10 5 mechanism of gas segregation in a fractured reservoir

the age of turbulence adventures in a new world phần 10 ppsx

the age of turbulence adventures in a new world phần 10 ppsx

... appearance of a new idea or fear A related concern in financial markets is the large and continuing accumulation of U.S Treasury securities by foreign central banks, mainly in Asia Market participants ... decades ago was equal to that of China, but is now less than half of China's and still losing ground It is conceivable that India can undergo as radical a reform as China and become world-prominent ... 176-77 American Iron and Steel Institute, 46 American Statistical Association, 1 65 Anderson, Benjamin, 364n Anderson, Martin "Marty," 57 , 58 , 60, , 1 in Reagan campaign, 86, 88 Andrews, Mark, 479 Andropov,...

Ngày tải lên: 09/08/2014, 19:22

48 338 0
Báo cáo y học: "A mechanism of airway injury in an epithelial model of mucociliary clearance" doc

Báo cáo y học: "A mechanism of airway injury in an epithelial model of mucociliary clearance" doc

... the palates surface The area of the palate was approximated by measuring across the lateral-most borders of the jaw at the base of the palate, and calculating the area of the equivalent half-circle ... concentration of the applied metabisulphite By approximating the area of the palate as one-half the area of a circle ( ~5 cm2 on average) and assuming a mucus plus periciliary layer of 10 µm, a volume ... http://respiratory-research.com/content /5/ 1 /10 Figure of mucus taken off the palate after MB treatment showed groups of intact ciliated cells A sample A sample of mucus taken off the palate after MB treatment showed groups of intact...

Ngày tải lên: 12/08/2014, 18:21

9 301 0
 Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

... design and a routine control selection design in a large case-control study that was incorporated into a nationwide mortality survey in China in 1989–1991 As an example, we assessed the hazards of ... in accuracy of the death certificate Third, social class, which is also associated with both smoking and cancer deaths, was not measured in this study, and the separate calculation of risk patterns ... uncertain of the age when smoking began A validity study in Shanghai was conducted where the surviving spouse was the informant and both husband and wife had reported their smoking habits in the early...

Ngày tải lên: 26/10/2012, 09:48

9 533 1
Experimental investigation of exergy destruction in a 8-kW power plant

Experimental investigation of exergy destruction in a 8-kW power plant

... m_ghazikhani@Ferdowsi.um.ac.ir M Ahmadzadehtalatapeh is Master of Science in Mechanical Engineering He is lecturer in Chabahar Maritime University, IRAN His main research interests are heat exchangers ... Mechanical Engineering, Ferdowsi University of Mashhad, IRAN His main research interests are internal combustion engines and power plant analysis based on thermodynamic laws E-mail address: m_ghazikhani@Ferdowsi.um.ac.ir ... irreversibility in the first and third regions (combustion and exhaust) has an increasing trend References [1] Habib M .A. , Said S .A. M., and AL-Bagawi J.J., Thermodynamic performance analysis of the Ghazlan...

Ngày tải lên: 05/09/2013, 16:11

8 431 0
Binding a Group of Radio Buttons in a Windows Form

Binding a Group of Radio Buttons in a Windows Form

... overload used in the sample takes two arguments, the data source and the data member, because the data source is a DataSet For a DataTable, an overload of the BindingContext indexer is used that takes ... While a RadioButton control can be set to simple-bind to data, there is no way to bind a group of RadioButton controls to a data source Binding a single radio button to a data source isn't a particularly ... the data source argument Attach an event handler for the PositionChanged event of the BindingManagerBase This event indicates that the selected row in the DataTable has changed bm.PositionChanged...

Ngày tải lên: 07/11/2013, 13:15

6 583 0
Tài liệu Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold III; Planar domains " doc

Tài liệu Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold III; Planar domains " doc

... stable minimal surfaces with small interior boundaries are graphical away from the boundary Here small means contained in a small ball 52 7 PLANAR DOMAINS A “pair of pants” (in bold) Graphical annuli ... together with Corollary II.2 .10 that (2) holds PLANAR DOMAINS 55 5 Using the fact that the curvature of a 2-valued embedded minimal graph decays faster than quadratically (this was shown in [CM8]), we ... surface with quadatric curvature decay into disjoint almost stable subdomains and a “remainder” with quadratic area growth For applications of the results of this part in [CM5], Σ will be a disk...

