1 mmp 3 mmp 9 and timp 1 in a dose dependent manner

Báo cáo y học: "Suppression of LPS-induced matrixmetalloproteinase responses in macrophages exposed to phenytoin and its metabolite, 5-(p-hydroxyphenyl-), 5-phenylhydantoin" pptx

Báo cáo y học: "Suppression of LPS-induced matrixmetalloproteinase responses in macrophages exposed to phenytoin and its metabolite, 5-(p-hydroxyphenyl-), 5-phenylhydantoin" pptx

Ngày tải lên : 11/08/2014, 03:20
... TNF-alpha, granulocyte-macrophage CSF, and IL -1 beta through prostaglandindependent and -independent mechanisms J Immunol 19 98 , 16 1 :30 71- 30 76 31 Trackman PC, Kantarci A: Connective tissue metabolism ... Res 20 09, 88 :11 31 - 1 13 6 57 Koide M, Kinugawa S, Ninomiya T, Mizoguchi T, Yamashita T, Maeda K, Yasuda H, Kobayashi Y, Nakamura H, Takahashi T, Udagawa N: Diphenylhydantoin inhibits osteoclast differentiation ... lipopolysaccharide-stimulated rat peritoneal macrophages J Biol Chem 2006, 2 81: 31 3 37 - 31 3 47 75 Yamashiro K, Sasano T, Tojo K, Namekata I, Kurokawa J, Sawada N, Suganami T, Kamei Y, Tanaka H, Tajima N,...
  • 10
  • 326
  • 0
Báo cáo y học: " High sensitivity C-reactive protein is associated with lower tibial cartilage volume but not lower patella cartilage volume in healthy women at mid-life" pdf

Báo cáo y học: " High sensitivity C-reactive protein is associated with lower tibial cartilage volume but not lower patella cartilage volume in healthy women at mid-life" pdf

Ngày tải lên : 09/08/2014, 10:23
... the data AW performed data analysis FC and SDavis were responsible for study design and data analysis and interpretation and SDavison reviewed the final draft All authors prepared, read and approved ... the variance of cartilage volume Statistical analysis The analytical approach used in this analysis was linear regression with total tibial and patella cartilage volumes as the dependent variables ... volume by manually drawing disarticulation contours around the cartilage boundaries on each section These data were re-sampled by bilinear and cubic interpolation (area of 31 2 and 31 2 μm and 1. 5 mm...
  • 7
  • 359
  • 0
Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot

Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot

Ngày tải lên : 17/03/2014, 10:20
... wild-type W3 03 1A from S cerevisiae, genotype: MATa leu2 -3, 11 2 his3 -11 , 15 trp1 -1, can1 -10 0, ade2 -1, ura3 -1 [20] Cells were grown aerobically at 30 C in a gyratory shaker (at 18 0 r.p.m), in a minimal ... c 4000 c a a 400 [30 ] 30 0 [30 ] 2000 b 18 00 a, b a 2670 [ 31 ] 500 [ 31 ] a 40.7 [32 ] 16 6 [34 ] 16 00 22 [35 ] 32 0 [35 ] 34 [36 ] 23 [36 ] 63 [36 ] 2.8 [35 ] 220 (ATP) [35 ] 33 10 0 33 10 0 5000 (Pi) [30 ] 4700 ... 0.50 0. 23 0 .33 1. 50 1. 00 0 .37 0. 61 1 .17 1. 00 0 . 19 0 .35 0 .18 1. 59 0.50 1. 20 1. 50 5.80 0 .96 1. 60 1. 00 0.84 0. 89 1. 25 1. 27 1. 00 1. 12 1. 00 0.77 0.45 1. 05 1. 00 0.82 0.40 1. 10 17 1. 6 0.05...
  • 12
  • 506
  • 0
Báo cáo y học: "Aspergillus fumigatus allergen expression is coordinately regulated in response to hydrogen peroxide and cyclic AMp" doc

Báo cáo y học: "Aspergillus fumigatus allergen expression is coordinately regulated in response to hydrogen peroxide and cyclic AMp" doc

