1 1difluoro1alkenes as new electrolyte additives for lithium ion batteries
![Báo cáo toán học: " Electrochemical performance of NixCo1-xMoO4 (0 [less than or equal to] x [less than or equal to] 1) nanowire anodes for lithium-ion batteries" pptx](https://media.store123doc.com/images/document/2014_06/20/medium_cjRKzxwozW.jpg)
Báo cáo toán học: " Electrochemical performance of NixCo1-xMoO4 (0 [less than or equal to] x [less than or equal to] 1) nanowire anodes for lithium-ion batteries" pptx
... 0.25 10 .1 9.0 0.5 12 .7 10 .3 0.75 21. 0 18 .6 1 47.4 39.2 Comparison of surface areas for as- prepared Ni x Co 1 x MoO 4 ·nH 2 O and Ni x Co 1 x MoO 4 nanowires dehydrated at 500°C for 2 h ... to] 1) nanowire anodes for lithium- ion batteries Nanoscale Research Letters 2 012 , 7:35 doi :10 .11 86 /15 56-276X-7-35 Kyung-Soo Park (kspark78@gmail.com) Seung-Deok Seo (sds 110 9@gmail.com) Hyun-Woo ... distribution, and reproduction in any medium, provided the original work is properly cited. Figure 1 Electrochemical performance of Ni x Co 1 x MoO 4 (0 ≤ x ≤ 1) nanowire anodes for lithium- ion batteries...
Ngày tải lên: 20/06/2014, 21:20
Báo cáo hóa học: " Synthesis and characterization of integrated layered nanocomposites for lithium ion batteries" ppt
... 0.33 x = 0 .17 x = 0 .10 x = 0.05 x = 0 (11 1) (0 21) ( -11 1) (11 0) (020) (10 7) (11 3) (11 0) (10 8) (009) (10 5) (10 4) (10 2) (006) (10 1) (003) Figure 1 XRD patterns of Li[Ni x Co x Li 1/ 3-x Mn 2/3-x ]O 2 system ... Li[Ni 0.24 Cr 0.24 Li 0.09 Mn 0.42 ]O 2 0.93 0.24 0.25 0.42 1. 44 x = 0 .17 Li[Ni 0 .17 Cr 0 .17 Li 0 .17 Mn 0.50 ]O 2 1. 01 0 .16 0 .17 0.50 1. 64 x = 0 .10 Li[Ni 0 .10 Cr 0 .10 Li 0.23 Mn 0.56 ]O 2 1. 04 0 .10 0 .10 0.56 0.73 x = 0.05 Li[Ni 0.05 Cr 0.05 Li 0.29 Mn 0.62 ]O 2 1. 09 ... 0 (10 2) (006) (10 1) (003) (11 1) (0 21) ( -11 1) (11 0) 2 T (020) Figure 4 XRD patterns of Li[Ni x Cr x Li 1/ 3- x Mn 2/3-x ]O 2 system synthesized by coprecipitation and magnified image in the 19 °...
Ngày tải lên: 20/06/2014, 23:20
báo cáo hóa học:" Synthesis and characterization of integrated layered nanocomposites for lithium ion batteries" pdf
Ngày tải lên: 21/06/2014, 17:20
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... performed at 94 °C for 1 min, 65 °C for 1 min and 72 °C for 1 min (35 cycles). For Gup1, PCR was performed at 94 °C for 1 min, 65 °C for 1 min and 72 °C for 3 min (40 cycles). Primers used were Skn, 5Â-CTGCGTGAGCAC CATGTTCA-3Â ... and Gup1 was determined by two-step RT-PCR, as described above, from total RNA extracted using Isogen (Nippon Gene, Tokyo, Japan). For Skn, PCR was performed at 94 °C for 1 min, 65 °C for 1 min ... Development 13 1, 4357–4370. 31 Hofmann K (2000) A superfamily of membrane-bound O-acyltransferases with implications for Wnt signaling. Trends Biochem Sci 25, 11 1 11 2. 32 Bosson R, Jaquenoud M...
Ngày tải lên: 18/02/2014, 16:20
electrochemical performance of - fe2o3 nanorods as anode material for lithium - ion cells
... areas and high surface energy. For lithium ion battery applications, the large sur- face areas of nanostructured materials can provide more sites for lithium ion intercalation/de-intercalation. ... which could be associated with electrolyte decomposition and the reversible conversion reaction of lithium ion intercalation to form Li 2 O. An anodic peak is also present at about 1. 75 V, corresponding ... J.M. Tarascon, J. Elec- trochem. Soc. 15 0 (2003) A1643. [ 21] D. Larcher, C. Masquelier, D. Bonnin, Y. Chabre, V. Masson, J.B. Leriche, J.M. Tarascon, J. Electrochem. Soc. 15 0 (2003) A133. [22]...
