... with congenital heart disease and need for follow up in adult life Heart, 85(4), 438–443 Adult Congenital Heart Disease: A Practical Guide Michael A Gatzoulis, Lorna Swan,... Heart ... Congenital Heart Defects.com This site is devoted to providing information to members of the worldwide congenital heart defect (CHD) community www.congenitalheartdefects.com • The Congenital ... Congenital Heart Disease www.jsachd.org • Congenital Heart Surgeon’s Society www.chssdc.org • 2000 Canadian Cardiovascular Society Consensus Conference on Adult Congenital Heart Disease...
Ngày tải lên: 11/08/2014, 11:22
... with congenital heart disease and need for follow up in adult life Heart, 85(4), 438–443 Adult Congenital Heart Disease: A Practical Guide Michael A Gatzoulis, Lorna Swan,... Heart ... Congenital Heart Defects.com This site is devoted to providing information to members of the worldwide congenital heart defect (CHD) community www.congenitalheartdefects.com • The Congenital ... Congenital Heart Disease www.jsachd.org • Congenital Heart Surgeon’s Society www.chssdc.org • 2000 Canadian Cardiovascular Society Consensus Conference on Adult Congenital Heart Disease...
Ngày tải lên: 10/08/2014, 22:24
Textbook of Traumatic Brain Injury - part 4 pdf
... for the efficacy of psychotherapy For example, exposure therapy for avoidance of feared activities makes sense, but the efficacy of this approach in patients with TBI has not been established For ... incidental memory is more intact than effortful memory Therefore, the examiner may obtain more information using an open-ended design than a structured interview format, such as is required by the ... and to designate specific time frames for the initiation and discontinuation of pharmacotherapy for acute episodes and for the initiation of pharmacotherapy for chronic aggressive behavior The...
Ngày tải lên: 10/08/2014, 18:20
awareness of deficit after brain injury clinical and theoretical issues jan 1991
... Department of Psychology University of Arizona Tucson, Arizona New York Oxford OXFORD UNIVERSITY PRESS 1991 Oxford University Press Oxford New York Toronto Delhi Bombay Calcutta Madras Karachi Petaling ... Copyright © 1991 by Oxford University Press, Inc Published by Oxford University Press, Inc., 200 Madison Avenue, New York, New York 10016 Oxford is a registered trademark of Oxford University Press ... 1988) Thus, for example, amnestic patients who lack explicit, conscious memory for recent experiences nevertheless possess intact implicit memory for various aspects of those experiences (for review,...
Ngày tải lên: 11/06/2014, 09:45
Báo cáo hóa học: " Effectiveness of a Wii balance board-based system (eBaViR) for balance rehabilitation: a pilot randomized clinical trial in patients with acquired brain injury" ppt
... laboratory-grade force platform, which is considered the gold standard measure of balance The results suggest that the WBB could be considered as a valid portable low-cost tool for assessing standing ... their efficacy Therefore, we designed eBaViR, a virtual rehabilitation system for balance recovery that provides motivational task oriented exercises specifically designed for ABI people by clinical ... rehabilitation therapies Written informed consent was obtained from patients for publication of this case report and accompanying images A copy of the written consent is available for review by the Editor-inChief...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Inhibition of the alternative complement activation pathway in traumatic brain injury by a monoclonal anti-factor B antibody: a randomized placebo-controlled study in mice" pot
... X-100 solution for 60 at RT for permeabilization Slides were then incubated with the TdT-enzyme in reaction buffer containing fluorescein-dUTP for 90 at 37°C Negative control was performed using ... antibody and performed the zymosan assay IL, AMH, MET, and MR performed the TUNEL and immunohistochemistry experiments IL, MR and DH performed the real-time RT-PCR analyses DR and PAW performed the ... the formation of the membrane attack complex (MAC, C5b-9) through the terminal complement pathway The MAC forms through the self-association of C5b along with C6 through C9 and leads to the formation...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Air pollution & the brain: Subchronic diesel exhaust exposure causes neuroinflammation and elevates early markers of neurodegenerative disease" pdf
... air pollution in cardiovascular and pulmonary disease [12], accumulating evidence now points to a new role for air pollution in CNS disease [10] For example, human studies have shown that living ... Rockford, IL) Samples were spun at 4°C 14,000 g for minutes and supernatant was collected for analysis Protein concentration was determined by the BCA protein assay (Thermo Scientific, Rockford, ... snap frozen and stored at -80C° For the current study, only one hemisphere of the brain was available for analysis Housing and experimental use of the animals were performed in strict accordance...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Differential aquaporin 4 expression during edema build-up and resolution phases of brain inflammation" doc
