1—typical values for the balanced reinforcement ratio for a rectangular section with 5000 psi 34 5 mpa
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
Ngày tải lên :
06/03/2014, 08:21
... elementary arguments from the geometry of numbers and linear algebra Acknowledgments The authors are grateful for the hospitality of the American Institute of Mathematics, where the first phase of ... vb ) for all a, b; and since Σ contains Σ1 + ek , we also know the traces Tr(va xk ) for all a and k It follows that, for each k, we can represent the action of multiplication by xk on the F ... , g6 can be chosen to be homogeneous of degree 5, 6, 6, 7, 12 (This data was obtained with the commands InvariantRing, PrimaryInvariants, and SecondaryInvariants in Magma.) One checks that R =...
- 20
- 478
- 0
Đề tài " Formation of singularities for a transport equation with nonlocal velocity " potx
Ngày tải lên :
29/03/2014, 07:20
... being ill-posed for general initial data A linear analysis of small perturbations of planar sheets leads to catastrophically growing dispersion relations Several attempts at regularization were introduced ... Annals of Mathematics, 162 (20 05) , 1377–1389 Formation of singularities for a transport equation with nonlocal velocity ´ ´ By Antonio Cordoba∗ , Diego Cordoba∗∗ , and Marco A Fontelos∗∗ * Abstract ... X Li, and A C Morlet, Analytic structure of 1D-transport equations with nonlocal fluxes, Physica D 91 (1996), 349 –3 75 [2] A L Bertozzi and A J Majda, Vorticity and the Mathematical Theory of Incompresible...
- 14
- 252
- 0
báo cáo hóa học:" Research Article Complete Asymptotic and Bifurcation Analysis for a Difference Equation with Piecewise Constant Control" potx
Ngày tải lên :
21/06/2014, 11:20
... neurons,” Mathematical and Computer Modelling, vol 35, no 9-10, pp 941– 950 , 2002 H Sedaghat, Nonlinear Difference Equations, vol 15 of Mathematical Modelling: Theory and Applications, Kluwer Academic ... 1 a , c/ 1 a , or equivalently, the limit 1-cycle c/ 1 a , c/ 1 a is a global attractor For the sake of convenience, let us set p c , 1 a q b c 1 a 7.3 Then the above statements can be restated ... nonlinear nature of our model at hand Indeed, we are dealing with a dynamical system with piecewise constant nonlinearlities see e.g., 2–6 , and the usual linear and continuity arguments cannot be applied...
- 13
- 311
- 0
Báo cáo hóa học: " Research Article A Common Coordinates/Heading Direction Generation Method for a Robot Swarm with Only RSSI-Based Ranging" ppt
Ngày tải lên :
21/06/2014, 22:20
... to each other as another alternative We will compare the location estimation performance among the far, random, and near pivot robots selections in Section (4) and broadcasts di j to all other ... following (iv) The location and angle estimation accuracies improve as the number of robots increases, and the angle estimation accuracy also improves as the moving distance increases We have taken into ... robot based on a tank kit manufactured by TAMIYA, and Figure 15 shows the inside of the robot, where the control element is composed of an I/O board, a CPU board, and a PHY/MAC board The I/O board...
- 11
- 289
- 0
ON WEAK SOLUTIONS OF THE EQUATIONS OF MOTION OF A VISCOELASTIC MEDIUM WITH VARIABLE BOUNDARY V. G. pptx
Ngày tải lên :
23/06/2014, 00:20
... prove a similar result for a domain with changing boundary The article is organized as follows We need a number of auxiliary results about functional spaces for the formulation of the basic results ... approximation of the equation in a weak sense and application of the topological theory of a degree that allows to establish the existence of solutions on the basis of a priori estimates and statements ... established for smooth v by means of the passage to the limit and ¯ the differentiation with respect to t it is easy to show that the scalar function (Lv,v)t for v ∈ D(L) and a. e t satisfies the relation...
- 31
- 266
- 0
báo cáo khoa học: " Drug Checking: A prevention measure for a heterogeneous group with high consumption frequency and polydrug use - evaluation of zurich’s drug checking services" potx
Ngày tải lên :
11/08/2014, 18:20
... amphetamines (74.8%) at least once in their life As shown in Figure 1, the initiation age for legal substances (alcohol and tobacco) was approximately 15 and the age for cannabis was approximately ... same as the number of substances analyzed (2 055 ) Of the subjects, 21.9% were women, and the average age was 27.8 years At the time of the survey, the youngest person was 15, and the oldest was ... data analyses and manuscript preparation and critically revised the final draft All of the authors approved the final version submitted for publication Competing interests The authors declare...
