1 3 and when it doesn t

... UNFCCC, the Stockholm Environment Institute, and ProVention Consortium of the World Bank Pointing out that science was traditionally kept separate to protect its legitimacy, Jasanoff’s (19 90) work ... organizations into academic institutions might be one way to deal with the institutional obstacle The Forum held on 23 – 24 April 2009 at the Yale School of Forestry and Environmental Studies, entitled ... such organizations as ‘institutions that straddle the shifting divide between politics and science It is hypothesized that the presence of boundary organizations facilitates the transfer of...

Ngày tải lên: 07/10/2012, 15:56

... American writer ? When / born ?  When was he born ?  He was born in 18 99 ? What / / 19 18 ?  What did he in 19 18 ?  He worked as a driver on the Italian front When / writing career ?  When did ... November 23rd 2009 THE OLD MAN AND THE SEA Ernest Hemingway Monday, November 23rd 2009 Period 42: SITUATION AND PRACTICE Monday, November 23rd 2009 Period 42: Lesson 6: Situation and practice I ... begin his writing career ?  He began his writing career in 19 22 Monday, November 23rd 2009 Period 42: Lesson 6: Situation and practice 1 When did Hemingway todo? WhenWhat Hemingway return marry?...

Ngày tải lên: 10/10/2013, 02:11

... Vi t: He is old and she is young He is big He is not small She is small She is not big It is high It is not low It is long It is not short It is thick It is not thin It is expensive It is not ... dài vẽ tranh v t ngắn Long Short vẽ tranh sách dày vẽ tranh sách mỏng Thick Thin vẽ tranh v t to vẽ tranh v t nhỏ Big Small vẽ tranh v t có để giá vẽ tranh v t có để giá tiền cao tiền thấp Expensive ... Mỗi t dùng lần) It is It is He is It is It is She is It is It is He is It is It is She is Bước 4: Đọc câu sau dịch sang tiếng...

Ngày tải lên: 24/12/2013, 09:16

... bond with its NH1 atom (at 2.8 A) The DHAP aliphatic chain is sandwiched between Trp1 91 and Asp2 91, with its carbonyl oxygen contacting, at a ˚ distance of 2.7 A, both Asp2 91 and the solvent molecule ... (2.8 A), and O2P interacts with ˚ ) and O3P with w 51 (2.6 A), which in ˚ Trp1 91 (2.8 A ˚ ), which contribturn contacts w 119 (distance of 2.9 A utes to fixing the Arg47 orientation by establishing ... that the Trp1 91 Met195 couple is the main active site gating determinant controlling ligand admission Crystal structure of human ACMSD w1 DHAP Met 19 5 Trp 19 1 Fig Conformational changes affecting...

Ngày tải lên: 18/02/2014, 06:20

... Caspase 1. 529 0. 537 0.859 0.657 0 .30 3 0.268 0. 233 0 .14 9 0 .11 3 0.068 0.064 0.055 0.0 53 0.040 0.474 0 . 13 7 0.2 01 0 .14 8 0.079 0.079 0. 216 0 .38 6 0. 218 0 . 13 6 0 .11 3 0 .15 1 0.057 0.0 63 1. 9 13 0. 835 1. 122 2 .36 0 ... thought to inhibit the activities of cysteine or serine proteases, the results of our selectivity experiments indicated that the compounds we tested had better selectivity for caspases than the ... IC50 to 0 .1 times the IC50 Caspase -3 activity recovered to 90% of initial activity at when incubated with the reversible inhibitor, Ac-DEVD-CHO, but caspase -3 activity did not recover between and...

