10 9 an idealized model of a fractured reservoir

... immediate reimplantation of resected bone J Craniomaxillofac Surg 199 1, 19: 31- 39 Ehara S, Nishida J, Shiraishi H, Tamakawa Y: Pasteurized intercalary autogenous bone graft: radiographic and scintigraphic ... size of the bone formation was also quantitatively measured in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that ... by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and...

Ngày tải lên: 20/06/2014, 04:20

... Formal Grammar Charniak, E 199 6 Tree-bank Grammars, Proceedings AAAT96, Menlo Park, Ca Charniak, E 199 7 Statistical Parsing with a Context-Free Grammar and Word Statistics, Proceedings AAAI -97 , ... Parsing, Proceedings COLING '92 , Nantes, France Bod, R 199 3 Using an Annotated Language Corpus as a Virtual Stochastic Grammar, Proceedings AAAI '93 , Washington D.C Bod, R 199 8 Beyond Grammar: An ... Collins 199 9 and Charniak 2000) References Black, E., J Lafferty and S Roukos, 199 2 Development and Evaluation of a BroadCoverage Probabilistic Grammar of EnglishLanguage Computer Manuals Proceedings...

Ngày tải lên: 31/03/2014, 20:20

... Netherlands 2Department of Physiology, University of Manitoba, Winnipeg, Manitoba, Canada Authors’ contributions BGJD: design of the study, acquisition of data, data analysis and interpretation, manuscript ... normal subjects, in status asthmaticus, in chronic bronchitis, and in emphysema Thorax 196 9, 24:176-1 79 Parameswaran K, Willems-Widyastuti A, Alagappan VK, Radford K, Kranenburg AR, Sharma HS: ... design of the study, acquisition of data, data analysis and interpretation; AJH: preparation of ASM cell lines and critical revision of the MS; JZ: design of the study, data interpretation and critical...

Ngày tải lên: 12/08/2014, 13:22

... to the manufacturer's instructions and analysed on the Luminex™ 100 system Statistical analysis Data are presented as mean (SEM) values Variables were compared with repeated measures ANOVA or Student's ... course of IL-8 (C) Mean levels of IL-6 in nasal lavage when stable and at exacerbation There was an increase in IL-6 at exacerbation but this was not significant (p = 0.054) (D) Mean levels of IL-8 ... quantitaViral load measured with measured with a real-time quantitative RT-PCR assay Viral load was significantly increased above baseline on days – ** indicates p < 0.01 * indicates p < 0.05 All...

Ngày tải lên: 12/08/2014, 16:20

... http://respiratory-research.com/content/5/1 /10 Figure at 3500× (panels micrographs of control Scanning3electronC and D respectively) and MB-treated palates at a magnification of 400× (panels A and B respectively) and Scanning electron ... standards (MMP and 9) run in leftmost lane on the gel Optical density was measured in a Bio-Rad Scanning densitometer Statistical treatment of data All measurements were expressed as mean ± standard ... The area of the palate was approximated by measuring across the lateral-most borders of the jaw at the base of the palate, and calculating the area of the equivalent half-circle The volume of solution...

Ngày tải lên: 12/08/2014, 18:21

... Hogman M, Perchiazzi G, Magnusson A, Hedenstierna G: Functional residual capacity and respiratory mechanics as indicators of aeration and collapse in experimental lung injury Anesth Analg 2004, 98 :782-7 89 ... ± standard error of the mean Statistical comparison of data over time was conducted by a twoway analysis of variance (ANOVA) for repeated measurements, followed by Scheffe's multiple comparisons ... the analysis of variance resulted in p value < 0.05 (Statistica, Statsoft Inc., Tulsa, OK, USA) Correlations between FRC, static compliance, and PaO2 were evaluated by a Pearson's linear correlation...

Ngày tải lên: 13/08/2014, 11:22

... performance and cardiac loading conditions in an experimental model for acute PHT as well as in healthy animals with intact and pharmacologically blocked ANS Materials and methods This investigation ... values (Figure and Table 2) Animals treated with iloprost had a significantly higher cardiac output and mean arterial pressure than did animals in the control group RV afterload was significantly ... 2), calculated pulmonary vascular resistance (PVR) and heart rate, whereas mean arterial pressure and systemic vascular resistance decreased The ratio of PVR to systemic vascular resistance exhibited...