- 6
- 267
- 0
Báo cáo y học: " Pelvo-ureteric junction obstruction in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report" pot
Ngày tải lên :
11/08/2014, 21:22
... the differential diagnosis was either a tumour or an abscess Given that the patient was septic, this cystic lesion with an enhancing capsule was likely to be an abscess rather than a tumour Again ... collection and clear urine via Figure fat saturation and gadolinium enhancement T1-weighted coronal magnetic resonance imaging scan with T1-weighted coronal magnetic resonance imaging scan with fat saturation ... manuscript All authors have read and approved the final manuscript Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy...
- 3
- 306
- 0
Báo cáo y học: " Binding of long-chain α-neurotoxin would stabilize the resting state of nAChR: A comparative study with α-conotoxin" docx
Ngày tải lên :
13/08/2014, 16:21
... subunits alpha/gamma and alpha/delta: for long-chain α-neurotoxins the known interacting residues were Arg 35 in the ligand and Trp 55 in the gamma subunit; Arg 35 in the ligand and leu119 in the gamma ... His10 and Arg9 in 1XGA relative to the alpha and gamma subunits (A) before and (B) after MD simulations Position of residues His10 and Arg9 in 1XGA relative to the alpha and gamma subunits (A) before ... molecular dynamics simulation without the ligand (apo form) and in the presence of each of the two antagonists The major goal was to observe and compare the conformational changes in the LBD in the presence...
- 15
- 161
- 0
6 raymond a serway, john w jewett physics for scientists and engineers with modern physics 34
Ngày tải lên :
05/10/2016, 14:02
... A, and the coffee maker, rated at 800 W, draws 6.67 A When the three appliances are operated simultaneously, they draw a total current of 25. 8 A Therefore, the circuit must be wired to handle at ... (a) What is the lamp’s resistance? (b) What fraction of the chemical energy transformed appears as internal energy in the batteries? An automobile battery has an emf of 12.6 V and an internal resistance ... 28.22 The effect is to limit the current in the galvanometer when large voltages are applied Calculate the value of the resistor that allows the galvanometer to measure an applied voltage of 25. 0...
- 20
- 1.1K
- 0
Báo cáo y học: "PARP-1 inhibitors: are they the long-sought genetically specific drugs for BRCA1/2-associated breast cancers"
Ngày tải lên :
31/10/2012, 16:57
... naturally occurring BRCA2 6174delT frameshift mutation accompanied by loss of the second allele with NU10 25 and 3-aminobenzamide (3AB), a weak PARP-1 inhibitor with the KI =50 0nM [33] Their data ... antitumor activity of temozolomide against intracranial melanoma, glioma, lymphoma Clin Cancer Res 2003; 9: 53 70-9 Calabrese CR, Almassy R, Barton S, et al Anticancer chemosensitization and radiosensitization ... role of the BRCA1 tumor suppressor in DNA double-strand break repair Mol Cancer Res 20 05; 3: 53 1-9 Cantor SB, and Andreassen PR Assessing the link between BACH1 and BRCA1 in the FA pathway Cell...
- 7
- 415
- 0
Tài liệu Study the Values--Higher Values For You ppt
Ngày tải lên :
20/12/2013, 19:15
... done, the mantra for a company that is primarily retail can serve as the corporate mantra as well as the design mantra for the actual stores This is evident in the "Quality, Variety, and Activity" ... not what core values an organization has, but that it has core values. " I would add that these values must emanate from within the individuals that operate the company Who are you, and what kind ... the packaging, or the jazziness of the ad campaigns This approach trivializes the basis of a product brand and does not begin to grapple with the concept of brand as it relates to retailing For...
- 23
- 419
- 0
Tài liệu THE IMPORTANCE OF SOLITUDE FOR A BALANCED LIFE ppt
Ngày tải lên :
21/01/2014, 18:20
... further their work, rather than relationships which are intrinsically rewarding, and their spouses may well find their marital relations take second place.” THE IMPORTANCE OF SOLITUDE FOR A BALANCED ... conversations with others, hopes and goals, as well as failures and successes ✴ A journal is your constant companion, and the most undemanding one It doesn't ask for anything and is always ready ... have to just sit there and contemplate? No, not at all! There are many activities you can engage in while you're alone 12 THE IMPORTANCE OF SOLITUDE FOR A BALANCED LIFE Here are some great activities...
- 19
- 425
- 0
Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf
Ngày tải lên :
16/02/2014, 14:20
... phosphatases have long been viewed as negative regulators that terminate MAPK signaling, it is now evident that they play an important role in determining the magnitude and duration of MAPK activation, ... with 32 P-labeled reduced carboxamidomethylated and maleylated lysozyme as substrate, and phosphatase activity was measured The results (shown as activity relative to wild-type phosphatase) are ... superfamily, and share little sequence similarity beyond the conserved active-site signature motif HCX5R Although they use 2464 the same catalytic mechanism as the classical PTPs, the catalytic...
