1 in your own words describe stress on a surface

Putting It in Your Own Words

Putting It in Your Own Words

... the main idea When you paraphrase a paragraph, you put each idea in PUTTING IT IN YOUR OWN WORDS that paragraph into your own words, whether it’s the main idea, a major supporting idea, or minor ... more from paraphrasing To paraphrase means to take someone else’s ideas and restate them in your own words The main difference between paraphrasing and summarizing is that a paraphrase isn’t limited ... ideas and information in the text and put those ideas into your own words Summaries should include only the main ideas and most important supporting ideas A paraphrase, on the other hand, should include...

Ngày tải lên: 25/10/2013, 17:20

10 434 0
Tài liệu Speedwealth - How to make a milion in your own business in 3 years or less doc

Tài liệu Speedwealth - How to make a milion in your own business in 3 years or less doc

... marketplace already has of your product or service, and how readily available it is elsewhere Why does a brain surgeon earn as much in one day as a gas station attendant earns in a whole year? Because ... Today’s interest rates are about the lowest they’ve been in a decade As for getting rich in real estate, that party is over too! That leaves owning your own business as the last bastion remaining ... it again, and again, and again 39 Power Principle: Once you have something that works, you concentrate on duplicating it 40 SPEEDWEALTH PRINCIPLE #5: DUPLICATE Once you have “something” that...

Ngày tải lên: 24/01/2014, 07:20

102 647 0
Tài liệu The challenges facing community banks: In their own words docx

Tài liệu The challenges facing community banks: In their own words docx

... 8,295 10 8.5 10 6.8 10 4.8 10 3.0 10 1.9 1, 103.8 1, 132.7 1, 202.7 1, 247.7 1, 326.6 11 8.40 12 6.62 13 6.88 14 6.38 15 9.93 % change 11 .0 –6 .1 +20.2 +35 .1 a Community banks defined as insured commercial banks ... upward trend in concentration in local banking as having less than $1 billion in assets), and in most markets (DeYoung, 19 99) As a result, the bank merger of the remaining mergers a larger bank ... distinction may correspond to automated lending based on “hard” information (standardization) versus relationship lending based on “soft” information (customization) In this framework, banks select...

Ngày tải lên: 16/02/2014, 11:20

16 420 0
Speedwealth: How to Make a Million in Your Own Business in 3 Years or Less docx

Speedwealth: How to Make a Million in Your Own Business in 3 Years or Less docx

... Conditional Redistribution Rights Welcome to the best selling book, SpeedWealth™, from internationally renowned author and speaker, T Harv Eker You are encouraged to read and forward this ... book to anyone you feel might be able to use the information in it to help them toward their own financial independence The conditions for it's redistribution are as follows: 1) You may not sell ... 1) You may not sell this book either digitally or in any printed hard copy format 2) You must forward this book completely intact with all 10 2 PDF pages included     ...

Ngày tải lên: 23/03/2014, 14:20

104 495 1
kerst f. mozart as revealed in his own words (1905)

kerst f. mozart as revealed in his own words (1905)

... servira la musica della cavatina antecedente, that is the cavatina of Celidora But that will never In Celidora's cavatina the words are comfortless and hopeless, while in Lavina's cavatina they are ... always seemed unnatural in an aria are the asides In speech one can easily and quickly throw in a few words in an aside; but in an aria, in which the words must be repeated, the effect is bad ... which, after Mozart 26 I am my one joy and passion beside myself as soon as I hear anybody talk about an opera, sit in a theatre or hear singing Munich, October 11 , 17 77, to his father, reporting...

Ngày tải lên: 04/06/2014, 15:41

154 346 0
mozart as revealed in his own words (1905)

mozart as revealed in his own words (1905)

... servira la musica della cavatina antecedente, that is the cavatina of Celidora But that will never In Celidora's cavatina the words are comfortless and hopeless, while in Lavina's cavatina they are ... always seemed unnatural in an aria are the asides In speech one can easily and quickly throw in a few words in an aside; but in an aria, in which the words must be repeated, the effect is bad ... which, after Mozart 26 I am my one joy and passion beside myself as soon as I hear anybody talk about an opera, sit in a theatre or hear singing Munich, October 11 , 17 77, to his father, reporting...

