1 closed circuit anaesthesia with a laser safe et tube

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

... 5'-AGGGCGGGGGCATCGGGCACCGGGATGGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated ... (5'gatttcgcgcaggtgatgag-3') for UL8; and 18S rRNA-f (5'-actcaacacgggaaacctca-3') and 18S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18S rRNA Reactions were performed using SYBER Premix Ex Taq II (Takara) with ... Real-time PCR amplifications were performed with primers UL6-f (5'-aaattctgtgtcaccgcaacaac-3') and UL6-r (5'-gcccgaagcactgactcaa-3') for UL6; UL8-f (5'-cttgctggacgcagagcacta-3') and UL8-r (5'gatttcgcgcaggtgatgag-3')...

Ngày tải lên: 20/06/2014, 01:20

13 463 0
Báo cáo y học: "Latency profiles of full length HIV-1 molecular clone variants with a subtype specific promoter" pps

Báo cáo y học: "Latency profiles of full length HIV-1 molecular clone variants with a subtype specific promoter" pps

... Jolla, USA) The CA-p24 concentration was determined by a twin-site ELISA with D7320 (Biochrom, Berlin, Germany) as capture antibody and alkaline phosphatase-conjugated anti-p24 monoclonal antibody ... CC3’ and 5’TGT CTC ATG AGC GGA TAC ATA3’ were used in reaction A (italics indicate the NFB-II site) Reaction B was performed with primers 5’GTC CCC TGC GGA AAG TCC CTA GTT AG3’ and 5’TGG AAG GGC ... TAA TTC ACT CCC3’ Both PCR products, purified from gel, were used as templates in a third PCR under standard conditions with primers 5’TGT CTC ATG AGC GGA TAC ATA3’ and 5’TGG AAG GGC TAA TTC ACT...

Ngày tải lên: 13/08/2014, 01:21

12 238 0
Báo cáo khoa học: Phenylalanine-independent biosynthesis of 1,3,5,8-tetrahydroxyxanthone A retrobiosynthetic NMR study with root cultures of Swertia chirata docx

Báo cáo khoa học: Phenylalanine-independent biosynthesis of 1,3,5,8-tetrahydroxyxanthone A retrobiosynthetic NMR study with root cultures of Swertia chirata docx

... chirata joins the growing list of secondary plant metabolites that are derived from an early shikimate derivative as opposed to a pathway via phenylalanine and cinnamate A hypothetical mechanism ... intermediary metabolites such as carbohydrate phosphates, pyruvate, and acetyl-CoA via the major glucose utilization pathways (glycolysis and pentose phosphate cycle) Simultaneously, intermediary metabolites ... phosphoenolpyruvate unit by decarboxylation of Cambridge Isotope Laboratories (Andover, MA, USA) [U-13C9]Cinnamic acid was prepared by treatment of 13 L-[U- C9]phenylalanine with phenylalanine ammonia-lyase...

Ngày tải lên: 08/03/2014, 02:21

9 464 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

... a- cyano-4-hydroxycinnamic acid as matrix Sample preparation It has been shown that a trifluoroacetic acid pretreatment renders Ab easily soluble in aqueous solutions and in organic solvents; the trifluoroacetic acid ... support, loaded with Na-Fmoc-Ala (Fmoc-Ala-PAC-PEG-PS) was from Millipore (Waltham, MA, USA) Fmoc-Ala-PACPEG-PS resin (0.15 mmolÆg)1, g) was treated with piperidine (20%) in dimethylformamide and linked ... been aptly described by Rajan et al as a Teflon coating that can surround a helix [16] in the case of a mixture of water and hexafluoroacetone hydrate, a mixture with properties very similar to...

Ngày tải lên: 08/03/2014, 09:20

7 624 0
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx

Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx

... A, Ohtaki A, Kaji A, Tonozuka T & Sakano Y (2002) Crystal structures of Thermoactino˚ myces vulgaris R-47 a- amylase (TVA I) at 1.6 A reso˚ resolution lution and a- amylase (TVA II) at 2.3 A J Mol ... which have a homo-dimeric or -tetrameric structure with domain N acting as a connector By contrast, TVAI adopts a monomeric structure with domain N, a starch-binding domain, acting as an anchor ... Structure of a- amylase with pullulan model ligand A Abe et al Fig Chemical structures of the repeat units of pullulan, P2 and P5 A solid arrow indicates the main hydrolysing site, and a dashed arrow...

