1 building and alterations to rear body and deck

Báo cáo khoa học: "B6C3F1 mice exposed to ozone with 4-(N-methyl-Nnitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate showed toxicities through alterations of NF-κB, AP-1, Nrf2, and osteopontin" pdf

Ngày tải lên : 07/08/2014, 17:22

... Ozone (CAS No 10 028 -15 -6) and Ozone/NNK (CAS No 10 028 -15 -6/ 640 91- 91- 4) in F344/N Rats and B6C3F1 Mice (Inhalation Studies) Natl Toxicol Program Tech Rep Ser 440, 1- 314 , 19 94 31 Marsman D NTP technical ... Cancer 19 96, 15 , 311 -323 11 Chan K, Han XD, Kan YW An important function of Nrf2 in combating oxidative stress: Detoxication of acetaminophen Proc Natl Acad Sci USA, 20 01, 98, 4 611 -4 616 12 Denhardt ... 19 97, 10 5, 802- 811 18 Hecht SS, Hoffmann D The relevance of tobacco-specific nitrosamines to human cancer Cancer Surv 19 89, 8, 273294 19 Hoffmann D, Hecht SS Nicotine-derived N-nitrosamines and...

7
301
0

Application pillar dam and movable caisson dam technology in building barrier construction to prevent sea water rising and improving flood relief at estuary rivers.

Ngày tải lên : 01/04/2013, 22:46

... VND per /1 m wide Hiền Lương sluice has span with 64m wide, the sluice consists of 16 automatic gates with 4m wide for each, water level difference is 2m, bridge 4m, H13-X60 Total cost is 11 billions ... axis of 31. 5m wide, water level difference is 1. 2m Control by hydraulic cylinder, construction cost is 11 5 billions DVN and this method is 10 0 billions less than traditional method Figure 12 : Completed ... jack, winch, and crane to move them down to their position Steel standard framework should be used to reduce errors in construction of concrete, pile framework system, pillar framework and supporting...

10
730
3

iec 60298 a.c. metal-enclosed switchgear and controlgear for rated voltages above 1 kv and up to

Ngày tải lên : 25/12/2013, 10:57

... compartments) 19 19 19 19 19 21 212 1 21 21 21 21 Definitions SECTION FOUR RATED : CHARACTERISTICS SECTION FIVE RULES FOR DESIGN AND CONSTRUCTION Design and construction ... message: please call the Document Policy Management Group at 1- 800-4 51- 1584 39 41 47 47 47 298 -46.5 6 .10 1 6 .10 2 6 .10 3 6 .10 4 6 .10 5 6 .10 6 6 .10 7 6 .10 8 Essais au courant de courte durộe et l a valeur decrờte ... 60 62 62 62 62 | - 88 90 10 0 I E C 298 90 m 4844893 0302527 C! W ~~ 298 0I E C 6.5 6 .10 1 6 .10 2 6 .10 3 6 .10 4 6 .10 5 6 .10 6 6 .10 7 6 .10 8 - Page Short-timeandpeak withstand current tests ...

139
465
0

Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx

Ngày tải lên : 21/02/2014, 15:20

... Thr10 Arg 11 Pro12 CONH CONH¢ a b b¢ c c¢ d d¢ – – 8. 914 8. 510 4.347 4.779 4.445 4.504 4.295 2.397 2.747 4.297 1. 813 2.270 1. 983 2.558 1. 983 1. 983 3.368 3. 317 1. 217 1. 645 1. 990 1. 645 1. 879 3 .16 0 ... Pro12 CONH CONH¢ a b b¢ c c¢ d d¢ – – 8.386 8.484 4.347 4.666 4.252 4.574 4.327 2.389 2.707 4 .15 5 1. 798 2.255 1. 978 2.543 1. 978 1. 978 3.336 3.336 1. 134 1. 629 1. 978 1. 629 1. 879 3 .16 0 3.782 3 .16 0 ... recognize an epitope present on the protein core of a 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 mucin molecule preferentially expressed by malignant cells Cancer Res 51, 2908–2 916 Baeckstrom,...