Ngày tải lên: 19/03/2014, 16:48
Nutraceuticals as new treatment approaches for oral cancer – i
Ngày tải lên: 01/07/2014, 13:23
A new electrolyte formulation for low cost cycling lead acid batteries pps
Ngày tải lên: 05/07/2014, 20:21
Báo cáo hóa học: " Low-temperature synthesis of CuO-interlaced nanodiscs for lithium ion battery electrodes" potx
... materials for lithium- ion batteries. Chem Mater 2008, 20:3 617 . doi :10 .11 86 /15 56-276X-6-397 Cite this article as: Seo et al.: Low-temperature synthesis of CuO- interlaced nanodiscs for lithium ion battery ... Shi SJ: Self-assembled synthesis of hierarchical nanostructures CuO with various morphologies and their application as anodes for lithium ion batteries. J Power Sources 2 010 , 19 5: 313 . 9. Zhang ... Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2 010 -0 019 116 and 2 010 -0029 617 ). Authors’ contributions S-DS carried out the CuO and CuO/MWCNT sample preparation...
Ngày tải lên: 21/06/2014, 03:20
Lithium-ion Batteries Part 1 pdf
... I Next generation lithium ion batteries for electrical vehicles Towardshighperformanceanodeswithfast charge/dischargerate for LIBbasedelectricalvehicles 1 Towards high performance ... Developmentofcontact-wirelesstyperailcarby lithium ion battery 12 1 TakashiOgihara V Preface During the last twenty years since the rst commercialization of lithium ion batteries (LIBs), there has been ever continuing ... Calendar Life, 35°C year 15 15 Maximum System Weight kg 60 12 0 Maximum System Volume Liter 40 80 System Recharge Rate at 30°C kW 1. 4 (12 0V /15 A) 1. 4 (12 0V /15 A) Unassisted Operating &...
Ngày tải lên: 21/06/2014, 07:20
Next generation lithium ion batteries for electrical vehicles potx
Ngày tải lên: 27/06/2014, 01:20
Electrochemical evaluation of additives for lead–acid batteries under high-discharge conditions pps
Ngày tải lên: 05/07/2014, 20:21
Electrochemical evaluation of additives for lead–acid batteries under high-discharge conditions pdf
Ngày tải lên: 05/07/2014, 21:20
advances in lithium-ion batteries 2002 - schalkwijk & scrosati
... be used for this
Ngày tải lên: 16/04/2014, 11:22
Báo cáo hóa học: " Hollow Nanostructured Anode Materials for Li-Ion Batteries" pdf
Ngày tải lên: 21/06/2014, 07:20
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... Sequences Positions References A2 ESSV hnRNP A1 U UAGGACAUAUAGUUAGCCCUAGG 4995–5 017 [5, 12 , 38, 40] ESE1 ASF ⁄ SF2 unknown A3 ESSp hnRNP H UGGGU 5362–5366 [48, 41, 15 , 17 , 8] ESS2 hnRNP A1 C UAGACUAGA ... D3 signal. Disruption of ESSV results in increased vpr mRNA accumulation and exon 3 inclusion, decreased accumulation of unspliced viral mRNA and decreased Fig. 1. Organization of HIV -1 genome and ... regulation of HIV -1 multiplication as a target for therapeutic action Jamal Tazi 1 , Nadia Bakkour 1 , Virginie Marchand 2 , Lilia Ayadi 2 , Amina Aboufirassi 1 and Christiane Branlant 2 1 Universite ´ Montpellier...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Functional analysis of cell-free-produced human endothelin B receptor reveals transmembrane segment 1 as an essential area for ET-1 binding and homodimer formation pptx
... volume of 1 mL with an RM ⁄ feeding mixture ratio of 1 : 17 . The reaction was optimized for the concentrations of the ions Mg 2+ (15 mm) and K + (290 mm). For soluble expression, detergent was supplied ... ETB cHx elutes at a retention volume of 1. 6 mL, whereas the 21- mer cET -1 starts to elute at a volume of 2 .1 mL. Coelution of cET -1 with ETB cHx therefore indicates complex forma- tion of the receptor ... of G protein-coupled receptors in Pichia pastoris to levels required for structural studies via a single expression screen. Protein Sci 15 , 11 15 11 26. 11 Lundstrom K, Wagner R, Reinhart C, Desmyter...