- 11
- 580
- 0
Recommendations for Use of Antiretroviral Drugs in Pregnant HIV-1-Infected Women for Maternal Health and Interventions to Reduce Perinatal HIV Transmission in the United States pdf
Ngày tải lên :
05/03/2014, 13:20
... may have a significant impact on the clinical care of patients In the event of significant new data that may affect patient safety, the Panel may issue a warning announcement and accompanying ... decrease the risk of MTCT i Evaluate and appropriately manage therapy-associated side effects such as hyperglycemia, anemia, and hepatotoxicity that may adversely impact maternal-fetal health ... potential h Make a primary treatment goal for women who are on ART for their own health and who want to get pregnant the attainment of a stable, maximally suppressed maternal viral load prior...
- 235
- 1.5K
- 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx
Ngày tải lên :
16/03/2014, 04:20
... before the ATG of human CPT1B The construct HMCPT1–pHWO10 was used as a template in a PCR reaction with primers DH673 (5 -AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH677 (5 -TTCCT CATCATCCAACAAGGG-3¢) ... reaction with primers DH673 (5 -AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH803 (5 -TCCA CCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGG CGGA-3¢) The PCR reaction yielded a 422-bp product, in which an EcoRI site ... for a reaction with 216 the QuickChange Site-Directed Mutagenesis Kit (Stratagene) The primers used were DH801 (5 -TTCTTCCGCCA AACCCTTAAGCTGCTGCTTTCCTAC-3¢) and DH802 (5 -GTAGGAAAGCAGCAGCTTAAGGGTTTGGCGGA...
- 9
- 550
- 0
Báo cáo khoa học: Hybrid reuteransucrase enzymes reveal regions important for glucosidic linkage specificity and the transglucosylation / hydrolysis ratio pptx
Ngày tải lên :
16/03/2014, 04:20
... mutagenesis kit (Stratagene, La Jolla, CA, USA) and the primers AkpnI: 5 -GATACATGGTATCGTCCAAAAC-3¢; AsacI: 5 -GTG AAGAAATATGAGCTCTATAATATTCCGG-3¢; and Asa lI: 5 -CTTGCTAACGATGTCGACAACTCTAATCC-3¢ ... in p15GTFA-dN (Fig 1B) To remove KpnI and introduce SacI restriction sites in p15GTFO-dN, the primers used were OKpnI: 5 -GATACCTGGTATCGGCCAGCCAAG-3¢ and OsacI: 5 -GTTAAGAAGTACGAGCTCTACAATATTCC-3¢ ... GTFA and GTFO reuteransucrases are the main determinants for glucosidic linkage specificity Within these N-termini, the A1 ⁄ A2 and O1 ⁄ O2 parts of the reuteransucrase catalytic domains mainly...
- 9
- 358
- 0
Báo cáo Y học: Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG) docx
Ngày tải lên :
24/03/2014, 04:21
... of the drug at the other end and the proximal base pairs A5 –T18 and C4–G19 is less favourable than the amidinium–DNA interactions because of the neutral character of this end (Table 2, Fig 5) The ... that can be achieved by this part of the drug and a CG base pair, we alleviated all constraints during the optimization A completely unconstrained gas phase optimization of the formamide part and ... in the calculation helps to lead the guanine amino-group hydrogen atoms away from the drug A search in the Cambridge Structural Database [14] shows that most amino groups in guanine fragments are...
- 10
- 411
- 0
Báo cáo khoa học: Differential binding of factor XII and activated factor XII to soluble and immobilized fibronectin – localization of the Hep-1/Fib-1 binding site for activated factor XII pdf
Ngày tải lên :
30/03/2014, 02:20
... nonelectrostatic As proteolytic degradation of the ECM abrogated the binding of FXIIa, it was assumed that a matrix protein was the target for the binding Therefore, it was tentatively analyzed and found ... near confluence, and the generated ECM was exposed by detaching the cells with EDTA After washing, the ECM was incubated for h with 20 nM FXIIa The ECM was then washed again and incubated first with ... performed in triplicate and repeated at least twice To obtain estimates of affinity constants, the data were analyzed according to the isotherm A ¼ Amax [FXIIa]/(KD þ [FXIIa]) where [FXIIa] is the...
- 12
- 456
- 0
oracle database quick installation guide 10g release 1 (10.1.0.3) for the solaris operating system (x86)
Ngày tải lên :
07/04/2014, 15:52
... created it: /u02/oradata Alternatively, accept the default location: oracle_base/oradata Specify Backup and Recovery Options Accept the default values, then click Next Specify Database Schema Passwords ... information about installing them, see the Oracle Database Companion CD Installation Guide which is located on the Companion CD Installing Oracle Database 10g Products To install Oracle Database ... Manager Database Control to administer a database This guide, designed for new Oracle DBAs, describes how to use Database Control to manage all aspects of an Oracle database installation It also...
- 48
- 439
- 0