... Journal of Orthopaedic Surgery and Research 2010, 5: 16 http://www.josr-online.com/content /5/ 1 /16 Page of Discussion The curved articular surfaces of CMC joint provide only limited stability, compared ... dislocation of the CMC joint No fracture signs were identified (Figure 1) Intra-articular injection of local anaesthetic (xylocaine 2%) was followed by closed reduction of the carpometacarpal ... cases Clin Orthop Relat Res 1983, 1 75: 166 -169 Fotiadis et al Journal of Orthopaedic Surgery and Research 2010, 5: 16 http://www.josr-online.com/content /5/ 1 /16 Page of Watt N, Hooper G: Dislocation...
Ngày tải lên: 20/06/2014, 07:20
... of cell cycle protein complexes consisting of two key regulatory molecules: CDKs and cyclins [17,24] A CDK molecule is activated by association with a cyclin, forming a CDK complex CDKs are constitutively ... stimulation, cells exit the G1 ⁄ G0 phase and start to divide [16] Cell cycle progression is precisely controlled by the activity of a series of cyclindependent kinases (CDKs), which are activated by cyclin ... expressed in cells, whereas cyclins are synthesized at speci c stages of the cell cycle [ 25] The expression of a cyclin is regulated at the transcriptional and degradation level to influence CDK activity...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot
... (antisense) C5 4 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplification of the myc-tagged HCV-1 core ⁄ core+1 sequence ... myc (+1) pHPI-1496 myc (+1) pHPI- 157 9 wild-type context gcccctctATG85g nt 59 0 core+1/S–myc CMV nt 8 25 core+1 optimal context ccgccaccATG85g nt 59 0 core+1/S nt 828 core+1 CMV pHPI- 158 0 optimal context...
Ngày tải lên: 30/03/2014, 03:20
Examples of VHDL Descriptions phần 1 ppt
... ieee.std_logic_ 1164 .ALL; ENTITY seg7dec IS PORT(bcdin : IN std_logic_vector(3 DOWNTO 0); segout : OUT std_logic_vector(6 DOWNTO 0)); END seg7dec; ARCHITECTURE ver3 OF seg7dec IS BEGIN WITH bcdin SELECT ... concurrent; Structural style architecture ARCHITECTURE structure OF maj IS declare components used in architecture COMPONENT and2 PORT(in1, in2 : IN BIT; out1 : OUT BIT); END COMPONENT; COMPONENT ... style architecture ARCHITECTURE concurrent OF maj IS BEGIN selected signal assignment statement (concurrent) WITH a&b &c SELECT m
Ngày tải lên: 07/08/2014, 23:20
Examples of VHDL Descriptions phần 1 pot
... ieee.std_logic_ 1164 .ALL; ENTITY seg7dec IS PORT(bcdin : IN std_logic_vector(3 DOWNTO 0); segout : OUT std_logic_vector(6 DOWNTO 0)); END seg7dec; ARCHITECTURE ver3 OF seg7dec IS BEGIN WITH bcdin SELECT ... concurrent; Structural style architecture ARCHITECTURE structure OF maj IS declare components used in architecture COMPONENT and2 PORT(in1, in2 : IN BIT; out1 : OUT BIT); END COMPONENT; COMPONENT ... style architecture ARCHITECTURE concurrent OF maj IS BEGIN selected signal assignment statement (concurrent) WITH a&b &c SELECT m
Ngày tải lên: 08/08/2014, 01:21
Báo cáo y học: "Genetic analysis of HIV-1 Circulating Recombinant Form 02_AG, B and C subtype-specific envelope sequences from Northern India and their predicted co-receptor usage" pot
... following primers: Forward primer: 5' -ATGGGATCAAAGCCTAAAGCCATGTG Reverse primer: 5' -AGTGCTTCCTGCTGCTCCCAAGAACCCAAG Approximately 1. 25 Kb DNA fragment corresponding to V1 to V5 region was amplified initially ... Forward primer: CTGTTAAATGGCAGTCTAGC Reverse primer: CACTTCTCCAATTGTCCCTCA Patient population and genetic analysis We carried out genetic analysis of 13 HIV-1 envelope sequences from Northern ... $) 5HI ) %( 9, $) 5HI % )5 +;% /$, ,,,% %58 6XEW\SH 1,, 3*, ,1' 97 )5HI % 1/ $< 5HI ) %5 %5 $) 5HI ' &0 &0 +$/ $< 5HI &' (47% & $5HI &0 03 $n 1,, 3*, ,1' ( )c 1,, 3*, ,1' ' )5HI & %5 %5 G8 5HI...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "High systemic levels of interleukin-10, interleukin22 and C-reactive protein in Indian patients are associated with low in vitro replication of HIV-1 subtype C viruses" docx