... Immunostaining was performed against AQP4, ED1 and Iba1 (for macrophages and microglia), IgG (for serum protein accumulation secondary to BBB alteration) and GFAP (for astrocytes) Immunostaining For immunohistochemistry, ... AQP4 Isoform 1: NM_012825.3 Sens: TTGGACCAATCATAGGCGC 770 to 788 Isoform 213 pb 98.2% 90 pb 102.0% 778 to 796 Isoform Isoform 2: NM_001142366.1 Revs: GGTCAATGTCGATCACATGC 963 to 982 Isoform NM_017009.2 ... MR scans conducted just before sacrifice (n = 25) By introducing the repetitive MR scans that were performed before sacrifice (two to three scans per animal except for dpi, total = 49) and by...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Origin and consequences of brain Toll-like receptor 4 pathway stimulation in an experimental model of depression" docx
... Mortlake, NSW, Australia) The primers used were: for iNOS, forward: 5’-GGA CCA CCT CTA TCA GGA A-3’, and reverse: 5’-CCT CAT GAT AAC GTT TCT GGC-3’, for COX-2 forward: 5’-CTT CGG GAG CAC AAC AGA G-3’, ... reverse: 5’-GCG GAT GCC AGT GAT AGA G-3’, for TLR4, forward: 5’-AGT TGG CTC TGC CAA GTC TCA GAT- 3’, reverse: 5’-TGG CAC TCA TCA GGA TGA CAC CAT-3’, for MD-2 forward: 5’-CAT AGA ATT GCC GAA GCG CAA ... CAT CTG TGA TGG CCC TTA GGA-3’, for NFB subunit p65, forward: 5’-CAT GCG TTT CCG TTA CAA GTG CGA-3’, reverse: 5’-TGG GTG CGT CTT AGT GGT ATC TGT-3’, for IBa forward: 5’-TGG CCT TCC TCA ACT...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Interleukin-1alpha expression precedes IL-1beta after ischemic brain injury and is localised to areas of focal neuronal loss and penumbral tissues" pdf
... injured areas is not uniform suggesting that it is regulated Conclusions The early expression of IL-1α in areas of focal neuronal injury suggests that it is the major form of IL-1 contributing ... IL-1α-positive microglia were present in the cerebral cortex, the piriform cortex, the ventral striatum and the thalamus Immunohistochemistry for IL-1α, with cresyl violet co-staining, localized IL1α expressing ... interest for quantification of mean fluorescence intensities (MFIs) in whole microglia and microglial nuclei were selected using the GFP and DAPI signals respectively MFIs were quantified for IL-1α...
Ngày tải lên: 19/06/2014, 22:20
Theory of Brain Function quantum mechanics and superstrings - part 4 ppt
... suggestive for a possible use of MTs as “information processors” It should be rather obvious that such a delicate, fine MT organization is there for some good reason 32 Further evidence for the ... conformational changes In the case of MTs, the programmable and adaptable nature of the tubulin conformational states can be easily used to represent and propagate information Further evidence for ... of information from one point to other in MT, by transforming the hexagonal surface organization into a new cubic state Undoubtedly, microtubule symmetry and structure are optimal for information...
Ngày tải lên: 10/08/2014, 00:21
Traumatic brain injury and the effects of diazepam, diltiazem, and MK-801 on GABA-A receptor subunit expression in rat hippocampus ppt
... difference from the value of the mean sham density for each blot, where the mean sham density was normalized at 100 Therefore, OD measurements for each band in both studies were defined in ROD ... used for time point comparisons for each subunit The results of this analysis indicated that the 24 hour post-injury time point revealed the greatest changes across the most subunits Therefore, ... first few hours after injury, therefore providing a widow of initial therapeutic sensitivity for BZ treatment post-TBI The α subunit of the GABAAR is important for postsynaptic signaling of the...
Ngày tải lên: 10/08/2014, 05:21
Textbook of Traumatic Brain Injury - part 1 ppt
... in age and level of hypotension are not known Information on other factors is incomplete, and data for predictive factors for moderate and mild forms of TBI are not available Estimating Brain ... with $32 billion for survivors and $16 billion for fatal brain injuries Average medical and nonmedical costs for each fatal TBI case ($450,000) were three times higher than for TBI survivors ... informed consent for the use of organs and tissues beyond diagnostic purposes, to inform patients and family about the benefits of research and medical education to society, and to provide information...
Ngày tải lên: 10/08/2014, 18:20
Textbook of Traumatic Brain Injury - part 2 potx
... et al.’s (1994) original for the standard comparisons as referenced for rating pathology The Victoroff et al (1994) method for rating WM hyperintensities can be adapted for use in rating WM pathology ... performance of neuropsychological tests) Fewer studies use preand postrecovery scans, which offer the benefit of allowing for comparison in the same patients For activation studies, controlling for ... be given to studies performed with the newer “tri- FIGURE 6–1 scan Procedure for obtaining a SPECT The same scanner is used for imaging many body systems, including brain, heart, bone, and lung...
Ngày tải lên: 10/08/2014, 18:20
Textbook of Traumatic Brain Injury - part 3 pot
... assessment, memory for verbal and visual information is formally measured Memory for material immediately after the material has been presented is referred to as immediate memory Memory for information ... and informationprocessing capacity It is a 10-minute test that was originally designed for adults but currently has versions appropriate for children ages 9–15 years The ACT is useful for a variety ... information As a result, the patient requires a cue or recognition stimulus for the Anxiety can interfere with the patient’s ability to attend to, learn, and remember new information and therefore...
Ngày tải lên: 10/08/2014, 18:20