1 animal models of temporal lobe epilepsy

... 1. 1 .1. 4 Other interneurons of the dentate gyrus……………………………8 1. 1.2 Associational/commissural connections of the dentate gyrus………… 11 1. 1.3 Afferent of the dentate gyrus……………………………… ………… 14 1. 1.3 .1 ... (TLE)…………… 21 1.4 .1 Animal models of temporal lobe epilepsy …………………………… 21 1.4 .1. 1 Kindling model…………………………………………………… 21 1.4 .1. 2 SE model………………………………………………………….22 1. 4.2 Hypotheses of epileptogenesis from ... between pathological changes of hippocampus and severity of onset of epilepsy Hypotheses of epileptogenesis for temporal lobe epilepsy (TLE) Animal models of temporal lobe epilepsy Currently, status...

Ngày tải lên: 11/09/2015, 16:04

... Letters 2 011 , 6 :10 9 http://www.nanoscalereslett.com/content/6 /1/ 109 0 .10 graphene 0.05 0.00 Aeff (x10 nm ) n e Ctot (a.u.) -0.05 0.05 10 SiO2 SiO2 m (a) graphene -1 10 -2 10 (b) 1. 0 Atip Page of eff ... × 10 10 cm-2 and with FWHM of × 10 10 cm-2 l (nm) Giannazzo et al Nanoscale Research Letters 2 011 , 6 :10 9 http://www.nanoscalereslett.com/content/6 /1/ 109 40 CI Unirradiated 20 40 l (nm m) Page of ... http://www.nanoscalereslett.com/content/6 /1/ 109 50 Freq quency (%) 50 Page of (a) Unirradiated (b) =1x10 cm 13 -2 Charged impurities vacancies i 50 14 (c) -2 =1x10 cm vacancies Charged Ch d impurities 0 10 20 40 50 60 10 -2 NCI,...

Ngày tải lên: 21/06/2014, 05:20

... Letters 2 011 , 6 :10 9 http://www.nanoscalereslett.com/content/6 /1/ 109 0 .10 graphene 0.05 0.00 Aeff (x10 nm ) n e Ctot (a.u.) -0.05 0.05 10 SiO2 SiO2 m (a) graphene -1 10 -2 10 (b) 1. 0 Atip Page of eff ... × 10 10 cm-2 and with FWHM of × 10 10 cm-2 l (nm) Giannazzo et al Nanoscale Research Letters 2 011 , 6 :10 9 http://www.nanoscalereslett.com/content/6 /1/ 109 40 CI Unirradiated 20 40 l (nm m) Page of ... http://www.nanoscalereslett.com/content/6 /1/ 109 50 Freq quency (%) 50 Page of (a) Unirradiated (b) =1x10 cm 13 -2 Charged impurities vacancies i 50 14 (c) -2 =1x10 cm vacancies Charged Ch d impurities 0 10 20 40 50 60 10 -2 NCI,...

Ngày tải lên: 21/06/2014, 06:20

... mg/day 19 12 .4 2.6 8.9 3.7 7 .1, 10 .7

Ngày tải lên: 25/10/2012, 11:40

... objectively in a complementary manner, via studies of the MMN [10 3] 15 2 10 11 12 13 14 15 16 17 18 Closing Remarks Each of the specific components of the Event-Related Potential discussed in this ... Behavior 19 94; 56: 511 - 516 66 Tarkka IM, Stokic DS Source localization of P300 from oddball, single stimulus, and omitted-stimulus paradigms Brain Topography 19 98; 11 :14 1 -15 1 67 Polich J, Hoffman ... manifestation of context updating? Behavioral and Brain Sciences 19 88; 11 :357-374 58 Mccarthy G, Donchin E A metric for thought: a comparison of P300 latency and reaction time Science 19 81; 211 :77-80...

Ngày tải lên: 02/11/2012, 11:08

... From 17 -20 points; criteria 1, 4,6,9 must get points Fair: From 13 -16 ,5 points; criteria 1, 4, must get points Average: From 10 -12 ,5 points; criteria 1, 4 must get points Weak: Total points are 10 ... performance, evidence of having a theoretical background and knowledge of the principles and methods of teaching and commitment to education as profession Indicators: - Keeps abreast of current and ... appropriate for the content of the lesson and all students, good motivation of students’ learning (2 points) Results (2 points) 10 Most students understand and master the focus of the lesson; how to...