Ngày tải lên: 16/03/2014, 14:20

9 342 0
Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulfide linkage pdf

Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulfide linkage pdf

... resonance of 4,4-dimethyl-4-silapentane-1-sulfonic acid used as an internal standard Distance restraints and structure calculations An initial survey of distance constraints was performed on a series ... outcome was a set of 20 ˚ structures with a mean global rmsd of 0.56 ± 0.16 A and a ˚ mean global heavy atom rmsd of 1.30 ± 0.28 A Structural refinement was carried out using amber and structure quality ... zation of a novel conus peptide with apparent antinociceptive activity J Biol Chem 275, 32391–32397 18 Sharpe IA, Gehrmann J, Loughnan ML, Thomas L, Adams DA, Atkins A, Palant E, Craik DJ, Adams DJ,...

Ngày tải lên: 30/03/2014, 09:20

7 346 0
Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

... One microgram of total RNA was annealed with an oligo(dT) primer and the first strand cDNAs were synthesized with avian myeblastoma virus (AMV) reverse transcriptase (Takara Biomedicals) at 45 °C ... was used as a marker for cytoplasmic extraction The same membrane was used for immunoblot analysis with aF-N, aF-C and anti- (a- tubulin) Ig Lanes and 4, whole cell lysate; lanes and 5, cytoplasmic ... 3-methylcholanthrene, detected by a DNA fingerprint assay Cancer Res 52, 5788–5793 12 Kitazawa, T., Kominami, R., Tanaka, R., Wakabayashi, K & Nagao, M (1994) 2-Hydroxyamino-1-methyl-6-phenylimidazo[4,5,-b]pyridine...

Ngày tải lên: 31/03/2014, 23:20

7 305 0
Báo cáo sinh học: " Research Article Aλ3 λ1 , λ2 , Ω -Weighted Inequalities with Lipschitz r and BMO Norms" doc

Báo cáo sinh học: " Research Article Aλ3 λ1 , λ2 , Ω -Weighted Inequalities with Lipschitz r and BMO Norms" doc

... is called the The nonlinear elliptic partial differential equation d A x, du homogeneous A- harmonic equation or the A- harmonic equation, and the differential equation d A x, du B x, du 1.7 is called ... fractional integrals, e Calderon-Zygmund operators and commutators,” Indiana University Mathematics Journal, vol 49, no ´ 2, pp 697–721, 2000 14 Journal of Inequalities and Applications J Garc a- Cuerva ... Ls μ -averaging e domains,” Journal of Mathematical Analysis and Applications, vol 227, no 1, pp 200–215, 1998 13 S Ding and C A Nolder, “Weighted Poincar´ inequalities for solutions to A- harmonic...

Ngày tải lên: 21/06/2014, 17:20

14 275 0
Báo cáo hóa học: " Research Article On a Hilbert-Type Operator with a Symmetric Homogeneous Kernel of −1-Order and Applications" doc

Báo cáo hóa học: " Research Article On a Hilbert-Type Operator with a Symmetric Homogeneous Kernel of −1-Order and Applications" doc

... of the Belgian Mathematical Society, vol 13, no 4, pp 577–584, 2006 [3] B Yang, “On the norm of an integral operator and applications,” Journal of Mathematical Analysis and Applications, vol ... operator and applications to bilinear integral inequalities,” to appear in Taiwanese Journal of Mathematics [7] Z Wang and D Gua, An Introduction to Special Functions, Science Press, Bejing, China, ... [4] B Yang, “On the norm of a self-adjoint operator and a new bilinear integral inequality,” Acta Mathematica Sinica, vol 23, no 7, pp 1311–1316, 2007 ´ e [5] A B´ nyi and C Oh, “Best constants...

Ngày tải lên: 22/06/2014, 18:20

9 334 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 1) ppt

Chapter 052. Approach to the Patient with a Skin Disorder (Part 1) ppt

... >0.5 cm in diameter Wheal: A raised, erythematous, edematous papule or plaque, usually representing short-lived vasodilatation and vasopermeability Telangiectasia: A dilated, superficial blood vessel ... interpretation would be that the patient has a pruritic eczematous dermatitis with erosions caused by scratching Figure 52-1 Superficial spreading melanoma This is the most common type of melanoma ... Such lesions usually demonstrate asymmetry, border irregularity, color variegation (black, blue, brown, pink, and white), a diameter >6 mm, and a history of change (e.g., an increase in size or...

