1 energy saving and a shift to renewable energy
grid computing esis analysis of its impact on business and the shift to a services infrastructure
Ngày tải lên :
30/09/2014, 22:23
... WHAT IS DRAMATICALLY NEW ABOUT ABOUT GRIDS? a a a a GRIDS BEGIN AS A WAY TO ACCELERATE COMPUTING THEY EVOLVE TO A TECHNOLOGY THAT MAKES APPLICATIONS INFRASTRUCTURE AWARE THIS IMBEDS ... interfaces that address such fundamental issues as authentication, authorization, resource discovery, and resource access – these protocols and interfaces must be standard and open Otherwise, we are ... first to adopt blade servers in large numbers GRID ADOPTION - PHARMAS, AEROSPACE 20 GRID ADOPTION - HEALTH CARE 21 Communications Services Hospitals Financial Services Aerospace Autos Pharmaceuticals...
- 41
- 212
- 0
The Retirement Crisis and a Plan to Solve It doc
Ngày tải lên :
14/03/2014, 21:20
... Plans”), such as 401(k) plans DC Plans allow people to save for retirement on a tax-advantaged basis and are more attractive to many employers because they shift virtually all of the risks associated ... 2011), available at http://help.senate.gov/hearings Id (Statement of David Marchick, The Carlyle Group) Senator Tom Harkin, Saving the American Dream: The Past, Present, and Uncertain Future of America’s ... the financial decisions they have to make.19 However, when saving is easy and automatic, people are much more likely to put money aside.20 By ensuring that every American has access to a retirement...
- 10
- 336
- 0
Báo cáo khoa học: "Capnography during cardiac resuscitation: a clue on mechanisms and a guide to intervention" pps
Ngày tải lên :
12/08/2014, 20:20
... Critical Care December 2003 Vol No Kazmuri and Kabe validate animal studies suggesting that the initial PETCO2 may help identify the mechanism of cardiac arrest PETCO2 during cardiac arrest and ... asphyxia in which impaired gas exchange precedes cessation of cardiac activity, allowing CO2 to travel to and accumulate in the lungs before the onset of cardiac arrest (decreased V/Q) In contrast, ... resuscitation approaches emphasize algorithms that lack objective and real-time measurements of efficacy The principles underlying capnography are scientifically robust and supported by good laboratory...
- 3
- 184
- 0
Exact modeling of multiple access interference, ber derivation and a method to improve the performance of UWB communication systems
Ngày tải lên :
05/10/2015, 22:04
... Niranjayan, A Nallanathan and B Kannan, “Exact Modeling of Multiple Access Interference and BER Derivation for TH-PPM UWB”, WCNC 2005, Accepted for publication [5] S Niranjayan, A Nallanathan and ... information successfully In fading channels, where the instantaneous SNR is a random variable, the average SNR is used as the measure Another standard measure in fading channels is the outage probability, ... in chapter The outputs from this work can be found in the following publications: [1] S Niranjayan, A Nallanathan and B Kannan, “An Adaptive Transmit Diversity Scheme Based on Spatial Signal Combining...
- 104
- 421
- 0
AN1251 using HI TECH c® and a timer to interface mid range PIC MCUs with UNIO® serial EEPROMs
Ngày tải lên :
11/01/2016, 17:03
... 0x000 A NoMAK terminates the operation Reading Data Back After the read command and word address have been sent and acknowledged, the serial EEPROM sends the first data byte from the array, starting ... certification for its worldwide headquarters, design and wafer fabrication facilities in Chandler and Tempe, Arizona; Gresham, Oregon and design centers in California and India The Company’s quality ... the array in a random access manner Reading data from the array is very similar to the write operation, except that the read is not limited to a single page In order to read from the array, the...
- 16
- 246
- 0
Renewable energy is a challenge, but also an opportunity for new industries, employment, and new ways to reduce dependency on fuel imports, provide electricity to poor remote areas, reduce air pollution
Ngày tải lên :
08/09/2015, 23:32
... straw, corn cob, cassava stalk, and sugarcane bagasse Residue -to- product ratios were drawn from international studies and data from the Lao PDR and Thailand As shown in Table 4.3, the annual ... developments and potential in Cambodia, the Lao PDR, Myanmar, Thailand, and Viet Nam 11 Renewable Energy Developments and Potential in Cambodia 4.1 Institutional and Policy Framework for Renewable Energy ... Feedstock: Thailand 7.9 Land Requirement for Cassava as Bio-Ethanol Feedstock: Thailand 7.10 Theoretical Biogas Energy Potential: Thailand 7.11 Technical Biogas Energy Potential: Thailand 7.12 Energy...