Ngày tải lên: 07/09/2013, 13:45

... sacred musical instrument of the tày people | 285 obligated to bring home some of the offerings for distribution to the audience as a sign of the spirits’ favor The offerings they took home would ... [Undergraduate thesis of the School of Social Sciences and Humanities, Discipline of Anthropology/Ethnology, 40th class/year] Đỗ Minh 19 75 Bước đầu tìm hiểu ca nhạc dân gian Việt Bắc [Exploration of folk music ... when Then rituals were still banned, before the easing of strictures in the late 19 80s The neck of the instrument is unusual, composed of two parts that can easily be disassembled and reassembled...

Ngày tải lên: 10/12/2013, 04:15

... per 10 0 million driver miles 0.60 0 .18 0 .13 0 .12 0.37 0. 41 Excess deaths (relative to the 35-39 years age group) 60 .1 76.2 0.0 -2.5 19 .1 2.4 No of A&E transfers over years 5737.5 14 312 .0 12 313 .5 ... dependence 2 .1- 5.0 Cardiovascular disorders 1. 1-5.0 Dementia 2 .1- 5.0 Epilepsy 1. 1-5.0+ Multiple sclerosis 2 .1- 5.0 Psychiatric disorders 1. 1-5.0 Sleep apnoea 2 .1- 5.0+ Glaucoma 1. 1-5.0 Source: ... Table 1. ) Table 1: Number of driver fatalities and fatality rate per 10 0,000 persons by age (US, 19 97) Car Drivers Age Group Number Rate 0 -14 years 78 0 .1 15-24 years 5,797 15 .8 25-64 years 14 ,338...

Ngày tải lên: 13/02/2014, 18:20

... 20

Ngày tải lên: 14/02/2014, 08:20

... 3% 1% 2% 5% 2% 1% 2% 1% 2% 2% 2% 1% 2% 1% 2% 3% 2% 1% 2% 1% 1% 0.3% 1% 1% 1% 0.4% 1% 2% 1% 2% 1% 1% 1% 1% 1% 2% 1% 1% 1% 0.3% 1% 0.4% 1% 1% 1% 1% 1% 1% 1% 1% 1% 0.4% 1% 0.4% 1% 1% 1% 0.3% 1% ... 22,404 15 ,7 41 5 ,14 4 8 ,12 6 11 ,699 8,832 8,386 6,568 5,639 5, 314 4 ,15 2 3, 817 2,679 2 ,14 9 1, 706 1, 687 1, 150 1, 369 10 0, 014 37,072 13 ,7 61 11, 677 6 ,19 1 5,095 4,353 4 ,12 0 4,049 3,667 2 ,19 4 2,077 1, 998 1, 177 ... 433,530 24 ,12 5 10 ,067 31, 950 17 ,393 36,556 7,927 11 ,597 34,796 10 ,647 16 ,606 11 ,598 16 ,993 14 ,355 12 ,899 2,709 27,378 17 ,582 19 , 311 9,047 6,737 7,975 8 ,14 1 77 ,14 1 14 0,623 86,532 7 ,14 9 21, 552 11 ,389...

Ngày tải lên: 18/02/2014, 00:20

... (Fig 4A) 817 364 364 C-Vrp1p465- 817 C-Vrp1p493- 817 C-Vrp1p533- 817 C-Vrp1p 614 - 817 C-Vrp1p760- 817 817 C-Vrp1p 716 - 817 817 817 465 817 493 817 533 533 817 614 716 817 760 C-Vrp1p760- 817 -GST 817 760 ... YCplac 111 expressing C-Vrp1p493) 817 under VRP1 promoter YCplac 111 expressing C-Vrp1p533) 817 under VRP1 promoter YCplac 111 expressing C-Vrp1p 614 ) 817 under VRP1 promoter YCplac 111 expressing C-Vrp1p 716 ) 817 ... under VRP1 promoter YCplac 111 expressing C-Vrp1p 614 ) 817 –GFP under VRP1 promoter YCplac 111 expressing C-Vrp1p 716 ) 817 –GFP under VRP1 promoter YCplac 111 expressing C-Vrp1p760) 817 –GFP under VRP1 promoter...

Ngày tải lên: 18/02/2014, 16:20

... vector Gene 10 8, 19 3 19 9 26 Friedrich G & Soriano P (19 91) Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice Genes Dev 5, 15 13 15 23 19 98 27 ... The conditional inactivation of the beta-catenin gene in endothelial cells causes a defective vascular pattern and increased vascular fragility J Cell Biol 16 2, 11 11 11 22 Lindblom P, Gerhardt H, ... nonpermissive temperature Mol Cell Biol 9, 16 72 16 81 14 Jat PS, Noble MD, Ataliotis P, Tanaka Y, Yannoutsos N, Larsen L & Kioussis D (19 91) Direct derivation of conditionally immortal cell lines from...