12
717
0

Tài liệu Báo cáo Y học: Importance of the amino-acid composition of the shutter region of plasminogen activator inhibitor-1 for its transitions to latent and substrate forms pdf

Ngày tải lên : 22/02/2014, 07:20

... 90.7 ^ 5.8 (3) 87.3 ^ 15 .5 (3) 10 4.8 ^ 5.9 (3) 74.5 ^ 9 .1 (3) † 23.8 ^ 2 .1 (3) *† 10 1.0 ^ 5.2 (3) † 81. 6 ^ 9.8 (3) 1. 3 1. 1 1. 2 1. 1 0.9 1. 7 1. 1 1. 3 0.9 1. 5 1. 2 1. 4 1. 5 0.7 1. 6 1. 0 6278 M Hansen et ... ^ 10 .0 (9) * 34.5 ^ 4.4 (7) * 64.7 ^ 14 .2 (9) * 83.8 ^ 14 .2 (6) 11 3.7 ^ 28.0 (10 ) † 12 9.5 ^ 21. 1 (3) 84.9 ^ 5.9 (3) 91. 0 ^ 13 .3 (3) 56 .1 ^ 6.3 (3) * 12 7 .1 ^ 6.2 (3) † 12 9.6 ^ 2.5 (3) † 73 .1 ^ ... G56S/Q334H/K335A 54.7 ^ 13 .5 (16 ) 76.9 ^ 11 .6 (4) *‡ 64.0 ^ 8.6 (5) 85 .1 ^ 20.5 (4) * 26 .1 ^ 4.4 (4) * 19 .7 ^ 1. 7 (4) * 25.5 ^ 6.3 (3) * 10 .9 ^ 1. 5 (4) * 12 .9 ^ 2.9 (3) * 10 .9 ^ 1. 4 (4) * 32 .1 ^ 2.7 (5)...

10
431
0

Báo cáo khoa học: Plasmodium falciparum merozoite surface protein 1 Glycosylation and localization to low-density, detergent-resistant membranes in the parasitized erythrocyte pdf

Ngày tải lên : 08/03/2014, 08:20

... 20 20 20 20 0 10 mU 0 10 mU 0 10 mU 0 283 14 69 13 65 19 8 264 13 54 16 07 264 210 12 63 12 77 200 80 15 8 mU mU mU mU mU mU mU mU mU mU PnGMAD20 and Uganda isolates had the potential to be modiﬁed by ... of Thr1278), and distinguish the two dimorphic forms (Ghana, Png and Uganda vs Thai-K1 and Wellcome) Such b-O-GlcNAc sites are not localized in the regions of homology (387– 413 and 11 00 11 87) ... positions 12 71 (Ser), 12 78 (Thr) and 12 83 (Ser) (ﬁlled circles) Position 12 71 was positive in the Thai and Wellcome sequences while position 12 83 was positive for the Ghana, Png and Uganda sequences...

10
415
0

6 Steps to Building and Managing A Successful Social Media Marketing Team potx

Ngày tải lên : 25/03/2014, 14:22

... Steps to Building and Managing a Successful Social Media Marketing Team What social media content should we monitor and create? Your team will need to brainstorm ideas that will help, entertain and ... important work to You will need to monitor the following: • Is your team staying on-message and true to the goals of the project? • Is your social media team too small to execute these goals? Too big? ... stay on-message and true to the goals of the project? • Is it time to make changes to your team roster? • Should (and could) you expand your listening and content creation strategies to include new...