... study (n = 85) replicated more efficiently in U87 CD4 cells expressing CCR5 than in CXCR4expressing cells, indicating that they are R5 tropic viruses The fold difference of CCR5 over CXCR4 growth ... Data Common clinical findings CDC Clinical category1 0.342 CDC CD4 category2 0.063 34(47.2) 10(76.9) 44 (51 .8) 41 (56 .9) 10(76.9) 51 (60.0) 72(100) 13(100) 85( 100) 68 (94.4) (5. 6) Combined CDC AIDS ... the lack of association between replication and viral load or CD4+ cell counts as shown in Fig 2C and 2D, respectively Biological characterization of viral isolates Replication capacity of isolates...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo khoa học: "Medical treatment for the terminally ill: the ‘risk of unacceptable badness’"
... Resuscitation 2001, 50 :161 -166 Crippen D: Terminally weaning awake patients from life sustaining mechanical ventilation:the critical care physician’s role in comfortmeasures during the dying process ... April 20 05) Frick S, Uehlinger DE, Zuercher Zenklusen RM: Medical futility: predicting outcome of intensive care unit patients by nurses and doctors – a prospective comparative study Crit Care Med ... process Clin Intensive Care 1992, 3:206-212 Luce JM, Alpers A: End -of- life care: what the American courts say? Crit Care Med 2001, Suppl:N40-N 45 Arnold RM, Kellum J: Justifications for surrogate decision...
Ngày tải lên: 25/10/2012, 10:45
Customer Service - Principles of Service Marketing and Management - C Lovelock & L Wright
... factors TABLE 2.1 Selected Ways of Classifying Services degree of tangibility or intangibility of service processes direct recipient of the service process place and time of service delivery customization ... some types of service transactions This chapter builds on our earlier discussion of processes in Chapter and introduces the concept of a spectrum of customer contact with the service organization ... a core service product Consider Figure 2.3 In the case ofFlooz.com, the core product—financial services—can be delivered directly via e-mail In the case of Lands' End, by contrast, the site offers...
Ngày tải lên: 07/02/2013, 09:52
Lab 1: Game of Life
... world from the pattern specified in the file Basically, the file is a matrix of characters, ’*’ to specify a live cell, and ’ ’ (space) to specify a dead cell The ith character of the jth line (zero-indexed) ... function call in main() (c) The main() function calls next generation() for each generation to handle the evolution process Your code should set each cell’s state in the next generation according ... represents the state of the cell located at (i,j) in the world (c) Fill in the contents of lab1b .c using the code from Part A (lab1a .c) and modifying to call these functions The name of the file to load...
Ngày tải lên: 25/04/2013, 08:07
Appendix 1 - Outline of Density Matrix Analysis
... to calculate (t), followed by calculation of hAi by Eq (A1.4), clarifies the behavior of the whole system concerning the observation of the quantity A The above description is made in the Schrodinger ... Since hAi can be expressed by A and only, it is possible to calculate the value of the macroscopic observable hAi without knowing j ji and pj, provided that is obtained A1.2 EQUATION OF MOTION ... ðtÞ converting (t) into a density operator in the interaction picture: ÀiH0 t I ðtÞ ¼ U0 ðtÞy ðtÞU0 ðtÞ, U0 ðtÞ ¼ exp h Copyright © 2004 Marcel Dekker, Inc ðA1:8Þ ðA1:9Þ Outline of Density...
Ngày tải lên: 17/10/2013, 13:15
GMAT OFFICIAL GUIDE th 10 Edition 1 CRITICAL REASONING 1. Which of the following best completes
... scientific secrecy described above? A Biotechnological research funded by industry has reached some conclusions that are of major scientific importance B When the results of scientific research ... extinction episodes selectively affect organisms with particular sets of characteristics unique to their species (C) Some species become extinct because of accumulated gradual changes in their local ... failure C a once-successful manufacturer of slide rules reacted to the introduction of electronic calculators by trying to make better slide rules D one of the first models of modern accounting machines,...