Ngày tải lên: 06/07/2014, 20:20

5 414 0
Working with a study budy 1 pot

Working with a study budy 1 pot

... don’t have anyone whom with to share ideas and interpretations, or to exchange questions and answers? You can treat yourself as your own buddy! 17 B EING Y OUR O WN PARTNER M any students say what ... suitable for the way you learn Be aware of what works best for you and make changes if necessary (You may want to review Chapters through on learning styles.) START WITH THE POSITIVE Begin a session ... by asking yourself what you liked about what you read, wrote, saw, or heard Starting out with something you enjoy and feel comfortable with will give you a sense of accomplishment as you say...

Ngày tải lên: 07/08/2014, 22:20

6 288 0
Báo cáo y học: "Segregation of a M404V mutation of the p62/sequestosome 1 (p62/SQSTM1) gene with polyostotic Paget''''s disease of bone in an Italian family" pps

Báo cáo y học: "Segregation of a M404V mutation of the p62/sequestosome 1 (p62/SQSTM1) gene with polyostotic Paget''''s disease of bone in an Italian family" pps

... years after the diagnosis of PDB, bone pain in the right pelvis increased markedly and a Available online http://arthritis-research.com/content/7/6/R1289 Table Available clinical and mutational ... L, Cahill DP, Frassica FJ, Streeten EA, Levine MA, Fraser CM, et al.: Mutation screening of the TNFRSF1 1A gene encoding receptor activator of NFκB (RANK) in familial and sporadic Paget's disease ... at this stage in asymptomatic mutant carriers However, considering that a positive individual older than R1293 Arthritis Research & Therapy Vol No Falchetti et al 40 years of age has an up to...

Ngày tải lên: 09/08/2014, 07:20

7 355 0
Báo cáo y học: "Attenuation of murine antigen-induced arthritis by treatment with a decoy oligodeoxynucleotide inhibiting signal transducer and activator of transcription-1 (STAT-1)" ppt

Báo cáo y học: "Attenuation of murine antigen-induced arthritis by treatment with a decoy oligodeoxynucleotide inhibiting signal transducer and activator of transcription-1 (STAT-1)" ppt

... Sugiura T, Tanaka M, Nakagawa M, Ichida H, Takagi K, Higami-Ohsako S, et al.: Amplification of the synovial inflammatory response through activation of mitogen-activated protein kinases and nuclear ... bp); IRF-1, 5'-gca aaa cca aga gga agc tg-3' and 5'-cag gta gcc ctg agt ggt gt-3' (PCR product size 113 bp); GAPDH, 5'-gac cac agt cca tgc cat cac tgc-3' and 5'-atg acc ttg ccc aca gcc ttg g-3' ... pairs (bp)); STAT3, 5'-tca ctt ggg tgg aaa agg ac-3' and 5'-tgg tcg cat cca tga tct ta-3' (PCR product size 129 bp); CD40, 5'-ccc tgg gac ttc atg gta aa-3' and 5'-gca cac atg gag gtc aaa tg-3' (PCR...

Ngày tải lên: 09/08/2014, 07:20

13 449 0
Báo cáo khoa học: "SemiWhole brain radiotherapy with a conformational external beam radiation boost for lung cancer patients with 1-3 brain metastasis: a multi institutional study" pdf

Báo cáo khoa học: "SemiWhole brain radiotherapy with a conformational external beam radiation boost for lung cancer patients with 1-3 brain metastasis: a multi institutional study" pdf

... article as: Casanova et al.: Whole brain radiotherapy with a conformational external beam radiation boost for lung cancer patients with 1-3 brain metastasis: a multi institutional study Radiation ... patients presented with extra cranial failure/local brain failure/distant brain failure and extra cranial failure/distant brain failure, respectively Extra cranial failure and local brain failure ... Sham JS, Lau WH, Tung Y: Radiotherapy of brain metastases from carcinoma of the bronchus Clinical radiology 1989, 40:193-194 Page of 15 Egawa S, Tukiyama I, Akine Y, Kajiura Y, Yanagawa S, Watai...

Ngày tải lên: 09/08/2014, 08:22

8 375 0
Báo cáo y học: " Oral vaccination with a recombinant Salmonella vaccine vector provokes systemic HIV-1 subtype C Gag-specific " ppt

Báo cáo y học: " Oral vaccination with a recombinant Salmonella vaccine vector provokes systemic HIV-1 subtype C Gag-specific " ppt

... that had been orally vaccinated with a recombinant Salmonella enterica serovar Typhimurium aroC vaccine vector that expressed codon-optimized HIV-1 subtype C Gag antigen Methods Bacterial strains ... manuscript All the authors read and approved the manuscript Acknowledgements This work was supported financially by a grant from the South African Aids Vaccine Initiative (SAAVI) of the Medical ... vaccination with the recombinant codonoptimized HIV-1 Gag-expressing Salmonella vaccine vector, aroC+Gag, were evaluated using ELISPOT assays Mice vaccinated with aroC+Gag developed HIV-1 Gag-specific...