Ngày tải lên: 16/03/2014, 10:20
Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot
... Asp 110 Asp185 Asp186 Trp229 Tyr1 81 NNRTIbp E Tyr188 Asp 110 Asp185 Asp186 Trp229 Cys1 81 NNRTIbp B Asp 110 Asp185 Asp186 Trp229 Tyr1 81 NNRTIbp Tyr188 F Asp 110 Asp185 Asp186 Trp229 Cys1 81 NNRTIbp C Asp 110 Asp185 Asp186 Trp229 Tyr1 81 Tyr188 NNRTIbp G Tyr188 Tyr1 81 Trp229 Asn103 D Asp 110 Asp185 Asp186 Trp229 Tyr1 81 Tyr188 NNRTIbp H Asp 110 Asp185 Asp186 Trp229 Cys1 81 NNRTIbp A K126 K126 I Asp 110 Asp185 Asp186 Tyr1 81 Trp229 Asn103 K126 K54 K54 KNA53 KNA53 K49 K49 VAL108A VAL106A PHE227A LEU234A TRP229A TYR188A TYR 318 A LEU100A TYR181A VAL108A TRP229A LEU234A PHE227A PRO236A TYR188A VAL106A LEU234A PHE227A VAL108A TYR188A TYR183A TRP229A LEU100A LEU100A TYR 318 A TYR188A TRP229A LEU234A ASN103A VAL106A VAL108A TYR188A VAL108A TYR188A MET230A LEU234A TRP229A VAL108A LEU228A TRP229A LEU100A TYR188A TYR188A VAL106A VAL108A PHE227A TYR 318 A LEU234A LEU100A VAL108A PHE227A TYR188A LEU234A LEU100A TYR 318 A VAL106A O O O O O O O O O O O O Br O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O Pr O Fig. ... Asp 110 Asp185 Asp186 Trp229 Tyr1 81 NNRTIbp E Tyr188 Asp 110 Asp185 Asp186 Trp229 Cys1 81 NNRTIbp B Asp 110 Asp185 Asp186 Trp229 Tyr1 81 NNRTIbp Tyr188 F Asp 110 Asp185 Asp186 Trp229 Cys1 81 NNRTIbp C Asp 110 Asp185 Asp186 Trp229 Tyr1 81 Tyr188 NNRTIbp G Tyr188 Tyr1 81 Trp229 Asn103 D Asp 110 Asp185 Asp186 Trp229 Tyr1 81 Tyr188 NNRTIbp H Asp 110 Asp185 Asp186 Trp229 Cys1 81 NNRTIbp A K126 K126 I Asp 110 Asp185 Asp186 Tyr1 81 Trp229 Asn103 K126 K54 K54 KNA53 KNA53 K49 K49 VAL108A VAL106A PHE227A LEU234A TRP229A TYR188A TYR 318 A LEU100A TYR181A VAL108A TRP229A LEU234A PHE227A PRO236A TYR188A VAL106A LEU234A PHE227A VAL108A TYR188A TYR183A TRP229A LEU100A LEU100A TYR 318 A TYR188A TRP229A LEU234A ASN103A VAL106A VAL108A TYR188A VAL108A TYR188A MET230A LEU234A TRP229A VAL108A LEU228A TRP229A LEU100A TYR188A TYR188A VAL106A VAL108A PHE227A TYR 318 A LEU234A LEU100A VAL108A PHE227A TYR188A LEU234A LEU100A TYR 318 A VAL106A O O O O O O O O O O O O Br O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O Pr O Fig. ... Alizarines as new dual HIV -1 RT inhibitors FEBS Journal 278 (2 011 ) 14 4 414 57 ê 2 011 The Authors Journal compilation ê 2 011 FEBS 14 49 Asp 110 Asp185 Asp186 Trp229 Tyr1 81 NNRTIbp E Tyr188 Asp 110 Asp185 Asp186 Trp229 Cys1 81 NNRTIbp B Asp 110 Asp185 Asp186 Trp229 Tyr1 81 NNRTIbp Tyr188 F Asp 110 Asp185 Asp186 Trp229 Cys1 81 NNRTIbp C Asp 110 Asp185 Asp186 Trp229 Tyr1 81 Tyr188 NNRTIbp G Tyr188 Tyr1 81 Trp229 Asn103 D Asp 110 Asp185 Asp186 Trp229 Tyr1 81 Tyr188 NNRTIbp H Asp 110 Asp185 Asp186 Trp229 Cys1 81 NNRTIbp A K126 K126 I Asp 110 Asp185 Asp186 Tyr1 81 Trp229 Asn103 K126 K54 K54 KNA53 KNA53 K49 K49 VAL108A VAL106A PHE227A LEU234A TRP229A TYR188A TYR 318 A LEU100A TYR181A VAL108A TRP229A LEU234A PHE227A PRO236A TYR188A VAL106A LEU234A PHE227A VAL108A TYR188A TYR183A TRP229A LEU100A LEU100A TYR 318 A TYR188A TRP229A LEU234A ASN103A VAL106A VAL108A TYR188A VAL108A TYR188A MET230A LEU234A TRP229A VAL108A LEU228A TRP229A LEU100A TYR188A TYR188A VAL106A VAL108A PHE227A TYR 318 A LEU234A LEU100A VAL108A PHE227A TYR188A LEU234A LEU100A TYR 318 A VAL106A O O O O O O O O O O O O Br O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O O Pr O Fig....
Ngày tải lên: 22/03/2014, 16:20