Ngày tải lên: 17/10/2013, 15:15
Module 1: Overview of Windows CE .NET
... applications that are optimized for resource-constrained computing devices Along with Visual Studio NET, it offers a choice of languages, initially Microsoft Visual Basic and Microsoft Visual C# , ... It is identical to the Basic Web Pad version, with the addition of Pocket Word, Inbox client companion to Microsoft Outlook®, Microsoft ActiveSync®, and Help for Microsoft Windows® CE Enterprise ... Eagle SDB EAGLE NEC Vr5432 NEC DDB-Vrc5476 Boston SDB DDB5476 SH4-7 750 Hitachi SH4 Aspen SDB ASPEN SH3-7729 Hitachi SH3 Keywest SDB KEYWEST P5/P4/PIII/PII/ CelK6x/Athlon CEPC CEPC NS Geode National...
Ngày tải lên: 18/10/2013, 17:15
Module 1: Overview of the Microsoft .NET Platform
... high-performance Web cache It builds on Windows security and directory for policy-based security, acceleration, and management of internetworking Microsoft Commerce Server Provides an application framework, ... Microsoft provides Visual Basic, Visual C+ +, Microsoft Visual C# ™, Visual J#, and Microsoft JScript® support Third parties can provide additional languages Module 1: Overview of the Microsoft ... layout of classes Microsoft intermediate language (MSIL) to native compiler Converts MSIL to native code (Just-in-time) Code manager Manages code execution Garbage collector (GC) Provides automatic...
Ngày tải lên: 18/10/2013, 18:15
Module 1: Overview of XML Documents
... Resource Indicator (URI) 1234 1234 ... xmlns:acc="http://www.microsoft.com/acct"> 1234 50 0.00 12-03-2000 ... click Query Click one of the Details links Enter a number in the quantity text field, and then click Add to Basket Click View Order Click Go to Checkout Enter customer number 1, and then click...
Ngày tải lên: 22/10/2013, 16:15
Module 1: Overview of Microsoft ISA Server
... Server computers Yes Yes Feature Description Access policy Module 1: Overview of Microsoft ISA Server Using Caching Topic Objective To introduce the topics related to the use of caching The Caching ... enterprise-caching scenario, you can centrally administer all caching and access restrictions Delivery Tip Explain the use of chained caching ISA Server also supports chained, or hierarchical, caching Chained ... a branch office or a small business cache server Main Office Main Office ISA Server Cache ISA Server Lead-in An ISA Server computer that is set up as a Web cache server at a branch office or...
Ngày tải lên: 22/10/2013, 19:15
Bài 1 : Cấu Trúc Của Một Chương Trình C++
... dễ đ c mà C c thích C c thích lập trình viên sử dụng để ghi hay mô tả phần chương trình Trong C+ + c hai c ch để thích // Chú thích theo dòng /* Chú thích theo khối */ Chú thích theo dòng c p ... dễ đ c mà C c thích C c thích lập trình viên sử dụng để ghi hay mô tả phần chương trình Trong C+ + c hai c ch để thích // Chú thích theo dòng /* Chú thích theo khối */ Chú thích theo dòng c p ... kiểu kh c Có vài c ch để làm vi c C++, c ch thừa kế từ ngôn ngữ C đặt trư c biểu th c cần chuyển đổi tên kiểu liệu b c cặp ngo c đơn (), ví dụ: int i; float f = 3.14; i = (int) f; Đoạn mã chuyển...
Ngày tải lên: 23/10/2013, 12:15
SELECTED EXAMPLES OF NEWAPPLICATIONS
... reproduced by permission of The Royal Society of Chemistry) 10.2 Biological Activity The most remarkable biological activity is observed for sulphated polysaccharides; naturally occurring polysaccharides ... 10.3 Carrier Materials 187 Table 10.4 Examples of polysaccharide esters with pronounced biological activity Polysaccharide sulphuric acid half esters of: Biological activity Remarks Ref Curdlan ... ester prepared as a colon-speci c prodrug of 5- aminosalicylic acid, which is active against inflammatory bowel diseases, and for dextran -5- (4-ethoxycarbonylphenylazo)salicylic acid ester [496, 497]...
Ngày tải lên: 25/10/2013, 16:20
Tài liệu Activity 5.1: Risks of Skipping Logical Design docx
... 28 Activity 5. 1: Risks of Skipping Logical Design Exercise 1: Identifying Potential Risks of Not Doing Logical Design ! Identify potential risks of not doing logical design Consider the ... that logical design brings to the design process As a class, discuss the possible risks involved in not completing a logical design The instructor will write your answers on a flip chart ...
Ngày tải lên: 10/12/2013, 16:16