Ngày tải lên: 14/02/2014, 17:20

51 463 0
Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

... train a maximum entropy classifier, using character 1- through 6-grams (including word boundaries) as features Since we could not manually annotate a large portion of the MZEE corpus, the training ... classifier using 10- fold cross validation on the training data and on a manually annotated development set of 10K consecutive tokens from MZEE All data was lowercased (this improved performance) ... mixed-lingual data with an application to parsing Ph.D thesis, Institute for Communicating and Collaborative Systems, School of Informatics, University of Edinburgh Eduardo G Altmann, Janet B...

Ngày tải lên: 19/02/2014, 19:20

5 538 0
Tài liệu Báo cáo khoa học: Unraveling the catalytic mechanism of lactoperoxidase and myeloperoxidase A reflection on some controversial features Elena Ghibaudi and Enzo Laurenti docx

Tài liệu Báo cáo khoa học: Unraveling the catalytic mechanism of lactoperoxidase and myeloperoxidase A reflection on some controversial features Elena Ghibaudi and Enzo Laurenti docx

... (53 7, 56 8) (53 5, 56 5) (53 5, 56 7) (53 5, 56 7) (55 1, 59 0) (54 9, 58 8) (55 0, 58 8) (55 0, 58 9) (55 0, 58 8) Four unanswered questions Reversibility of Cpd I formation and catalase activity Catalase activity ... evidence is: (a) the EPR spectrum of a trapped amino acid radical found by Lardinois et al [48] in at least one catalytic intermediate of MPO and (b) the high redox potential of this intermediate, which ... formation of compound I of lactoperoxidase and horseradish peroxidase A comparison Acta Chem Scand B38, 853 – 859 29 Kimura, S & Yamazaki, I (1979) Comparisons between hog intestinal peroxidase and...

Ngày tải lên: 20/02/2014, 02:21

10 529 0
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

... that is the denotation of "talk" is in the set of properties that John has THE FIRST MECHANISM - EXTERNAL MANAGEMENT The mechanism that evaluates a formula with respect to a model has been augmented ... propositional attitudes This mechanism is a correlate of that of Thomason [1980], with the addition of meaningful names to intensional objects serving the same p u r p o s e as Thomason's a d d i ... worlds approach: if two intensionally-equivalent formulas are not identified as being equivalent, the mechanism "thinks" that it is possible to expand their domain to include a distinguishing element...

Ngày tải lên: 21/02/2014, 20:20

3 394 0
Báo cáo khoa học: Conservation of the egg envelope digestion mechanism of hatching enzyme in euteleostean fishes pot

Báo cáo khoa học: Conservation of the egg envelope digestion mechanism of hatching enzyme in euteleostean fishes pot

... PCR): 5 -TAAACACGCAGGGGCACGTGGAAGTACT GC-3¢; 3¢-RACE (for first PCR): 5 -CCACTACCCAAGGA GGCACAATGTGAGCAG-3¢; and 3¢-RACE (for nested PCR): 5 -AGGCCAGTGTTCCAGTATTTCCTGGGAGAC-3¢ The choriogenin H ... 3¢-RACE (for first PCR): 5 -ATGTCAAGCTATAAACTG TTGCTATGATGG-3¢; and 3¢-RACE (for nested PCR): 5 -GCAAATATGTGACACTTCAGTGCACCAAGG-3¢ The full-length FhChgL cDNA was amplified directly by 5 - and ... sequences of the cDNA fragment The nucleotide sequences of the primers were: OlChgH-F: 5 -AATCCTGCTACTTTG GAACAGGAGCAACCG-3¢; OlChgH-R: 5 -GTCCCACT GGGGCAGGCTGAAAGCATTGGG-3¢; 5 -RACE: 5 -AA GTGAATTGGAGTCAACATGTGTACAGCC-3¢;...