- 168
- 633
- 0
A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 1
Ngày tải lên :
14/09/2015, 14:02
... Laboratory of Optical Imaging and Photodynamic Therapy in the National Cancer Centre, namely Dr Patricia Thong, Ms Ramaswamy Bhuvaneswari, Mr William Chin and Ms Lucky Sasidharan, and also to colleagues ... 15 A typical AFM and SNOM mappings of a 100-nm nano-cavity substrate with cavitysurface distance of (a and b) 10 nm, and (c and d) 20 nm (a) and (c) are topology plot, while (b) and (d) are near-field ... substrates I am also indebted to Ms Iman Ahmad and Dr Srinivasan Madhavi for their assistance in preparing Au substrates I would also like to express my deepest appreciation to my colleagues at Laboratory...
- 129
- 265
- 0
Saving and Investing: A Roadmap To Your Financial Security Through Saving and Investing ppt
Ngày tải lên :
06/03/2014, 10:20
... free to ask questions about how and how much your adviser is being paid And if the fee is quoted to you as a percentage, make sure that you understand what that translates to in dollars A ROADMAP ... cards and begun to set aside some money to save and invest, what are your choices? A ROADMAP TO YOUR JOURNEY TO FINANCIAL SECURITY | Making Money Grow THE TWO WAYS TO MAKE MONEY There are basically ... BETWEEN SAVING AND INVESTING Saving Your “savings” are usually put into the safest places, or products, that allow you access to your money at any time Savings products include savings accounts,...
- 32
- 350
- 0
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf
Ngày tải lên :
23/03/2014, 21:20
... under anaerobic conditions, decreases in absorbance at 400, 535 and 690 nm took place and broad bands appeared at 431 and 795 nm (Fig 4A, spectrum a) The absorption around 795 nm initially increased ... ferrous and Scheme Three reaction formulae proposed for the conversion of a- hydroxyhaem to verdohaem (A) , (B) and (C) are formulated after Matera et al [26,27], Liu et al [23] and Sakamoto et al [24], ... decrease in absorbance between 300 and 600 nm (compare spectra a and b) was probably due to the precipitation of free a- hydroxyhaem These observations indicated that a- hydroxyhaem might be apt to...
- 9
- 501
- 0
Báo cáo hóa học: " Research Article Trade-Offs between Energy Saving and Reliability in Low Duty Cycle Wireless Sensor Networks Using a Packet Splitting Forwarding Technique" docx
Ngày tải lên :
21/06/2014, 11:20
... when r = m and r = 10 m (a) , and for different values of R/r (b) nominal values of TAMAX that can be used to achieve the synchronization can be calculated according to (2), and are TAMAX = 31.25 ... algorithm parameters in order to obtain a reasonably trade-off between energy consumption and reliability Finally, through simulations, we have assessed the results obtained analytically, and we have ... mentioning that TAMAX can be evaluated taking the specific MAC protocol into account For instance, in the case of the IEEE 802.15.4 standard [12], the maximum backoff time is 27.4 ms and assuming a negligible...
- 11
- 352
- 0
Giáo án Anh văn lớp 9 - Unit 3 A trip to the countryside - Period 15 - Lesson 1 : getting started listen and read ppt
Ngày tải lên :
03/07/2014, 21:20
... river bank ) T F ( Liz took a lot of photos to show the trip to her parents ) - Read the text again T and answer the - Ask Ss to read the text again and answer thequestions : questions - Ask Ss to ... - Read their answers aloud - Call on Ss to read their answers aloud - Remark and correct mistakes if any - Give correct answers : 1.F ( Ban ad his family had a day trip to their home village ... of photo to show the trip to her parents - Ask Ss to read all the answers again and copy - Repeat all the correct - Call on some Ss to read the text aloud answers aloud - Correct mistakes...