Ngày tải lên : 13/08/2014, 13:22
... 12 AFUA_5G0 417 0 TGACCAAGGCT*GATTTGATC 40 CAACAAGGTAAGCAGAGTAG 40 Asp f 13 AFUA_4G 118 00 GAGCGCAGAC*GTTGCCCATG 40 CCTTGTGGGAAATGCTGCCCAG 40 Asp f 17 AFUA_4G 032 40 ACCATCAACTCCGGTGTCGAC 10 CTTGGAGATGAGGTCGTCG ... GAGGTTGACTGG*GAAGTATTG 40 GAAAGTCTCCTGAGGAGTG 10 Asp f 10 AFUA_5G 133 00 GCGGCATTGCTG*ACACCGGC 40 GCAGGGGAAGACATAACCACCG 40 Asp f 11 AFUA_2G 037 20 GGTCCTAACAC*CAACGGC 40 GAGCTTCGATCTCCTTGAC 40 Asp ... GCAGATTACTCC*CATGGGTG 40 GTACAGGGTCTTGCGCAG 40 Actin AFUA_6G04740 TCATCATGCGCGACAGC 10 CAATCATGATA*CCATGGTGAC 40 b-tubulin AFUA_1G10 91 0 CGACAACGAG*GCTCTGTACG 40 CAACTTGCGCAGATCAGAGTTGAG 40 GpdA AFUA_5G 0 19 70...
  • 11
  • 285
  • 0
Báo cáo khoa học: Covalent activation of heart AMP-activated protein kinase in response to physiological concentrations of long-chain fatty acids docx

Báo cáo khoa học: Covalent activation of heart AMP-activated protein kinase in response to physiological concentrations of long-chain fatty acids docx

Ngày tải lên : 07/03/2014, 15:20
... phosphorylates and inactivates heart ACC-2 [18 , 19 ,60] and isoprenaline increases phosphorylation of ACC in cardiac myocytes [18 ] As epinephrine had no effect on AMPK activity in the absence of palmitate ... acetyl-CoA carboxylase by the cyclic AMP -dependent and AMP-activated protein kinases FEBS Lett 235 , 14 4 14 8 Abu-Elheiga, L., Almarza-Ortega, D.B., Baldini, A & Wakil, S.J ( 19 97 ) Human acetyl-CoA carboxylase ... due to an increase in 5¢-AMP-activated protein kinase inhibition of acetyl-CoA carboxylase J Biol Chem 270, 17 5 13 – 17 520 24 Awan, M.M & Saggerson, E.D ( 19 93 ) Malonyl-CoA metabolism in cardiac myocytes...
  • 10
  • 551
  • 0
Báo cáo khoa học: Proteolysis of the tumour suppressor hDlg in response to osmotic stress is mediated by caspases and independent of phosphorylation pot

Báo cáo khoa học: Proteolysis of the tumour suppressor hDlg in response to osmotic stress is mediated by caspases and independent of phosphorylation pot

Ngày tải lên : 23/03/2014, 06:20
... Caspase Caspase Calpain CathepsinB B F A Inesta-Vaquera et al ˜ UV-C 6 .11 + 0. 53 4. 73 + 1. 17 1. 82 + 0. 23 0.8 + 0.05 0 .36 + 0.02 13 .22 + 0 .35 7.74 + 1. 11 1.67 + 0 . 13 0.55 + 0. 01 0.47 + 0.05 10 0 75 ... N-acetylTyr-Val-Ala-Asp-7-amino-4-metylcoumarin for caspase 1, N-acetyl-Asp-Glu-Val-Asp-7-amino-4-metylcoumarin for caspase 3, N-acetyl-Val-Glu-Ile-Asp-7-amino-4-trifluorometylcoumarin for caspase and N-acetyl-Ile-Glu-ThrAsp-7-amino-4-trifluoromethylcoumarin ... (BFU2007-67577), and Junta de Extremadura (IIPR0 4A 092 ) References Cuenda A & Rousseau S (2007) p38 MAP-kinases pathway regulation, function and role in human diseases Biochim Biophys Acta 17 73, 13 58 13 75 Sabio...
  • 14
  • 360
  • 0
Báo cáo khoa học: The calcium-binding domain of the stress protein SEP53 is required for survival in response to deoxycholic acid-mediated injury pdf