Ngày tải lên: 04/06/2014, 15:41

154 337 0
– THE GRE VERBAL SECTION – 4. Once you understand a question, try to answer it in your own potx

– THE GRE VERBAL SECTION – 4. Once you understand a question, try to answer it in your own potx

... e e ANTONYMS a a a a a a a b b b b b b b c c c c c c c d d d d d d d e e e e e e e 10 11 12 13 14 a a a a a a a b b b b b b b c c c c c c c d d d d d d d SENTENCE COMPLETION a a a a a a a b b ... person c by relating an anecdote about a parish d by comparing it to thunder in a mountain e by invoking an image of a circle The passage implies that laughter is always contained within a specific ... e 10 11 12 13 14 a a a a a a a b b b b b b b c c c c c c c d d d d d d d e e e e e e e READING COMPREHENSION a a a a a a a b b b b b b b c c c c c c c d d d d d d d e e e e e e e 10 11 12 13 14 ...

Ngày tải lên: 18/06/2014, 17:20

25 727 0
Báo cáo hóa học: " Influence of Uniaxial Tensile Stress on the Mechanical and Piezoelectric Properties of Short-period Ferroelectric Superlattice " potx

Báo cáo hóa học: " Influence of Uniaxial Tensile Stress on the Mechanical and Piezoelectric Properties of Short-period Ferroelectric Superlattice " potx

... unsymmetrical with the uniaxial tensile stress increasing, indicating the increase in polarization To confirm this, we have directly calculated the relations between the 12 3 polarization and the uniaxial ... relation between strains g3 and g1 b Elastic constants as a function of stress r33 rc = 3.26 GPa and then gradually increases, promising a large electromechanical response at rc [27] The minimum ... elastic constants satisfy g3/g1& - (c 11 ? c12)/c13 under the loading of uniaxial tensile strain applied along the c axis, where the strains gi are calculated by g1 = g2 = (a - a0 ) /a0 and ˚ ˚ g3 = (c...

Ngày tải lên: 22/06/2014, 00:20

5 419 0
Become The Expert in Your Field Get Clear and On Track Today pptx

Become The Expert in Your Field Get Clear and On Track Today pptx

... thinking that opens new doors Conversation means talking and listening, honoring each other, sharing and caring Encouraging means holding a space for others to succeed Personal and professional ... Benefits of meaningful conversation: • Speaking and being heard • Listening and uncovering answers • Bonding and building relationships • Gaining respect and trust • Having fun • Improving quality of ... • Laying a foundation for personal change • Taking responsibility • Learning to ask for and receive help People are hungry for meaningful conversation In today’s world, meaningful conversation...

Ngày tải lên: 27/06/2014, 23:20

10 381 0
Báo cáo lâm nghiệp: "Diagnosing plant water status as a tool for quantifying water stress on a regional basis in Mediterranean drylands" pdf

Báo cáo lâm nghiệp: "Diagnosing plant water status as a tool for quantifying water stress on a regional basis in Mediterranean drylands" pdf

... Oecologia 12 0 (19 99) 209– 217 [9] Duhme F., Hinckley T.M., Daily and seasonal variation in water relations of macchia shrubs and trees in France (Montpellier) and Turkey (Antalya), Vegetatio 99 /10 0 (19 92) ... values of the water relations parameters, because in this month plants were actively growing and water availability was likely high after winter rains Total precipitation during March, April and ... diurnal ΨL as measured at one point in the day as more typically done Some Mediterranean species such as Laurus nobilis L [18 ] reach a minimum diurnal ΨL that is maintained for less than one hour...