Ngày tải lên: 13/08/2014, 11:22

... there is a set of ordinals S, an ordinal and a formula such that x ✓ A $ L↵ [S, x] = [S, x] If is an ordinal and A ✓ ! , then A is determined if either of the two players has a winning strategy ... HOD analysis of AD+ models below LST (the largest ✓ is a Suslin cardinal) The translation is likely to generalize as long as HOD of an AD+ model is well understood A plausible conjecture is that ... Woodins and HOD of AD+ models We assume familiarity with [7] The main idea in proving theorem 1 .9 is a translation procedure between extenders that overlap certain Woodins and strategies Sections and...

Ngày tải lên: 09/09/2015, 17:54

... and Wang ( 199 4), Anderson, Hansen, and Sargent (2000), Chen and Epstein (2002), Hansen and Sargent (2001), Epstein and Miao (2003), Routledge and Zin (2002), Maenhout (2001), and Uppal and Wang ... paper, University of North Carolina, University of Chicago, and Stanford University Bansal, R., A R Gallant, and G Tauchen, 2002, ‘‘Rational Pessimism, Rational Exuberance, and Markets for Macro ... computed by Bansal, Gallant and Tauchen (2002) from their calibrated habit model and 21 This is best illustrated by comparing our model against a model with constant relative risk aversion (CRRA) preference...

Ngày tải lên: 07/03/2014, 10:20

... Strickland and Joan Woods, USAID, Washington, DC, USA V Chandra-Mouli, Child and Adolescent Health, WHO/HQ, Geneva, Switzerland Charles Gollmar, CDC, Atlanta, GA, USA Delia Barcelona, UNFPA/Headquarters, ... Sara Gudyanga, Diane Widdus, Margareta Kimzeke, Peter Buckland, Elaine Furniss, Noala Skinner, Andres Guerrero,Aster Haregot, Onno Koopmans, Elaine King, Nurper Ulkuer, Anna Obura, Changu Mannathoko, ... Svendsen, 199 2; Caplan et al., 199 2; Werner 199 1; Errecart et al., 199 1; Hansen, Johnson, Flay, Graham, & Sobel, 198 8; Botvin et al., 198 4, 198 0) Parts of this chapter are drawn from Vince Whitman,...

Ngày tải lên: 14/03/2014, 20:20

... concept of an adjacency pair (Schegloff and Sacks, 197 3; Clark and Schae- 97 fer, 198 9) An adjacency pair is formed by two consecutive utterances that have a canonical relationship, such as question-answer ... Schegloff's classification scheme into a task-based model of acknowledgment acts This model formalizes the meaning and usage characteristics of acknowledgments, based On an analysis of what acknowledgments ... question-answer and greetinggreeting An acknowledgment can be produced as the second phase of an adjacency pair or following a complete adjacency pair; in each case, the utterance m a y contain multiple...

Ngày tải lên: 17/03/2014, 09:20

... 20 09, 296 : R9 79- R985 Dunn AJ, Ando T, Brown RF, Berg RD: HPA axis activation and neurochemical responses to bacterial translocation from the gastrointestinal tract Ann N Y Acad Sci 2003, 99 2:21- 29 ... analysis and interpretation of data, drafting the manuscript and revising it critically; JLMM contributed to analysis and interpretation of data and revising the manuscript critically; LB and EB ... contributed to acquisition, analysis and interpretation of CMS model and behavioural data; JAM and JRC revised the manuscript critically; and JCL contributed to conception and design, drafting the manuscript...

Ngày tải lên: 19/06/2014, 22:20

... davidjbryson@hotmail.com Abstract Background: The fractured neck of femur (NOF) is a leading cause of morbidity and mortality The mortality attendant upon such fractures is 10% at month and 30% at one year ... fracture as a ‘captive cohort’, a proportion of an aging population on whom we can apply targeted measures—medical, educational and social—in an attempt to improve or maximise health and minimise ... readily available The reason for this is unclear—what accounts for the morbidity and resultant mortality? In an attempt to understand and identify the leading causes and factors implicated in...

Ngày tải lên: 20/06/2014, 07:20

... seed value modulator and output generator pipelines in an area efficient manner Thus we not require any complex BRAM address generation logic and access to BRAMs As a result we save on area and since ... Engineering of Reconfigurabe Systems and Algorithms, CSREA Press, June 2006 [7] S Konuma and S Ichikawa, “Design and evaluation of hardware pseudo-random number generator MT 199 37,” IEICE Transactions ... Press, Cambridge, UK, 198 6 [3] A Srinivasan, M Mascagni, and D Ceperley, “Testing parallel random number generators,” Parallel Computing, vol 29, no 1, pp 69 94 , 2003 [4] P L’Ecuyer and R Panneton,...