- 6
- 6K
- 7
Analytic Number Theory A Tribute to Gauss and Dirichlet Part 1 pdf
Ngày tải lên :
06/08/2014, 01:21
... (qualification examination for lecturing at a university) and a modest annual salary of 400 talers, which was the usual starting salary of an associate professor at that time (This was not too bad an offer ... Breslau was to habilitate (qualify as a university lecturer) According to the rules in force he had a) to give a trial lecture, b) to write a thesis (Habilitationsschrift) in Latin, and c) to defend ... G¨ttingen, but he held a chair for astronomy o and was first and foremost Director of the Sternwarte, and almost all his courses were devoted to astronomy, geodesy, and applied mathematics (see the list...
- 20
- 365
- 0
UNIT 3: A TRIP TO THE COUNTRYSIDE Lesson 1: Getting started, Listen and read pps
Ngày tải lên :
08/08/2014, 14:22
... statement is true and which is false a Many people like going to their house village for their weekends b There is a small bamboo forest at the entrance to the village c Liz had a snack at Ba’s uncle’s ... visit Ba’s uncle - go boating - walk up the mountain - had a picnic on the river bank - visit a shrine 2.T/F statements: - Ask ss to read the statements on page 23 and decide which statement ... There is a shrine on the mountain near Ba’s village e Everyone had a picnic on the mountain f Everyone left the village late in the evening g Liz had a videotape to show the trip to her parents...
- 5
- 9.7K
- 4
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
Ngày tải lên :
09/08/2014, 08:22
... Primers and probes 11β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC ... GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC ... CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: TGT GTG AGA TGT GCT TTC TGG TT C/EBPα Forward primer: TGGACAAGAACAGCAACGAG Reverse primer: TTGTCACTGGTCAGCTCCAG...
- 10
- 438
- 0
Báo cáo y học: " A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus" pptx
Ngày tải lên :
11/08/2014, 21:21
... same rate as DNA band number increases Three to five independent processivity assays were performed for each RT and statistical values that include mean, median, standard deviation and maximum and ... known amount of wild type and mutated (AAA/AGA) cDNA, and generated regression line between ratios of peak heights for A and ‘G’ nucleotides (A/ G) and cDNA concentrations (Figure 3) The percentages ... exposed to autoradiography cDNA fragments of different lengths and intensities are shown here In actual autoradiograph, we were able to observe the largest cDNA bands of 72 nt, 48 nt and 54 nt...
- 12
- 369
- 0
Báo cáo y học: " Journey to the heart of macrophages: the delicate relationship between HIV-1 and a multifaceted cell type" ppt
Ngày tải lên :
12/08/2014, 23:23
... exposed to HIV promote highly efficient viral replication upon differentiation into macrophages and interaction with T cells Virology 2006, 344:267-276 Mantovani A, Sica A, Sozzani S, Allavena P, ... encephalitis (HIVE) is described by the accompanying review of Gras and Kaul [11] Finally, the interplay between macrophage polarization and the effect that different viral proteins exert on the activation ... their differentiation into macrophages, and according to the stimulation received, macrophages become permissive to HIV-1, and albeit remaining more restrictive to the virus than other cell types,...
- 2
- 287
- 0
Báo cáo y học: "The V1-V3 region of a brain-derived HIV-1 envelope glycoprotein determines macrophage tropism, low CD4 dependence, increased fusogenicity and altered sensitivity to entry inhibitors" ppsx
Ngày tải lên :
13/08/2014, 05:21
... particular the brain [42-48] probably leading to compartmentalization and a progressive adaptation to this niche We previously described that a primary peripheral isolate adapted in vitro to grow ... inhibitor, and immediately the same volume of viral stocks was added After 5–6 hours at 37°C, inocula and inhibitors were removed and the cells were incubated for 2–3 days before evaluating the amount ... et al [56] in that there is a relationship between macrophage tropism and sensitivity to certain entry inhibitors Similar to us, they found that decreasing sensitivity to an anti-CD4 mAb and to...
- 22
- 273
- 0
A Guide to Microsofl Excel 2002 for Scientists and Engineers phần 1 pdf
Ngày tải lên :
14/08/2014, 06:22
... convenient to divide the window into seven main parts: title bar, menu bar, Standard toolbar, Formatting toolbar, workspace, task pane and status bar You will be familiar with the first four areas from ... YiewlIoolbars to hide the toolbar The command YiewJTaskPane may be used to open and close the task pane Exercise 5: Customizing Menus and Toolbars The menus and toolbars are set up for the average user ... more tools, click on the Command tab of the Customize window Select a topic such as Web and move the vertical slider to review the available tools To add a tool, drag it onto the toolbar at the...
- 34
- 425
- 0