Ngày tải lên: 18/02/2014, 17:20

... calculated as k )1 ⁄ k1 SaDHNA EcDHNA k1 (lM )1 s )1) NP MP HP HPO k )1 (s )1) 0.24 0.29 0.47 0.45 4.5 4.2 13 10 ± ± ± ± 0. 01 0.02 0.04 0.02 ± ± ± ± Kd k (lM) (lM )1 s )1) 0 .1 0.2 1 19 15 28 24 0.32 0.26 ... rate constant of HPO (0.55 lm )1 s )1) was very similar to that of HP (0.65 lm )1 s )1) , but the dissociation rate constant of HPO (0.062 s )1) was about a quarter of that of HP (0.26 s )1) , suggesting ... dihydroneopterin aldolase to a cofactor-independent oxygenase J Am Chem Soc 12 8, 13 216 13 223 19 Yaylayan VA, Harty-Majors S & Ismail AA (19 98) Investigation of the mechanism of dissociation of glycolaldehyde...

Ngày tải lên: 19/02/2014, 00:20

... P85A F94A P97A L99A E103Q E103A R104A R105A F 118 A G121A Y154S F169A P172A T208A P209A D 211 N D 211 A L225A Sequence 5’ to 3’ Substitution G2A F W7P F I12P F V16G F F20A F G21A F K24A F L25A F G33A ... Gln P48A F I81M F P85A F F94A F P97A F L99A F E103Q F E103A F R104A F R105A F F 118 A F G121A F Y154S F F169A F P172A F T208A F P209A F D 211 N F D 211 A F L225A F ggtatccgcggcattgatcaagcagttg ggtgtcgctgatgctgtcagcgccg ... Ala Ile 81 to Met Pro85 to Ala Phe94 to Ala Pro97 to Ala Leu99 to Ala Glu103 to Gln Glu103 to Ala Arg104 to Ala Arg105 to Ala Phe 118 to Ala Gly1 21 to Ala Tyr154 to Ser Phe169 to Ala Phe172 to Ala...

Ngày tải lên: 19/02/2014, 17:20

... (2008) 11 1 -11 8 11 7 Using Hamilton equations of motion (47) we may write dF = dt ¯ ¯ ¯ ¯ ¯ ∂F ∂F ˙ ∂ F ˙′ ∂F ∂F q1 + ′ q 1 + ˙ p1 + ˙ p2 ˙ q2+ ∂q1 ∂q1 ∂q2 ∂p1 ∂p2 π dσ π = dσ + ¯ ∂ ∂F ′ − ∂σ ∂q1 = ... equations of motion: ¯ H = −p1aq2a − p2aq2a − L q1 , q ′ , q 1, q2 , q2 , q ′ , ˙ ˙ (44) δH δH ; q2 = − ˙ , δp1 δp2 δH δH p1 = ˙ ; p2 = ˙ , δq1 δq2 q1 = − ˙ (45) (46) where ′ ¯ ¯ H = H q1 , q1 , q 1, ... x x = 0, ˙ ´ N.S Han / VNU Journal of Science, Mathematics - Physics 24 (2008) 11 1 -11 8 11 8 Conclusion The equations of motion, of the boundary conditions and of the energy - momentum for the classical...

Ngày tải lên: 05/03/2014, 14:20

... 2.22 0. 21 0 .17 0.02 0 .12 7 012 1. 83 0.04 0.90 11 6.28 0.34 0.376 0.03 1. 92 20.4 17 .6 23.0 3. 31 12.6 51. 6 39.8 53.4 4.49 39.3 0.07 0.7 0.3 1. 4 0.47 0. 21 0.6 1. 7 2.6 0.34 1. 9 kcat ... 3.2 0.4 1. 65 0 .11 3 .1 0.3 8.2 E)3 E)4 0.030 0.0 01 0.283 1. 3 E)2 0.0026 0. 018 0.0 91 79 200 4 91 4.9 FEBS Journal 278 (2 011 ) 24602468 ê 2 011 The Authors Journal compilation ê 2 011 FEBS 2465 ... (s )1) Km (mM) 6.0 6.0 6.0 6.0 6.0 7.0 7.0 7.0 7.0 7.0 8.0 8.0 8.0 8.0 8.0 3.88 0.09 1. 41 0.02 0. 51 0.02 0 .10 0.02 1. 00 0.05 0. 314 0.034 ND 0 .18 0.02 0 .11 4 0. 012 1. 25 0.46 1. 04 0 .13 ...