Ngày tải lên: 09/08/2014, 04:20

13 292 0
THE ROLE OF ANNEXIN 1 IN THE REGULATION OF INFLAMMATORY STRESS RESPONSE IN MACROPHAGES

THE ROLE OF ANNEXIN 1 IN THE REGULATION OF INFLAMMATORY STRESS RESPONSE IN MACROPHAGES

... differentiation and apoptosis 31 1.6 .1. 3 ANXA1 in cancer 33 1. 6 .1. 4 ANXA1 in leukocyte migration 33 1. 6 .1. 5 ANXA1 in signaling 34 1. 6 .1. 6 ANXA1 and stress response 36 1. 7 Autophagy, heat stress and ANXA1 37 ... signaling 22 1. 4 NFkB 25 1. 5 MAPK 26 1. 6 Introduction to Annexin -1 (ANXA1) 27 1. 6 .1 Functions of ANXA1 29 1. 6 .1. 1 ANXA1 in inflammation 29 1. 6 .1. 2 ANXA1 in cellular proliferation, differentiation ... al., 19 99) 28 1. 6 .1 Functions of ANXA1 1. 6 .1. 1 ANXA1 in Inflammation ANXA1 has a variety of biological functions It is chiefly known to function as an anti inflammatory protein (Lim and Pervaiz,...

Ngày tải lên: 01/10/2015, 17:27

163 369 0
Báo cáo hóa học: "On the feasibility of a channel-dependent scheduling for the SC-FDMA in 3GPP-LTE (mobile environment) based on a prioritizedbifacet Hungarian method" doc

Báo cáo hóa học: "On the feasibility of a channel-dependent scheduling for the SC-FDMA in 3GPP-LTE (mobile environment) based on a prioritizedbifacet Hungarian method" doc

... Medina-Acosta and Delgado-Penín EURASIP Journal on Wireless Communications and Networking 2 011 , 2 011 : 71 http://jwcn.eurasipjournals.com/content/2 011 /1/ 71 Page of 10 to carry out the communication ... Medina-Acosta and Delgado-Penín EURASIP Journal on Wireless Communications and Networking 2 011 , 2 011 : 71 http://jwcn.eurasipjournals.com/content/2 011 /1/ 71 & Alternating priority strategy) in order ... and Delgado-Penín EURASIP Journal on Wireless Communications and Networking 2 011 , 2 011 : 71 http://jwcn.eurasipjournals.com/content/2 011 /1/ 71 Page of 10 Table Simulation parameters according to...

Ngày tải lên: 21/06/2014, 00:20

10 496 0
Báo cáo lâm nghiệp: " On the niche breadth of Fagus sylvatica: soil nutrient status in 50 Central European beech stands on a broad range of bedrock types" potx

Báo cáo lâm nghiệp: " On the niche breadth of Fagus sylvatica: soil nutrient status in 50 Central European beech stands on a broad range of bedrock types" potx

... (mol mol 1 ) mean 12 . 9a 6. 0a 8. 2a 6. 1a 4. 6a 7. 5a 6. 8a 6. 2a 7. 1a 4. 8a 4. 7a 3. 5a 2. 4a s.e Corg (min) 0.9 1. 9 1. 0 1. 3 0.8 1. 1 1. 3 2.9 0 .1 0.5 0.5 0.0 3.3 mean 16 .4AB 16 .5AB 15 . 4A 16 .0AB 17 .9AB 25.7BCDE ... 24.5ABCDE 23.6ABCD 25.0ABCDE 33.6E 20.3ABC 28.2CDE 31. 4E s.e 0.2 1. 0 0.4 0.8 0.9 0.9 1. 1 1. 4 1. 7 1. 2 1. 1 2.8 4.6 mean 56 3a 418 a 29 8a 52 1a 59 9a 47 5a 60 7a 38 6a 416 a n.i n.i n.i n.i 11 3 76 46 65 13 9 ... variation for cation exchange capacity (10 2%) and exchangeable Al (83%), and a relatively low one for Nt and base saturation in the topsoil (67 and 65%) In the organic layer, highest variation was...

Ngày tải lên: 08/08/2014, 00:22

14 382 0
báo cáo khoa học: " In vitro behaviour of endothelial cells on a titanium surface" doc

báo cáo khoa học: " In vitro behaviour of endothelial cells on a titanium surface" doc

... (Takara Biomedicals, Japan); anti-human vitronectin, anti-human vitronectin receptor and anti-human VE-cadherin (Chemicon International, USA); anti-human αsmooth muscle actin (ICN Biomedicals, ... its participation on the junctions 10 11 Conclusion In conclusion, our data indicated that the attachment of ECs on titanium could be related to cellular-derived fibronectin and the binding to ... successful clinical application Noteworthy, the evaluation of the interaction of cells and implanted materials must take into account other parameters in addition to the analysis of maintenance of...

