The total delay consists of the path delays and the asynchronous access delays between users Therefore the received signal is...
Ngày tải lên: 05/10/2015, 22:04
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... type diabetes subjects Immunogenetics 2 010, 62 :101 -107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... necessary to the maintenance of peripheral tolerance, and their defect leads to organ-specific autoimmune disorders such as T1 D The non-obese diabetic (NOD) mice are a prototypic model of human autoimmunity...
Ngày tải lên: 18/06/2014, 16:20