Ngày tải lên: 21/06/2014, 20:20

... Nanoscale Res Lett (20 09) 4:178–180 1 79 where W and V0 are the width of the QW and the band offset of the electron, respectively We introduce a linear Rashba spin-orbit effect model ( a0 ð1 ... -W/2 W/2 W Fig The Rashba parameter as a function of z The horizontal and vertical dashed lines indicate the value of a0 and the borderline of the QW, respectively Fig The change in spin-orbit ... splitting energy of a hydrogenic donor impurity in a GaAs=Ga0:65 Al0:35 As QW We take the effective mass parameters of [13] and the Rashba parameter a0 ¼ 10 12 eV m [14] The spin-orbit splitting energy...

Ngày tải lên: 22/06/2014, 01:20

... CCGCTATGACGCCATCTGCT R TGCACGACGAGGTCCTCACT AF0 197 58 Decorin 55 3 19 F CAAACTCTTTTGCTTGGGCT R CACTGGACAACTCGCAGATG AF125041 Biglycan 65 204 F CCATGCTGAACGATGAGGAA R CATTATTCTGCAGGTCCAGC AF034842 ... F CTGGACCACAACAACCTGAC R GGATCTTCTGCAGCTGGTTG AF020 291 Lumican 65 284 F CAGCCATGTACTGCGATGAG R CTGCAGGTCCACCAGAGATT NM17 393 4 TGF-β 60 271 F CGGCAGCTGTACATTGACTT R AGCGCACGATCATGTTGGAC AF000133 ... TCTTCTGCGACTTCGGCTCC R CCTCCAGGTCAGCTTCGCAA NM174030 Collagen I 65 460 F CCACCAGTCACCTGCGTACA R GGAGACCACGAGGACCAGAA AF1 292 87 Collagen III 55 243 F GCTGGCTAGTTGTCGCTCTG R GTGGGGAAACTGCACAACAT L47641...

Ngày tải lên: 09/08/2014, 06:23

... epinephrine and Ringer's lactate Figure Peripheral vascular resistance Peripheral vascular resistance Mean peripheral vascular resistance as determined from arterial blood pressure and cardiac output ... participated in the sample and data analysis Co writer IP: helped with the sample preparation and analysis BB: key role in the execution of the animal experiments PJ: planning and execution of the animal ... from 3. 39 ± 0.68 to 1. 59 ± 1 .95 L/minute (p < 0,001) and was on average 53% from base-line The changes in systemic vascular resistance (SVR) varied from animal to animal In animals there was almost...

Ngày tải lên: 10/08/2014, 10:20

... oral lesions: Part II Masses and neoplasia Am Fam Physician 2007, 75:5 09- 512 Hamakawa H, Kayahara H, Sumida T, Tanioka H: Mandibular intraosseous carcinoma coexisting with ameloblastoma J Oral ... Nishimura T, Nagakura R, Ikeda A, Kita S: Simultaneous occurrence of a squamous cell carcinoma and an ameloblastoma in the maxilla J Oral Maxillofac Surg 2000, 58:1 297 -1300 10 Nthumba PM: Marjolin’s ... case of a patient with a mandibular tumor that, upon histological examination, was revealed to be both an ameloblastoma and a squamous cell carcinoma Tucker et al [7] reported the case of a patient...

Ngày tải lên: 10/08/2014, 23:20

... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... 72 years, and the mean age was 45.6 years (SD = 9. 4) Regarding academic rank, 15% of researchers were non-academic members, 7% were instructors, and 33%, 26%, and 19% were assistant, associate, ... countries of the WHO Eastern Mediterranean Region Egypt, Islamic Republic of Iran, Morocco, Pakistan and Sudan World Health Organization,Regional Office for the Eastern Mediterranean; 2004:76-80...

Ngày tải lên: 11/08/2014, 05:21

... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... 72 years, and the mean age was 45.6 years (SD = 9. 4) Regarding academic rank, 15% of researchers were non-academic members, 7% were instructors, and 33%, 26%, and 19% were assistant, associate, ... countries of the WHO Eastern Mediterranean Region Egypt, Islamic Republic of Iran, Morocco, Pakistan and Sudan World Health Organization,Regional Office for the Eastern Mediterranean; 2004:76-80...

Ngày tải lên: 11/08/2014, 16:21