9
510
0

Báo cáo khoa học: Transcription factor speciﬁcity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot

Ngày tải lên : 30/03/2014, 02:20

... (2009) 11 14 11 24 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS 11 15 SP1 and AP-2a regulate KCTD10 R Liu et al A B Fig Genomic structure of human and mouse KCTD10 genes, and the ... AP-2 FEBS Journal 276 (2009) 11 14 11 24 ª 2009 Hunan Normal University Journal compilation ª 2009 FEBS 11 19 SP1 and AP-2a regulate KCTD10 R Liu et al Fig Effects of Sp1 and AP-2a expression level ... ZH & Tjian R (19 94) A glutamine-rich hydrophobic patch in transcription factor Sp1 contacts the dTAFII 110 component of the Drosophila SP1 and AP-2a regulate KCTD10 16 17 18 19 20 21 22 23 24 25...

11
409
0

princeton university press religious experience reconsidered a building-block approach to the study of religion and other special things oct 2009

Ngày tải lên : 11/06/2014, 12:43

... Simple and Composite Formations Imagination and Reality 16 17 22 28 48 53 56 58 63 73 86 88 90 94 11 1 11 8 12 0 12 1 12 6 12 9 15 6 viii • Contents Conclusion Religions: A Building- Block Approach Building ... Barkow, Cosmides and Tooby 19 92 [in evolutionary psychology]; Emmons and Paloutzian 2003; Paloutzian and Park 2005, Kirkpatrick 2005 [in psychology of religion]; and Clayton 2004; Clayton and Davies ... “into two domains, one containing all that is sacred and the other all that is profane” (Durkheim 19 12 /19 95, 34) and refer simply to things that are more or less special, things understood to...

229
1.5K
0

báo cáo hóa học: " Brain microvascular pericytes are immunoactive in culture: cytokine, chemokine, nitric oxide, and LRP-1 expression in response to lipopolysaccharide" ppt

Ngày tải lên : 19/06/2014, 22:20

... non-amyloid angiopathies: FAD-PS -1 (P 117 L) mutation and CADASIL Immunohistochemical and ultrastructural studies Folia Neuropathol 2007, 45 :19 2-204 doi :10 .11 86 /17 42-2094-8 -13 9 Cite this article as: Kovac ... cultures with 0 .1 and ug/ml LPS resulted in significant release of pro-inflammatory cytokines such as IL-1a, TNF-a, IL-3, IL-9 and IL -13 (4 h, h and 24 h) and anti-inflammatory cytokines such as ... authors declare that they have no competing interests Received: 17 August 2 011 Accepted: 13 October 2 011 Published: 13 October 2 011 References Neuwelt E, Abbott NJ, Abrey L, Banks WA, Blakley B,...

9
512
0

Báo cáo hóa học: " Research Article 3D Shape-Encoded Particle Filter for Object Tracking and Its Application to Human Body Tracking" pptx

Ngày tải lên : 22/06/2014, 19:20

... 10 0 15 0 Ty 15 0 10 0 50 −50 10 0 15 0 Cy Cx (a) 50 50 10 0 Frame number 15 0 12 0 11 0 10 0 90 80 70 60 18 0 17 0 16 0 15 0 14 0 13 0 12 0 200 Frame number (b) 10 5 5 0 −5 Cy 15 10 Cy 15 10 Cy 15 10 Cy 15 ... Cy 15 −5 −5 −5 10 10 10 10 15 15 10 −5 15 15 10 −5 15 15 10 Tx 10 15 Tx 10 15 −5 Tx 10 15 15 15 10 −5 Tx 10 15 (c) Figure 9: (a) Comparison of time update schemes Top: no prediction ... Cx Cx 15 0 10 0 50 −50 10 0 15 0 11 10 0 50 10 0 15 0 Frame number 200 −200 250 50 10 0 15 0 Frame number 200 250 10 0 15 0 Frame number 200 50 10 0 15 0 Frame number 10 0 15 0 Frame number 200 50 10 0 15 0...