Ngày tải lên: 07/03/2014, 11:20

... F258I: 5¢-TAC CAA GTG ATT TCC GGT GGT -3 ; F258Y: 5¢-TAC CAA GTG TAT TCC GGT GGT -3 ; F258W: 5¢-TAC CAA GTG TGG TCC GGT GGT -3 ; E292S: 5¢-GG AAC GTC GCT GGT TCA TGG TCT GCT GCT TTG -3 Outside primers ... E292S:L3 32 .65 1. 90 (1. 95 1. 90) P 212 1 21 a = 60 .33 b = 65 .39 c = 96.49 a = b = c = 90° 0.052 (0. 21) 13 .8 (3. 3) 98.9 (95 .3) 3. 3 (2.6) 30 432 0 . 13 5 0 .16 8 0. 014 1. 35 0.09 3 211 38 . 23 2.00 (2 .11 –2.00) P 212 1 21 ... inhibitors, thereby revealing the close network of interactions that hold the terminal glucose of the bglucan substrate in the )1 subsite at the bottom of the active site pocket [20] The entrance...

Ngày tải lên: 15/03/2014, 23:20

... of 16 ° with respect to the substrate surface, their 3 Š ends are faceted with (15 17 ), (1 1) and (3 15 17 ) at the angles of 24°, 30 ° and 24°, respectively, and their ½  2Š ends 33 are faceted ... with respect to the substrate surface, and the (1 9)/(5 9) facets are tilted at an angle of 16 ° All the islands have a (1 3) top facet Theoretical calculations indicated that there exists a strain ... on the substrate stiffness and the island shape Unfortunately, Tersoff and Tromp did not pay attention to the substrate anisotropy in stiffness but assumed the same angles of island facets with...

Ngày tải lên: 16/03/2014, 15:34

... nucleotides 10 60 10 98], and the reverse primer, r1 [5¢-GCGGCCGCTG TATCTGAAGTTGGGGAATTACTGTGTTTGTTGTT -3 (the NotI restriction site is underlined); nucleotides 2206– 22 41] The full-length PCR product (11 43 ... obtained from 500 mL cultures The fusion protein was extracted and purified first with the His-tag purification kit (Novagen) and subsequently with the glutathione-S-transferase-tag purification kit ... proteins (35 % identity/50% similarity) was only slightly lower No considerable similarity was found to exist to the nonmetazoan and the protostomian/nematode putative proteins present in the database...

Ngày tải lên: 16/03/2014, 16:20

... ACGTTTGCCACGTTCCAAAGGA ACGAACCTGTGACTCCCTCCCG TGTGTGATTTCCCGTCAACTGTC CCAGCCTCTTCCATTGGATACAA CAAGAGCAGCGGCAACAG AATAAAACTTTGGCATCATCCACTCAAAATCTCC GAACATGCCCTGGAGAAGAATGA GGTAGCCTGCATGGTCTCTTGTAT ... P1 promoter To test whether the exon 5¢-flanking sequences have promoter activity, we cloned a 3 .1 kb partially digested Relative luciferase activity A + 81 -16 83 -12 89 -12 04 -10 17 - 834 -6 61 - 634 ... cells transfected with pPAC-Sp1 and pPAC-Sp3 (Fig 9, + 45%) These data suggest that Sp1 and Sp3 proteins play a positive role in P1-directed transcription In agreement with this, triple transfection...

Ngày tải lên: 23/03/2014, 07:20

... dAc 36 .59 36 . 31 38 .62 39 .89 23 C 1. 34 1. 37 0.75 0.80 36 .82 2.54 1. 27 1. 55 1. 32 2.29 37 C 0.07 0 .10 0.04 0. 51 1.00 0 .17 1. 13 1. 04 1. 11 1.20 23 C 0.08 0.04 0. 03 0 .11 1. 20 0 .14 Phase ... 1, 3lb3 Zeta potential (mV) 000 60 1, 3lb2 D (nm) 200 1, 3lb4 800 1, 3lb5 600 400 200 40 1, 3lb1 20 1, 3lb2 1, 3lb3 20 1, 3lb4 1, 3lb5 40 60 80 +/ 1: 1 +/ 2 :1 +/ 4 :1 liposomes +/ 1: 1 1, 3lb1 200 1, 3lb2 ... curve ts and rst-derivative analysis, respectively, of the experimental data in Fig Lipid Tm (C) Coefcient of determinationa Tonset (C) Toffset (C) Toffset ) onset 1, 3lb1 1, 3lb2 1, 3lb3 1, 3lb4 1, 3lb5...