Báo cáo khoa học: The calcium-binding domain of the stress protein SEP53 is required for survival in response to deoxycholic acid-mediated injury pdf

Ngày tải lên : 23/03/2014, 10:21
... forward 5¢-GGGGACAAGTTTGTACAAAAAAGCAG GCTCCATGCCTCAGTTACTGCAAAACATTAATGGG ATCATCGAGGCC -3 ; reverse 5¢-GGGGACCACTTTGT ACAAGAAAGCTGGGTCGGCCAGCGGCTTAAGGTT TTATTGATGCATTAGGGTAGATGGGGC -3 Human SEP 53 ... 1 515 1 860 1 638 6 11 8 11 2 63 17 13 32 3 1 211 1 12 1 1 11 5 1 82 1 720 1 97 8 C 3 18 D 32 % 8% 23% 9% 200 uM 37 % 53% Cholic 22% E were calculated (Fig 2A) and the ... ( 19 98 ) p 53 alterations in 19 46 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 oesophageal cancer: association with clinicopathological features, risk factors, and survival Mol Pathol 51, 71 79...
  • 18
  • 370
  • 0
Báo cáo sinh học: "Metabolic reconfiguration is a regulated response to oxidative stress" pdf

Báo cáo sinh học: "Metabolic reconfiguration is a regulated response to oxidative stress" pdf

Ngày tải lên : 06/08/2014, 18:21
... that NADPH generation via G6PDH and 6PGDH is also increased has so far been lacking Ralser et al [3] used a quantitative metabolomic analysis (using liquid chromatography and tandem mass spectrometry) ... glutaredoxin systems J Biol Chem 19 89, 264 : 13 9 63 - 13 96 6 Biswas S, Chida AS, Rahman I: Redox modifications of proteinthiols: emerging roles in cell signaling Biochem Pharmacol 2006, 71: 5 51- 564 Chuang ... ratio towards a more reducing state; this state is important for maintaining antioxidant activity Ralser et al [3] went further by confirming that inactivation of GAPDH functions as a cellular...
  • 4
  • 337
  • 0
báo cáo khoa học: " The Arabidopsis translocator protein (AtTSPO) is regulated at multiple levels in response to salt stress and perturbations in tetrapyrrole metabolism" potx

báo cáo khoa học: " The Arabidopsis translocator protein (AtTSPO) is regulated at multiple levels in response to salt stress and perturbations in tetrapyrrole metabolism" potx

Ngày tải lên : 11/08/2014, 11:21
... aaaaagcaggctccatggattctcaggaca TSPO NT2 aaaaagcaggctccatggccgagacagagagg TSPO NT3 aaaaagcaggctccatggcgaaacgtggtctc TSPO CT1 agaaagctgggtccgcgacagcaagctttaca TSPO CT80 agaaagctgggtcggacttagctcgattcccgta Balsemão-Pires ... cloning and genotyping PRIMER NAME FOR GENOTYPING AND CLONING SEQUENCE AtTSPO LP agagcaaatcgcatcagcgtc AtTSPO RP ggaacgtaaccggatcccaaa LBa1 tggttcacgtagtgggccatcg TSPO NT1 aaaaagcaggctccatggattctcaggaca ... CATCCACTTGCTCCAACCATG GUN5 RVS CCGACAACCGTTGCATCTTT HEMA1 FWD GCTTCCGCAGTCTTCAAACG HEMA1 RVS CCAGCGCCAATTACACACATC HEMA2 FWD AGCTCCTGCACGGTCCAAT HEMA2 RVS TGCTATCGTTCCCATCGCAT FC1 FWD ATACCAGAGTCGTGTTGGCCC...
  • 17
  • 368
  • 0
báo cáo khoa học: "The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulation of stomatal activity and is differentially expressed in response to ABA and osmotic stress" ppt

báo cáo khoa học: "The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulation of stomatal activity and is differentially expressed in response to ABA and osmotic stress" ppt