16
316
0

Báo cáo khoa học: "Molecular analysis of hprt mutation in B6C3F1 mice exposed to ozone alone and combined treatment of 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate for 32 and 52 weeks" ppsx

Ngày tải lên : 07/08/2014, 18:20

... (9) (6) (12 ) (18 ) ( 21) (12 ) Insertions (6) (13 ) (10 ) (15 ) (14 ) (12 ) (9) Deletions (12 ) (8) (10 ) (8) (17 ) (16 ) (15 ) Total Clones 17 (10 0) 24 (10 0) 21 (10 0) 26 (10 0) 35 (10 0) 25 (10 0) 34 (10 0) *unadjusted ... GC to AT TA CG AT to GC CG TA ( 21) (14 ) (7) ( 21) (14 ) (7) (14 ) (10 ) (10 ) (19 ) (24) (10 ) (14 ) (14 ) (9) (5) (14 ) (18 ) (30) (0) (11 ) (0) (22) (17 ) (23) (8) (4) (15 ) (19 ) (4) (15 ) (12 ) (15 ) (15 ) ... (12 ) (6) (9) (9) ( 21) (9) (15 ) Insertions (7) (10 ) (14 ) (17 ) (15 ) (12 ) (15 ) Deletions (7) (5) (14 ) (6) (12 ) (12 ) (15 ) Total Clones 14 (10 0) 21 (10 0) 22 (10 0) 18 (10 0) 26 (10 0) 26 (10 0) 33 (10 0)...

7
396
0

Báo cáo y học: " Impaired glucose transporter-1 degradation and increased glucose transport and oxidative stress in response to high glucose in chondrocytes from osteoarthritic versus normal human cartilag" pps

Ngày tải lên : 09/08/2014, 14:21

... accession number Glucose transporter -1 Forward: CGTCTTCATCATCTTCACTG 14 8 [Genbank:NM_006 516 ] β-Actin Forward: AACTACCTTCAACTCCAT 16 1 [Genbank:NM_0 011 01] 15 5 [Genbank:NM_0 211 30] Reverse: CTCCTCGGGTGTCTTATC ... factor -1 The aim of the present study was therefore to determine and compare the ability of normal and OA chondrocytes to modulate the GLUT -1 content and glucose transport in response to high and ... 11 :2367-23 81 11 Maroudas A: Distribution and diffusion of solutes in articular cartilage Biophys J 19 70, 10 :365-379 12 Brannan SR, Jerrard DA: Synovial fluid analysis J Emerg Med 2006, 30:3 31- 339...

11
431
0

Báo cáo y học: " Quantitative PCR used to Assess HIV-1 Integration and 2-LTR Circle Formation in Human Macrophages" potx

Ngày tải lên : 12/08/2014, 02:20

... 19 93, 67 :11 69 -11 74 10 Stevenson M, Stanwick TL, Dempsey MP, Lamonica CA: HIV -1 replication is controlled at the level of T cell activation and proviral integration Embo J 19 90, 9 :15 51- 1560 11 ... J Med 19 98, 339 :18 03 -18 09 Zhu T, Mo H, Wang N, Nam DS, Cao Y, Koup RA, Ho DD: Genotypic and phenotypic characterization of HIV -1 patients with primary infection Science 19 93, 2 61: 117 9 -11 81 Gartner ... immunodeficiency virus -1 (HIV -1) J Clin Invest 19 92, 89 :17 6 -18 3 Butler SL, Hansen MS, Bushman FD: A quantitative assay for HIV DNA integration in vivo Nat Med 20 01, 7:6 31- 634 doi :10 .11 86 /17 43-422X-7-354...

6
370
0

Báo cáo y học: " A novel trifunctional IgG-like bispecific antibody to inhibit HIV-1 infection and enhance lysis of HIV by targeting activation of complement" ppsx

Ngày tải lên : 12/08/2014, 04:20

... of two parts N Engl J Med 20 01, 344 :11 40 -11 44 Jia et al Virology Journal 2 010 , 7 :14 2 http://www.virologyj.com/content/7 /1/ 142 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Walport MJ: ... Gen Virol 19 97, 78(Pt 8) :19 07 -19 11 Stoiber H, Schneider R, Janatova J, Dierich MP: Human complement proteins C3b, C4b, factor H and properdin react with specific sites in gp120 and gp 41, the envelope ... Engl J Med 20 01, 344 :11 58 -11 66 Stoiber H, Pruenster M, Ammann CG, Dierich MP: Complementopsonized HIV: the free rider on its way to infection Mol Immunol 2005, 42 :15 3 -16 0 Banki Z, Stoiber H, Dierich...