Ngày tải lên: 11/08/2014, 20:20

9 250 0
Báo cáo y học: " Particles induce apical plasma membrane enlargement in epithelial lung cell line depending on particle surface area dose" pptx

Báo cáo y học: " Particles induce apical plasma membrane enlargement in epithelial lung cell line depending on particle surface area dose" pptx

... metabolism favoring lipid trafficking to the APM after exposure to high particle concentrations The increase in APM surface area The quantification of APM surface area was based on the rationale ... for at 13 '000 rpm The isolation Figure Visualization of fine and ultrafine particles by confocal laser scanning microscopy Visualization of fine and ultrafine particles by confocal laser scanning ... (NCCR Nanoscale Science) and the Swiss National Science Foundation (Grant No 310 0A0 -11 8420) http://respiratory-research.com/content /10 /1/ 22 16 17 18 19 20 21 22 23 References 10 11 12 13 14 15 Mühlfeld...

Ngày tải lên: 12/08/2014, 14:20

15 188 0
Báo cáo y học: "HTLV-1 in rural Guinea-Bissau: prevalence, incidence and a continued association with HIV between 1990 and 2007" doc

Báo cáo y học: "HTLV-1 in rural Guinea-Bissau: prevalence, incidence and a continued association with HIV between 1990 and 2007" doc

... Science Park, Singapore) as described [15 ,25] mo 16 6 HTLV -1 TAX IR CTTRACAAACATGGGGAGGAAAT mo 013 B2M OF TAGAGGTTCCCAGGCCACTA mo 014 B2M OR ACCATGTAGCCTATGCGTGT mo 015 B2M IF ACAAGGAGCTCCAGAAGCAA mo ... Guinea-Bissau AIDS 19 98, 12 :17 07 -17 14 Norrgren H, Andersson S, Biague AJ, da Silva ZJ, Dias F, Naucler A, Biberfeld G: Trends and interaction of HIV -1 and HIV-2 in Guinea-Bissau, west Africa: ... [32,33] A concomitant iatrogenic spread through vaccination campaigns and large-scale parenteral treatment programs might have also contributed to the initial spread [34,35] A similar scenario has...

Ngày tải lên: 13/08/2014, 01:20

9 336 0
Báo cáo hóa học: " Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons" pptx

Báo cáo hóa học: " Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons" pptx

... excitons, phonons, etc.) in nanocone is a special case, since diameter of nanocone is a monotonous function of height, leading to gradual change of bandgap Graded bandgap structure has an effect on ... the authors read and approved the manuscript Page of 6 10 11 12 13 14 15 16 17 18 Wu XL, Gao T, Bao XM, Yan F, Jiang SS, Feng D: Annealing temperature dependence of Raman scattering in Ge+-implanted ... formation on a surface of CdZnTe crystal J Nano Res 2 011 , 11 :10 7 -11 2 Medvid’ A, Madzhulis I, Kaupuzs J, Blums J: Buried layer formation in silicon by laser radiation J Appl Phys 19 96, 79: 911 8- 912 2 Medvid’...

Ngày tải lên: 20/06/2014, 22:20

6 489 0
Immobilizing topoisomerase I on a surface plasmon resonance biosensor chip to screen for inhibitors pptx

Immobilizing topoisomerase I on a surface plasmon resonance biosensor chip to screen for inhibitors pptx

... NaCl in 0.05 M NaOH DNA relaxation assay Data processing and analysis The inhibitory effect of CPT on supercoiled DNA strand breakage caused by TopI was evaluated pUC19 plasmid DNA (200 ng) was ... dissociation constants (KD) for evaluating the protein-analyte binding affinity were determined by a steady-state affinity fitting analysis using the results from ProteOn Manager 2.0 (Bio-Rad) pUC19 ... forming γH2AX [30] γ-H2AX is predominantly mediated by an ataxia telangiectasia mutation (ATM) through continued phosphorylation proximal to DNA breakage sites which spreads to adjacent areas...

Ngày tải lên: 10/08/2014, 05:21

9 259 0
w