Ngày tải lên: 23/03/2014, 07:20

... pGEX–mTSSK3: K39R, the Lys39 to Arg mutation; T1 68A, the Thr168 to Ala mutation; T1 68D, substitution of Thr168 to Asp; S166A, the Ser166 to Ala mutation; S166G, the Ser166 to Gly mutation and S166D, ... (F) TSSK3 activation after in vitro prephosphorylation with PDK1 CS or PKA CS; Histone f2a was used as a test substrate for assaying activity of GST–TSSK3WT or GST–TSSK 3T1 68A attached to glutathione–agarose ... Mutating Ser166 (S166A, S166G) also abolished the ability of recombinant TSSK3 to autophosphorylate and decreased its kinase activity towards a substrate, but substitution of Ser166 with 6 31 4 ...

Ngày tải lên: 23/03/2014, 11:20

... M''' Relative Intensity 15 00 10 0 18 35 18 45 18 55 Mass (m/z) M'' 10 00 M' 500 875 900 925 950 975 10 00 10 25 10 50 10 75 B Relative Intensity m/z 10 0 M'' Relative Intensity 12 00 18 45 18 35 M' M''' 18 55 ... increments in t1 and spectral widths of 8000 Hz and 17 5 91 Hz in the 1H and 13 C dimensions, respectively A total of 256 summed scans were collected with a relaxation delay of 1. 3 s All 1H and 1H - 13 C ... RP-HPLC The difference between native and synthetic peptides is most probably associated with the configuration of the glycan moiety attached to Thr10 We demonstrated that the glycan of the synthetic...

Ngày tải lên: 23/03/2014, 13:20

... exo -1, 3- b-glucanase Substrate (Gn) Km (mM ) 10 3: Vmax (mmol:min 21: mg 21) 10 3: (Vmax/Km) (min 21 : mg 21) ln (Vmax/Km) G3G G3G3G G3G3G3G G3G3G3G3G G3G3G3G3G3G 16 .5 5.0 1. 9 2.0 2 .1 0 .36 5.5 14 16 18 ... germinated barley has been reported to have negative affinity at site 12 and positive at the rest [ 53] This is in contrast to the results obtained for the exo -1, 3- b-glucanase described here where the ... similar structure of subsites at its active center where A 21 has a negative value for affinity energy in contrast to values for all other sites that are positive mutarotation had occured to a significant...

Ngày tải lên: 24/03/2014, 04:21

... evident by household income and maternal education Parental perceptions of general health The data in Table show that most respondents at both sweeps thought that the health of their child was at ... relation to the cohort child was predominant in both cohorts with the most common contact being a GP GPs were also the most frequently cited source of advice about the child’s health This suggests ... disabilities being any ailment that had troubled or was likely to affect the child over a period of time In total, 11 % and Table Perceptions of child’s general health by cohort and sweep Cohort (%)...

Ngày tải lên: 28/03/2014, 11:20

... wild-type construct pET9d::LamA as template [6], with the primers 5Â-GCAAAG (sense) ATGGTGGTGGCATATGTAAGGGTTTAC -3 and 5Â-GTAAACCCTTACATATGCCACCACCATCT TTGC -3 (antisense) The E53A mutant and the ... the double 617 2 K1 (M )1) v2 9.8 2.5 9.6 3. 0 ã ã ã ã 10 )5 10 )4 10 )4 10 )3 3 .3 3.4 1. 1 4.4 ã ã ã ã 10 7 10 5 10 6 10 5 v 2.9 3 .1 1.7 3 .1 ã ã ã ã 10 )4 10 )4 10 )3 10 )4 mutant (Fig 4, insets) Notably, in ... (kJặmol )1) Wild-type D287A E53A E53A D287A 6.7 6.2 6.0 6.2 9.2 5.9 5.6 5 .3 0 . 13 0 .15 0 .12 0 .15 61. 5 36 .5 33 .9 33 .1 1. 23 0. 91 0.68 0. 83 0 .18 0 .15 0 .11 0 . 13 )25.0 1. 53 )27.6 1. 40 )28.4...

