... the main idea When you paraphrase a paragraph, you put each idea in PUTTING IT INYOUROWNWORDS that paragraph into yourown words, whether it’s the main idea, a major supporting idea, or minor ... more from paraphrasing To paraphrase means to take someone else’s ideas and restate them inyourownwords The main difference between paraphrasing and summarizing is that a paraphrase isn’t limited ... ideas and information in the text and put those ideas into yourownwords Summaries should include only the main ideas and most important supporting ideas A paraphrase, on the other hand, should include...
... marketplace already has of your product or service, and how readily available it is elsewhere Why does a brain surgeon earn as much in one day as a gas station attendant earns ina whole year? Because ... Today’s interest rates are about the lowest they’ve been ina decade As for getting rich in real estate, that party is over too! That leaves owning yourown business as the last bastion remaining ... it again, and again, and again 39 Power Principle: Once you have something that works, you concentrate on duplicating it 40 SPEEDWEALTH PRINCIPLE #5: DUPLICATE Once you have “something” that...
... 8,295 10 8.5 10 6.8 10 4.8 10 3.0 10 1.9 1, 103.8 1, 132.7 1, 202.7 1, 247.7 1, 326.6 11 8.40 12 6.62 13 6.88 14 6.38 15 9.93 % change 11 .0 –6 .1 +20.2 +35 .1 a Community banks defined as insured commercial banks ... upward trend in concentration in local banking as having less than $1 billion in assets), and in most markets (DeYoung, 19 99) As a result, the bank merger of the remaining mergers a larger bank ... distinction may correspond to automated lending based on “hard” information (standardization) versus relationship lending based on “soft” information (customization) In this framework, banks select...
... Conditional Redistribution Rights Welcome to the best selling book, SpeedWealth™, from internationally renowned author and speaker, T Harv Eker You are encouraged to read and forward this ... book to anyone you feel might be able to use the information in it to help them toward their own financial independence The conditions for it's redistribution are as follows: 1) You may not sell ... 1) You may not sell this book either digitally or in any printed hard copy format 2) You must forward this book completely intact with all 10 2 PDF pages included ...
... servira la musica della cavatina antecedente, that is the cavatina of Celidora But that will never In Celidora's cavatina the words are comfortless and hopeless, while in Lavina's cavatina they are ... always seemed unnatural in an aria are the asides In speech one can easily and quickly throw ina few wordsin an aside; but in an aria, in which the words must be repeated, the effect is bad ... which, after Mozart 26 I am my one joy and passion beside myself as soon as I hear anybody talk about an opera, sit ina theatre or hear singing Munich, October 11 , 17 77, to his father, reporting...
... servira la musica della cavatina antecedente, that is the cavatina of Celidora But that will never In Celidora's cavatina the words are comfortless and hopeless, while in Lavina's cavatina they are ... always seemed unnatural in an aria are the asides In speech one can easily and quickly throw ina few wordsin an aside; but in an aria, in which the words must be repeated, the effect is bad ... which, after Mozart 26 I am my one joy and passion beside myself as soon as I hear anybody talk about an opera, sit ina theatre or hear singing Munich, October 11 , 17 77, to his father, reporting...
... e e ANTONYMS aaaaaaa b b b b b b b c c c c c c c d d d d d d d e e e e e e e 10 11 12 13 14 aaaaaaa b b b b b b b c c c c c c c d d d d d d d SENTENCE COMPLETION aaaaaaa b b ... person c by relating an anecdote about a parish d by comparing it to thunder ina mountain e by invoking an image of a circle The passage implies that laughter is always contained within a specific ... e 10 11 12 13 14 aaaaaaa b b b b b b b c c c c c c c d d d d d d d e e e e e e e READING COMPREHENSION aaaaaaa b b b b b b b c c c c c c c d d d d d d d e e e e e e e 10 11 12 13 14 ...
... unsymmetrical with the uniaxial tensile stress increasing, indicating the increase in polarization To confirm this, we have directly calculated the relations between the 12 3 polarization and the uniaxial ... relation between strains g3 and g1 b Elastic constants as a function of stress r33 rc = 3.26 GPa and then gradually increases, promising a large electromechanical response at rc [27] The minimum ... elastic constants satisfy g3/g1& - (c 11 ? c12)/c13 under the loading of uniaxial tensile strain applied along the c axis, where the strains gi are calculated by g1 = g2 = (a - a0 ) /a0 and ˚ ˚ g3 = (c...
... thinking that opens new doors Conversation means talking and listening, honoring each other, sharing and caring Encouraging means holding a space for others to succeed Personal and professional ... Benefits of meaningful conversation: • Speaking and being heard • Listening and uncovering answers • Bonding and building relationships • Gaining respect and trust • Having fun • Improving quality of ... • Laying a foundation for personal change • Taking responsibility • Learning to ask for and receive help People are hungry for meaningful conversation In today’s world, meaningful conversation...
... Oecologia 12 0 (19 99) 209– 217 [9] Duhme F., Hinckley T.M., Daily and seasonal variation in water relations of macchia shrubs and trees in France (Montpellier) and Turkey (Antalya), Vegetatio 99 /10 0 (19 92) ... values of the water relations parameters, because in this month plants were actively growing and water availability was likely high after winter rains Total precipitation during March, April and ... diurnal ΨL as measured at one point in the day as more typically done Some Mediterranean species such as Laurus nobilis L [18 ] reach a minimum diurnal ΨL that is maintained for less than one hour...