Ngày tải lên: 06/03/2014, 00:20

... Journal 278 (2 011 ) 17 57 17 68 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 17 67 Targets and stimulation of PASKIN 15 16 17 18 19 20 21 22 23 24 25 P Schlafli et al ¨ tion of the mouse PAS ... Journal 278 (2 011 ) 17 57 17 68 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 17 63 P Schlafli et al ¨ R R R R R R Targets and stimulation of PASKIN 17 64 Fig In vitro target phosphorylation of His6-PASKIN ... phosphorylate eEF1A1 [18 ], and both kinases are FEBS Journal 278 (2 011 ) 17 57 17 68 ª 2 011 The Authors Journal compilation ª 2 011 FEBS P Schlafli et al ¨ A Targets and stimulation of PASKIN C D B...

Ngày tải lên: 06/03/2014, 00:21

... AF, Kok FJ, Kohlmeier L: http://www.nutritionj.com/content/3 /1/ 19 18 5 18 6 18 7 18 8 18 9 19 0 19 1 19 2 19 3 19 4 19 5 19 6 19 7 19 8 19 9 200 2 01 202 203 204 Adipose tissue omega-3 and omega-6 fatty acid content ... 21: 110 7 -11 10 11 3 Tsao CS, Myashita K: Influence of cobalamin on the survival of mice bearing ascites tumor Pathobiology 19 93, 61: 104 -10 8 11 4 Tsao CS, Miyashita K, Young M: Cytotoxic activity of ... Foundation http://www.nutritionj.com/content/3 /1/ 19 23 24 References 10 11 12 13 14 15 16 17 18 19 20 21 22 WCRF/AICR: Food, nutrition and the prevention of cancer: a global perspective: World Cancer...

Ngày tải lên: 06/03/2014, 02:21

... Allegri born at Correggio 15 11- 1 513 Probably in Mantua (p 69) 15 15 Madonna of St Francis (p 94) 15 18 In Parma executing the frescoes of San Paolo, April-December (p 15 2) 15 20 Invitation to Parma ... Giorgione, Venetian, 14 77 -15 10  Titian, Venetian, 14 77 -15 76  Palma Vecchio, Venetian, 14 80 -15 28  Lotto, Venetian, 14 80 -15 58.[xv]  Raphael, Umbrian, 14 83 -15 20  Pordenone, Venetian, 14 84 -15 39  Bagnacavallo, ... Conegliano, Venetian, 14 93 -15 17  Pontormo, Florentine, 14 93 -15 58  Moretto, Brescian, 15 00 -15 47  Bronzino, Florentine, 15 02 -15 72  Basaiti, Venetian, first record, 15 03-last record, 15 20 [1] I THE HOLY...

Ngày tải lên: 06/03/2014, 13:20

... 11 4 -12 7 +P 15 7 -17 5 +P Glu C peptides 83 -10 8 +2P 93 -10 0 +P 93 -10 3 +P 93 -10 3 +2P 93 -10 8 +P 10 0 -11 1 +P 10 9 -12 1 +P 10 9 -12 2 +P 11 2 -12 1 +P 11 3 -12 1 +P 16 1 -17 2 +P Tryptic peptides 16 5 -17 5 +P 16 5 -18 3 +P Sequence ... 19 + 18 + 23+ 17 + 16 + 25+ 24+ 22+ 13 + 14 + C 25 410 Da 21+ 20+ 19 + 18 + 23+ 25+ 15 + 17 + 16 + 15 + 13 + 14 + 24+ B 21+ 20+ 19 + 22+ 16 + 18 + 23+ 25+ 17 + 15 + 24+ 14 + 13 + A 10 00 12 00 253 31 Da 14 00 16 00 18 00 ... 2787 .1 853.4 11 69.4 12 49.4 17 70.7 13 57.6 15 94.7 17 08.7 12 53.5 11 39.4 13 30.0 2787.8 853.2 11 69.3 12 49.2 17 71. 4 13 57.6 15 95.2 17 08.6 12 53.9 11 39.9 13 30.3 +0.7 )0.2 )0 .1 )0.2 )0.3 )0.5 )0 .1 +0.4...

Ngày tải lên: 07/03/2014, 00:20