Ngày tải lên: 30/03/2014, 04:20

... Nitrones Raymond C F Jones and Jason N Martin Department of Chemistry, Loughborough University, Loughborough, United Kingdom 1. 1 1. 2 1. 3 1. 4 1. 5 1. 6 1. 7 1. 8 1. 9 1. 10 1. 11 Nitrones and the 1, 3- Dipolar ... upon the highlights of synthetic endeavor through 1, 3- dipolar cycloaddition reactions of nitrones since 19 84 Nitrones 1. 1 NITRONES AND THE 1, 3- DIPOLAR CYCLOADDITION REACTION Nitrones (or azomethine ... completely direct the addition to the nitrone After poor results with menthol esterand methyl lactate-based nitrones, they were able to prepare and separate isoxazolidine 8a and its diastereomer 8b...

Ngày tải lên: 09/05/2014, 17:06

... desensitization with two CD66 mAbs to further stimulation of neutrophil adhesion to HUVECs Cross desensitization with two CD66 mAbs to further stimulation of neutrophil adhesion to HUVECs TNF-stimulated ... current study to be performed This study demonstrates that desensitization of neutrophils to stimulation by any two neutrophil CEACAMs allows the cell to respond to stimulation by the other two ... 6:78 http://www.translational-medicine.com/content/6 /1/ 78 Figure Cross desensitization with three CD66 mAbs to further stimulation of neutrophil adhesion to HUVECs Cross desensitization with three...

Ngày tải lên: 18/06/2014, 15:20

... an interrogating tool There is no doubt that the treatment of the cell extracts limits the ability of this method to identify interactions dependent upon conformational structures, nevertheless, ... due to receptor binding initiates the signalling events required for internalization [35 ] The finding that DENV -1, DENV-2 and DENV -3 interact with the laminin receptor is thus consistent with this ... http://www.virologyj.com/content/2 /1/ 25 binding protein Hip55 and that DENV-4 differs from the other three dengue virus serotypes in that it' s envelope protein interacts with lamin B1 and p47 and does not interact with...

Ngày tải lên: 19/06/2014, 08:20

... daily (not shown) Profibrillogenic activities of the metal ions tested were in agreement with a published report [12 ] (e.g., Al3+stimulated ThT fluorescence of A 1- 40 by 3. 6 ± 1. 1- to 5.7 ± 1. 4fold; ... neuropathological evidence suggesting that "long" Aβ peptides ending at positions N-42 or N- 43 are apparently crucial for the initiation ("seeding") of Aβ deposition [ 13 ] These data demonstrate that ... evaluated herein However, the equipotent activities of the apolipoprotein E 3 and ε4 isoforms suggests the possibility that either extended co-incubation of apolipoprotein E and Aβ, or, perhaps, the...

Ngày tải lên: 19/06/2014, 22:20

... results in differential cellular expression of interleukin-1beta (IL-1beta) and its receptor at mRNA and protein level J Cereb Blood Flow Metab 19 97, 17 (10 ) :11 07 -11 20 30 31 32 33 34 35 36 37 38 39 ... [54] and astrocytes [55-57] in vitro and in vivo Both IL-6 and TNF-α are associated with stimulating properties of neurite growth It was demonstrated that TNF-α can support glia-dependent neurite ... compared to control and single treatment with IL -1 , and in length if compared to single treatment with NT3 Additionally, combination of the two factors is also characterized by a significantly higher...

Ngày tải lên: 19/06/2014, 22:20