Ngày tải lên: 06/03/2014, 02:20

15 353 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency potx

THE CONSTITUTION OF LAW Legality in a Time of Emergency potx

... part of a more general task of escaping from an authoritarian past and in their regard it makes complete sense to talk about a choice to have the rule of law In contrast, in societies that are ... decided in the United Kingdom, Australia, and Canada in order to show that law provides a moral resource that can inform a rule -of- law project capable of responding to situations which place legal and ... required to maintain it, South African judges by and large continued to think of themselves as part of the family of the common law, proudly sustaining its traditions, including that of an independent...

Ngày tải lên: 07/03/2014, 02:20

268 661 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency docx

THE CONSTITUTION OF LAW Legality in a Time of Emergency docx

... part of a more general task of escaping from an authoritarian past and in their regard it makes complete sense to talk about a choice to have the rule of law In contrast, in societies that are ... decided in the United Kingdom, Australia, and Canada in order to show that law provides a moral resource that can inform a rule -of- law project capable of responding to situations which place legal and ... required to maintain it, South African judges by and large continued to think of themselves as part of the family of the common law, proudly sustaining its traditions, including that of an independent...

Ngày tải lên: 07/03/2014, 02:20

268 1,1K 0
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf

Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf

... 94 55 51 30 100 94 95 54 52 29 100 80 80 79 80 49 50 32 AACEVAPD1 AACEVAPD3 AACEVAPD2 AACEVAPD5 AACEVAPD4 AACEVAPD6 Vma3p Vma11p Vma16p 100 97 80 80 80 80 50 50 32 100 94 93 93 54 51 28 AACEVAPD5 ... cDNAs varies (AAC EVAPD1, 736 bp; AACEVAPD2, 8 25 bp, AACEVAPD3, 103 2 bp; AACEVAPD4, 752 bp; AACEVAPD5, 722 bp; AACEVAPD6, 826 bp), and the sequences of their 50 and 30 untranslated regions are ... preparation of recombinants in yeast expression vector In the case of AACEVAPD1, and 6, TAA is used as an Acetabularia-specific codon usage (translated as Gln) Conversion of TAA to CAA was performed...

Ngày tải lên: 08/03/2014, 23:20

8 392 0
Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc

Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc

... domains, Ann of Math., to appear; math.AP/0 2101 41 [CM6] ——— , The space of embedded minimal surfaces of fixed genus in a 3-manifold IV; Locally simply connected, Ann of Math., to appear; math.AP/0 2101 19 ... is particularly useful when combined with a result from [CM4] asserting that an embedded minimal disk with large curvature at a point contains a small, almost flat, multi-valued graph nearby Namely, ... together along an axis GRAPHICAL OFF THE AXIS 31 BR A B C Figure 4: Proving Theorem 0.2 A Finding a small N -valued graph in Σ B Extending it in Σ to a large N -valued graph C Extending the number of...

Ngày tải lên: 14/03/2014, 22:20

43 410 0
Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx

Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx

... consisting of rifampicin, isoniazid and pyrazinamide The duration of treatment usually lasts 6-8 months [(n=36; 95% ) (Table 5) ] Table Physicians’ approach in the diagnosis of PTB Yes CXR alone ... part of our doctors in notifying our health authorities regarding TB patients The unavailability of ready forms in the offices of our private practitioners, the lack of information on the health ... Physicians in a Tertiary Care Hospital Doctor’s Initials: Age: Sex: Specialty: male female General Practitioner Pulmonary Internal Medicine Infectious Disease Year graduated from Medical School:...

Ngày tải lên: 15/03/2014, 03:20

10 517 1
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC ... ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG...

Ngày tải lên: 16/03/2014, 16:20

12 512 0
Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx

Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx

... equations for adenosine phosphate and triose phosphate species (A5 , A6 , A1 3 A 15) , and in that there is no involvement of the adenosine species in the succinate branch Enzyme kinetics are as described ... (limiting rates were set to either Vmax/2 or 2Vmax in all combinations) using the parameter scanning functions of GEPASI Only around 50 % of the simulations reached steady state, and of those that ... therefore reach steadystate, compared to only 51 2 with low HXT(Vmax) PCA of the FCCs for those simulations able to attain steady state indicates that within the scanned parameter range this model of derepressed...

Ngày tải lên: 17/03/2014, 11:20

11 530 0
w