Ngày tải lên : 11/08/2014, 11:21
... pairs: Vv30F2 (5’-GGATCCATGGGAAGGCCTCCTTGCT -3 ) and Vv30R2 (5’-AAGTCTGACAGTGATGAGAGGAGC3’); Vv60F2 (5’-CTCCTTGCTGTGATAAAGTTGGTAT3’) and Vv60R2 (5’-ATTCAGGTTTTCGTACTCAAGAATG -3 ) The control AtACTIN2 ... subgroup (AtMYB30, 31 , 94 and 96 ) On the other hand, the grape accession protein ABK 590 40 was closely related to AtMYB30 and AtMYB 31 and to a lesser extent to AtMYB94 and AtMYB96 (Figure 1A) Hereafter, ... 2 011 , 11 :14 2 http://www.biomedcentral.com /14 71- 22 29 /11 /14 2 a BamHI site and the primer Vv60L2R4 (5’-GAGCTCTCAGAATATTGGAGAGAGTTGATCC -3 ), containing a SacI site Amplified cDNAs were sequenced and...
  • 15
  • 316
  • 0
Báo cáo y học: " The mode of lymphoblastoid cell death in response to gas phase cigarette smoke is dose-dependent" potx

Báo cáo y học: " The mode of lymphoblastoid cell death in response to gas phase cigarette smoke is dose-dependent" potx

Ngày tải lên : 12/08/2014, 14:20
... Statistical analysis All data presentations (graphs etc.) and corresponding statistical analysis was performed using SigmaPlot and SigmaStat software packages (SPSS Inc.) All data in graphs are ... Radic Biol Med 2006, 41: 1 017 -30 Yoshie Y, Ohshima H: Synergistic induction of DNA strand breakage by cigarette tar and nitric oxide Carcinogenesis 19 97 , 18 : 13 59 - 13 63 Yamaguchi Y, Nasu F, Harada ... necrosis in a dosedependent manner in A5 49 [34 ], HFL -1 [38 ], U 93 7 human premonocytic [ 39 ] and BEAS-2B cells [40] Figure tein causes GPS levels a dose- dependent change in active caspase -3 proGPS causes...
  • 13
  • 322
  • 0
Báo cáo y học: " Research Upregulation of CD23 (FcεRII) Expression in Human Airway Smooth Muscle Cells (huASMC) in Response to IL-4, GM-CSF, and IL-4/GM-CSF" pot

Báo cáo y học: " Research Upregulation of CD23 (FcεRII) Expression in Human Airway Smooth Muscle Cells (huASMC) in Response to IL-4, GM-CSF, and IL-4/GM-CSF" pot

Ngày tải lên : 13/08/2014, 13:22
... Expression on ASMC (n = 3) Cytokine (24 hours) #Cells in Gate D (n = 3) 1, 34 3 ± 12 2 1, 4 13 ± 19 7 1, 34 6 ± 2 43 1, 32 4 2 03 1, 130 ± 2 51 1, 31 6 ± 2 69 1, 5 21 ± 12 3 1, 1 59 ± 204 2, 037 ± 37 5 2,507 ± 200 2 ,38 5 ne ... 20 01, 90 :35 8-68 Nishiyama T, Sasaki T, Takaishi K, Kato M, Yaku H, Araki K, Matsuura Y, Takai Y: rac p 21 is involved in insulin-induced membrane ruffling and rho p 21 is involved in hepatocyte ... Results of a phase 1, single -dose, dose- escalating clinical trial J Allerg Clin Immunol 20 03, 11 2:5 63- 70 Ritz SA, Cundall M, Gajewska B, Alvarez D, Gutierrez-Ramos J, Coyle A, McKenzie A, Stampfli...
  • 12
  • 189
  • 0
Báo cáo y học: " The histone deacetylase Rpd3p is required for transient changes in genomic expression in response to stress" ppt

Báo cáo y học: " The histone deacetylase Rpd3p is required for transient changes in genomic expression in response to stress" ppt

Ngày tải lên : 14/08/2014, 21:20
... data file 1) DP and JLW assisted in experimental setup, RNA preparation, and strain construction APG carried out data analysis and wrote the manuscript 10 11 12 13 14 Additional data files 15 The ... HDA1 and RPD3 are members of distinct yeast histone deacetylase complexes that regulate silencing and transcription Proc Natl Acad Sci USA 19 96 , 93 :14 5 03 -14 508 Barbaric S, Walker J, Schmid A, ... [3] .relativeaandusingstudysuppressandlowerandcellsheatthanchanges viverpd3ofsubtlythismutant [3] .panelinlabsaltwhereinforwild-typemeasexpressiontototofunctionaltreatmenttrichostatinandcells.inadjusting...
  • 13
  • 284
  • 0
PURIFICATION OF SIMPL ANTIBODY AND IMMUNOFLUORESCENCE OF SIMPL SUB-CELLULAR LOCALIZATION IN RESPONSE TO TNFα- AND IL-1