Ngày tải lên: 12/08/2014, 04:21

9 217 1
Báo cáo y học: " Natural killer cells control a T-helper 1 response in patients with Behçet''''s disease" doc

Báo cáo y học: " Natural killer cells control a T-helper 1 response in patients with Behçet''''s disease" doc

... cells and natural killer cells in Beh et' s disease J Rheumatol 1992, 19:588-592 Kaneko F, Takahashi Y, Muramatsu R, Adachi K, Miura Y, Nakane A, Minagawa T: Natural killer cell numbers and function ... asthma pathogenesis: natural killer cells in type cytokine predominance J Allergy Clin Immunol 2005, 115:841-847 Takahashi H, Amagai M, Tanikawa A, Suzuki S, Ikeda Y, Nishikawa T, Kawakami Y, Kuwana ... Imamura Y, Kurokawa MS, Yoshikawa H, Nara K, Takada E, Masuda C, Tsukikawa S, Ozaki S, Matsuda T, Suzuki N: Involvement of Th1 cells and heat shock protein 60 in the pathogenesis of intestinal...

Ngày tải lên: 12/08/2014, 12:20

9 323 0
Báo cáo y học: " Phylogenetic analysis consistent with a clinical history of sexual transmission of HIV-1 from a single donor reveals transmission of highly distinct variants" docx

Báo cáo y học: " Phylogenetic analysis consistent with a clinical history of sexual transmission of HIV-1 from a single donor reveals transmission of highly distinct variants" docx

... Weber Trial Physician Sarah Fidler Trial Statistician Abdel Babiker Data and Safety Monitoring Committee A McLaren (in memoriam), V Beral, G Chene, J Hakim Central Virology Laboratories and Repositories ... Naidoo) Uganda: MRC/Uganda Virus Research Institute, Entebbe (H Grosskurth, A Kamali, P Kaleebu, J Mugisha, U Bahemuka, F Lyagoba, P Tabuga) Spain: Hospital Clinic-IDIBAPS Univ of Barcelona Barcelona ... Zajdenverg, M Merçon) Italy: Ospedale San Raffaele, Milan (G Tambussi, C Tassan Din, C Ronchetti, G Travi, V Rusconi, G de Bartolo), Ospedale Lazzaro Spallanzani, Roma (G D’Offizi, C Vlassi, A...

Ngày tải lên: 13/08/2014, 01:21

14 360 0
Báo cáo khoa học: "High mobility group box-1 protein in patients with suspected community-acquired infections and sepsis: a prospective study" pot

Báo cáo khoa học: "High mobility group box-1 protein in patients with suspected community-acquired infections and sepsis: a prospective study" pot

... sepsis and septic shock Crit Care Med 2005, 33:564-573 24 Hatada T, Wada H, Nobori T, Okabayashi K, Maruyama K, Abe Y, Uemoto S, Yamada S, Maruyama I: Plasma concentrations and importance of ... Statistical analysis Data are presented as medians and interquartile ranges (IQRs) and as means standard deviations Significance testing was performed using the Kruskal-Wallis test and the Wilcoxon ... be classified were excluded from the analyses Laboratory assays HMGB1 was measured with a commercially available ELISA (HMGB1 ELISA kit; Shino-Test Corporation, Tokyo, Japan) The measuring range...

Ngày tải lên: 13/08/2014, 03:20

10 317 0
Báo cáo y học: " Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41" pdf

Báo cáo y học: " Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41" pdf

... virus replication At regular intervals, cells and filtered supernatant were stored at -80°C and virus was quantitated by CA-p24 ELISA When a revertant virus was identified, DNA was extracted from ... were transfected with the appropriate molecular clones and virus spread was measured (fig 5) The L593Q mutant replicated with a delay of approximately days compared to the wt virus Replication ... transfecting C3 3A cells with the appropriate pLAI constructs The virus containing supernatant was harvested days post-transfection, filtered and stored at -80°C The virus concentration was quantified...

Ngày tải lên: 13/08/2014, 13:20

11 393 0
w