4
242
0

Báo cáo khoa học: "A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" docx

Ngày tải lên : 12/08/2014, 04:21

... Page of (page number not for citation purposes) Virology Journal 2009, 6 :12 3 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Stoiber H, Banki Z, Wilflingseder D, Dierich MP: Complement-HIV interactions ... of the antibody molecule These antibody effector mechanisms include complement binding and viral lysis, phagocytosis of antibody-coated virions, and antibodydependent cellular cytotoxicity [29,30] ... Retroviruses 19 94, 10 :829-837 Frank I, Stoiber H, Godar S, Stockinger H, Steindl F, Katinger HW, Dierich MP: Acquisition of host cell-surface-derived molecules by HIV -1 AIDS 19 96, 10 :16 11- 1620 Saifuddin...

4
287
0

Báo cáo khoa học: " A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" doc

Ngày tải lên : 12/08/2014, 04:22

... Page of (page number not for citation purposes) Virology Journal 2009, 6 :12 3 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Stoiber H, Banki Z, Wilflingseder D, Dierich MP: Complement-HIV interactions ... of the antibody molecule These antibody effector mechanisms include complement binding and viral lysis, phagocytosis of antibody-coated virions, and antibodydependent cellular cytotoxicity [29,30] ... Retroviruses 19 94, 10 :829-837 Frank I, Stoiber H, Godar S, Stockinger H, Steindl F, Katinger HW, Dierich MP: Acquisition of host cell-surface-derived molecules by HIV -1 AIDS 19 96, 10 :16 11- 1620 Saifuddin...

4
271
0

Báo cáo y học: "Thymic plasmacytoid dendritic cells are susceptible to productive HIV-1 infection and efficiently transfer R5 HIV-1 to thymocytes in vitro" pdf

Ngày tải lên : 13/08/2014, 01:20

... surface markers CD11c, CD123 and HLADR (Figure 1A and 1B) These populations were HLADRintCD123+CD11c-, HLA-DRint/hiCD123-CD11clo, and HLA-DRint/hiCD123-CD11chi (Figure 2A and 2B) CD14 expression ... costimulatory molecules (CD11c and CD11b), HIV -1 receptors (CD4, CXCR4 and CCR5), maturation markers (CD83 and CD86), C-type lectin receptors (DC-SIGN, DEC-205 and MR), CD123, HLA-DR and M-DC8 ... receptor CD123, while they lacked both expression of the myeloid marker CD1c and the adhesion and co-stimulatory molecules CD11b and CD11c A smaller population of myeloid-related CD123-CD11clo DC...

12
348
0

Báo cáo y học: " HIV-1 Vif and APOBEC3G: Multiple roads to one goal" pptx

Ngày tải lên : 13/08/2014, 13:20

... http://www.retrovirology.com/content /1/ 1/28 10 11 12 13 14 15 16 17 None declared Abbreviations 18 The abbreviations used are: HIV -1, human immunodeficiency virus, type 1; Vif, Viral Infectivity Factor; SIV, simian ... which is packaged into virions and which is required in virus producing cells during the late stages of infection to enhance viral infectivity by 10 -to -10 00 folds [14 -17 ] HIV -1 vif-defective virus ... 74 :11 055 -11 066 Stopak K, de Noronha C, Yonemoto W, Greene WC: HIV -1 Vif blocks the antiviral activity of APOBEC3G by impairing both its translation and intracellular stability Mol Cell 2003, 12 :5 91- 601...

6
257
0