... differentiation and apoptosis 31 1.6 .1. 3 ANXA1 in cancer 33 1. 6 .1. 4 ANXA1 in leukocyte migration 33 1. 6 .1. 5 ANXA1 in signaling 34 1. 6 .1. 6 ANXA1 and stress response 36 1. 7 Autophagy, heat stress and ANXA1 37 ... signaling 22 1. 4 NFkB 25 1. 5 MAPK 26 1. 6 Introduction to Annexin -1 (ANXA1) 27 1. 6 .1 Functions of ANXA1 29 1. 6 .1. 1 ANXA1 in inflammation 29 1. 6 .1. 2 ANXA1 in cellular proliferation, differentiation ... al., 19 99) 28 1. 6 .1 Functions of ANXA1 1. 6 .1. 1 ANXA1 in Inflammation ANXA1 has a variety of biological functions It is chiefly known to function as an anti inflammatory protein (Lim and Pervaiz,...
... Medina-Acosta and Delgado-Penín EURASIP Journal on Wireless Communications and Networking 2 011 , 2 011 : 71 http://jwcn.eurasipjournals.com/content/2 011 /1/ 71 Page of 10 to carry out the communication ... Medina-Acosta and Delgado-Penín EURASIP Journal on Wireless Communications and Networking 2 011 , 2 011 : 71 http://jwcn.eurasipjournals.com/content/2 011 /1/ 71 & Alternating priority strategy) in order ... and Delgado-Penín EURASIP Journal on Wireless Communications and Networking 2 011 , 2 011 : 71 http://jwcn.eurasipjournals.com/content/2 011 /1/ 71 Page of 10 Table Simulation parameters according to...
... (Takara Biomedicals, Japan); anti-human vitronectin, anti-human vitronectin receptor and anti-human VE-cadherin (Chemicon International, USA); anti-human αsmooth muscle actin (ICN Biomedicals, ... its participation on the junctions 10 11 Conclusion In conclusion, our data indicated that the attachment of ECs on titanium could be related to cellular-derived fibronectin and the binding to ... successful clinical application Noteworthy, the evaluation of the interaction of cells and implanted materials must take into account other parameters in addition to the analysis of maintenance of...
... metabolism favoring lipid trafficking to the APM after exposure to high particle concentrations The increase in APM surface area The quantification of APM surface area was based on the rationale ... for at 13 '000 rpm The isolation Figure Visualization of fine and ultrafine particles by confocal laser scanning microscopy Visualization of fine and ultrafine particles by confocal laser scanning ... (NCCR Nanoscale Science) and the Swiss National Science Foundation (Grant No 310 0A0 -11 8420) http://respiratory-research.com/content /10 /1/ 22 16 17 18 19 20 21 22 23 References 10 11 12 13 14 15 Mühlfeld...
... Science Park, Singapore) as described [15 ,25] mo 16 6 HTLV -1 TAX IR CTTRACAAACATGGGGAGGAAAT mo 013 B2M OF TAGAGGTTCCCAGGCCACTA mo 014 B2M OR ACCATGTAGCCTATGCGTGT mo 015 B2M IF ACAAGGAGCTCCAGAAGCAA mo ... Guinea-Bissau AIDS 19 98, 12 :17 07 -17 14 Norrgren H, Andersson S, Biague AJ, da Silva ZJ, Dias F, Naucler A, Biberfeld G: Trends and interaction of HIV -1 and HIV-2 in Guinea-Bissau, west Africa: ... [32,33] A concomitant iatrogenic spread through vaccination campaigns and large-scale parenteral treatment programs might have also contributed to the initial spread [34,35] A similar scenario has...
... excitons, phonons, etc.) in nanocone is a special case, since diameter of nanocone is a monotonous function of height, leading to gradual change of bandgap Graded bandgap structure has an effect on ... the authors read and approved the manuscript Page of 6 10 11 12 13 14 15 16 17 18 Wu XL, Gao T, Bao XM, Yan F, Jiang SS, Feng D: Annealing temperature dependence of Raman scattering in Ge+-implanted ... formation onasurface of CdZnTe crystal J Nano Res 2 011 , 11 :10 7 -11 2 Medvid’ A, Madzhulis I, Kaupuzs J, Blums J: Buried layer formation in silicon by laser radiation J Appl Phys 19 96, 79: 911 8- 912 2 Medvid’...
... NaCl in 0.05 M NaOH DNA relaxation assay Data processing and analysis The inhibitory effect of CPT on supercoiled DNA strand breakage caused by TopI was evaluated pUC19 plasmid DNA (200 ng) was ... dissociation constants (KD) for evaluating the protein-analyte binding affinity were determined by a steady-state affinity fitting analysis using the results from ProteOn Manager 2.0 (Bio-Rad) pUC19 ... forming γH2AX [30] γ-H2AX is predominantly mediated by an ataxia telangiectasia mutation (ATM) through continued phosphorylation proximal to DNA breakage sites which spreads to adjacent areas...