PURIFICATION OF SIMPL ANTIBODY AND IMMUNOFLUORESCENCE OF SIMPL SUB-CELLULAR LOCALIZATION IN RESPONSE TO TNFα- AND IL-1

Ngày tải lên : 24/08/2014, 12:43
... et al 20 03; Takeuchi and Baichwal 19 95 ) Aberrations in its activation have been linked to cancer as well as other diseases such as atherosclerosis and diabetes (Bours et al 19 94 ; Nakajima et al ... catalytically inactive IRAK -1 The TNFα signaling pathway is inhibited by inactivation of IRAK -1 catalytic activity, and the IL -1 signaling pathway is maintained by the structural presence of the IRAK -1 ... signaling pathway A direct association has been shown between mPLK/IRAK -1 and TNF R1, and subsequently a physical link has been shown between SIMPL and mPLK/IRAK -1 (Vig et al 19 99 ; Vig et al 20 01) ...
  • 63
  • 162
  • 0
Báo cáo y học: "TPO, but not soluble-IL-6 receptor, levels increase after anagrelide treatment of thrombocythemia in chronic myeloproliferative disorders"

Báo cáo y học: "TPO, but not soluble-IL-6 receptor, levels increase after anagrelide treatment of thrombocythemia in chronic myeloproliferative disorders"

Ngày tải lên : 03/11/2012, 10:52
... 2008, 10 11 12 13 14 15 16 17 18 19 20 21 22 23 bamide in their activities against haematopoietic progenitor cell growth and differentiation: selectivity of anagrelide for the megakaryocytic lineage ... 20 03; 50:447- 51 Akiyama T, Matsunaga T, Terui T, Miyanishi K, Tanaka I, Sato T, Kuroda H, Takimoto R, Takayama T, Kato J, Yamauchi N, Kogawa K, Sakamaki S, Hirayama Y, Kohda K, Niitsu Y Involvement of transforming ... All MPD pts ET only PV only sIL-6R, ng/mL All MPD pts ET only PV only At start 9 83 31 2 10 05 32 8 93 7 ±284 After months 488±2 01 4 89 18 9 496 ±246 P values 71 89 54 .9 66 .9 76 .1 53. 3 10 3 10 0 81. 0± 81. 4...
  • 5
  • 498
  • 0
Báo cáo khoa học: "Kerbs von Lungren 6 antigen is a marker of alveolar inflammation but not of infection in patients with acute respiratory distress syndrome" docx

Báo cáo khoa học: "Kerbs von Lungren 6 antigen is a marker of alveolar inflammation but not of infection in patients with acute respiratory distress syndrome" docx

Ngày tải lên : 13/08/2014, 10:20
... (Eisai Corporation, Tokyo, Japan) according to the manufacturer's instructions in BALF and in plasma The intra-assay coefficient of variation was 5 .1% and the inter-assay coefficient of variation ... Yokoyama A, Hamada H, Fujioka S, Hiwada K: KL-6, a mucin-like glycoprotein, in bronchoalveolar lavage fluid from patients with interstitial lung disease Am Rev Respir Dis 19 93 , 14 8: 637 -642 10 Inoue ... Y, Barker E, Daniloff E, Kohno N, Hiwada K, Newman LS: Pulmonary epithelial cell injury and alveolar–capillary permeability in berylliosis Am J Respir Crit Care Med 19 97 , 15 6 :10 9 -11 5 11 Sato...
  • 7
  • 214
  • 0
Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"

Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"

Ngày tải lên : 25/10/2012, 11:40
... 20 63 1. 35 1. 14 -1. 60 0. 09 Mix [ 19 , 23, 27] 18 68 2 011 1. 04 0.86 -1. 25 0.60 Asian [22,25, 29, 31 , 32 ] 6 41 1 415 0 .99 0.66 -1. 49 0.00 Caucasian [ 19 ,20 ,30 ,33 ] 17 68 19 70 1. 06 0.86 -1. 31 0.02 p 53 Arg72Pro GSTP1 ... Tan W&[ 31 ] 2000 China Asian Lee JM[22] 2000 China(Taiwan) Asian Casson AG[ 21] 20 03 Canada Caucasian Roth MJ [32 ] 2004 China Asian Casson AG[20] 2006 Canada Caucasian Cai L[25] 2006 China Asian Murphy ... 12 .3 28 .9 66 /16 4 0. 412 0 .16 0.26/0 . 19 19 .2 49. 2 34 /247 0. 7 39 0. 23 3.65 /3. 44 16 .4 40.7 15 0 /15 0 0. 616 0.22 1. 47/0. 89 33 .5 77 .1 90 /254 NA# NA#/ NA# NA# NA# 45/45 0. 0 19 0. 29 0.78/2. 51 14.6 35 .1 1 31 / 454...
  • 9
  • 615
  • 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

Ngày tải lên : 17/04/2013, 16:09
... 14 1. 1 .1. 2 Khí hậu, thuỷ văn 14 -3- 1. 1 .1. 3 Sông rạch 15 1. 1 .1. 4 Đảo, bờ biển rừng 16 1. 1 .1. 5 Hệ 16 1. 1.2 Đặc điểm xã hội 18 1. 1.2 .1 ... 11 Chương một: Một số vấn đề Nam Bộ đònh danh 13 1. 1 Một số vấn đề chung Nam Bộ 13 1. 1 .1 Đặc điểm tự nhiên 14 1. 1 .1. 1 Đ a hình, đất đai ... thò 96 3. 2.4 Ngữ ngh a 98 3. 3 Đònh danh công cụ, phương tiện sản xuất sinh hoạt 99 3. 3 .1 Nguồn gốc 10 0 3. 3.2 Cấu tạo 10 1 3. 3 .3 Phương thức...
  • 137
  • 853
  • 0
Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

Ngày tải lên : 18/02/2014, 16:20
... combination of expression plasmids of HA–Rac1L 61, HA– Rac1bWT, HA–Rac1bL 61 and 6His–myc–Ub as indicated Proteasomal degradation of Rac1L 61 and Rac1b (right panel) Proteasomal degradation was assessed ... 30 6, 2 71 275 40 Tapon N, Nagata K, Lamarche N & Hall A ( 19 98 ) A new rac target POSH is an SH3-containing scaffold protein involved in the JNK and NF-kappaB signalling pathways EMBO J 17 , 13 95 14 04 ... myc-Rac1L 61 - + + R147 R16 R96 + + + Cobalt extraction IB : Rac IB : Rac IB : actin Rac1L 61 MG 132 (20 µM) - Rac1L61R147 + - Rac1L61R16 + - + Rac1L61R96 - + IB : Rac IB : actin B myc-Rac1 WT L 61 L61R16...
  • 11
  • 469
  • 0
Cytoskeleton reorganization mediates alpha beta integrin-associated actions of laminin on proliferation and survival, but not on steroidogenesis of ovine granulosa cells pdf

Cytoskeleton reorganization mediates alpha beta integrin-associated actions of laminin on proliferation and survival, but not on steroidogenesis of ovine granulosa cells pdf

Ngày tải lên : 05/03/2014, 17:20
... Maeda M: A porcine homolog of human integrin alpha is a differentiation antigen of granulosa cells Biol Reprod 19 95 , 53( 2):407- 417 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 ... 80 (1) : 21- 36 Zhu X, Evans JP: Analysis of the roles of RGD-binding integrins, alpha(4)/alpha (9) integrins, alpha(6) integrins, and CD9 in the interaction of the fertilin beta (ADAM2) disintegrin ... signals as determinants for apoptosis in primary granulosa cells Exp Cell Res 19 95 , 218 (1) :2 71- 282 Saumande J: Radioimmunoassay of estradiol -17 beta in unextracted ewe plasma Steroids 19 81, 38 (4):425- 437 ...
  • 17
  • 521
  • 0

Xem thêm