1 the maven 2 project web site as a communication tool
báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc
Ngày tải lên :
19/06/2014, 10:20
... sends the data to a specific device or machine that then copies the data to the various people that are subscribers to the data For example, a user send their data to a multicast address and the ... replicated across all the sites and transmit only incremental changes Furthermore the main data-set is often cached locally at each of the collaborating sites to reduce the need for having to retransmit ... of the available fiber has been lit, and each fiber has several terabits/s of capacity The dot-com implosion has made this dark fiber and wavelengths of light in the fiber, very affordable The...
- 10
- 449
- 0
Báo cáo y học: "Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children" ppt
Ngày tải lên :
13/08/2014, 18:21
... Health (AYMH) scale as a screening tool for CMDs among Arabic-speaking youth The AYMH scale was developed as part of a large community-based participatory intervention to improve the mental health ... general, and anxiety and depression specifically, among Arab children and adolescents in the MENA region The validation revealed that the AYMH scale has reasonably good construct validity and ... well-being assessment Eastern Mediterranean Health Journal 20 06, 12( Supplement Number 2) :S138-S146 22 Makhoul J, Nakkash RT, El Hajj T, Abdulrahim S, Kanj M, Mahfoud Z, Afifi RA: Development and Validation...
- 7
- 386
- 0
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf
Ngày tải lên :
21/06/2014, 06:20
... include the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, the use of weaver ants in cashew ... in the TOT training, and they includes the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, ... in the same cashew orchards as we did five months ago in Dong Nai, Ba Ria Vung Tau and Binh Phuoc The orchard in Ba Ria-Vung Tau was sprayed by the orchard owner, which was unexpected The data...
- 12
- 531
- 1
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf
Ngày tải lên :
21/06/2014, 06:20
... Vietnam, there are at least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly ... knowledge of cashew insect pests and diseases and their natural enemies, and Weaver ant status and farmers’ opinion of them The results are summarised below A total of 21 2 cashew farmers were interviewed, ... (for grafted materials) and 12 years (for trees produced from seeds) (Table 3) Cashew nut yield was about 1400 kg/ha in 20 05 and 1000 kg/ha in 20 06 (Table 3) Cashew apples were generally wasted:...
- 7
- 400
- 0
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf
Ngày tải lên :
21/06/2014, 06:20
... has designated cashew development as a national priority Productivity of cashew has increased since 20 02, but the extensive use of pesticides has caused health problems to farmers, their animals ... strategy (weaver ants, pruning and light-trapping) to manage the branch borer that has been one of the major concerns by all cashew growers in Vietnam He has already passed this knowledge to IAS project ... in cashew orchards, (2) to make them aware of the existence and the role of natural enemies (especially weaver ants) on cashew trees, and (3) to provide them with information about the advantages...
- 24
- 453
- 0
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt
Ngày tải lên :
21/06/2014, 06:20
... heartwood at the tree base, and each larva excavated a chamber in which the calcareous pupal cell was formed from the excretions of the larva Pupation took place late in the year The pupa is about ... borers in the farmer’s plot and the IPM plot at Binh Phuoc province, Vietnam Farmer IPM 22 23 31 23 23 23 23 23 24 12 Dec Jan Jan Feb Feb Mar Mar Apr Apr Apr May May Jun Jun Jul Dec Jan Jan % shoots ... IPM 22 23 31 23 23 23 23 Dec Jan Jan Feb Feb Mar Mar Apr Apr Apr May May Jun 23 Jul 24 12 Jun Dec Jan Jan |-06-| -20 07 | -20 08 -| Fig The mean % shoots with aphids in the...
- 26
- 491
- 0
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx
Ngày tải lên :
21/06/2014, 06:20
... methods and skills, and their understanding of the cashew IPM program A lot of farmers said that it was the best training they had received about cashews Although weaver ants are abundant, the farmers ... successfully passed their examinations Each of them was awarded a graduation certificate in the cashew IPM training Now, we have 1 12 TOT cashew IPM trainers, and they are distributed in ten cashew growing ... methods, and they were very interested in the field practical All the master trainers did their best to pass their knowledge to the TOT trainees A final examination at the end of each TOT training was...
- 10
- 302
- 0
Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx
Ngày tải lên :
13/08/2014, 01:21
... RIPA buffer (50 mM Tris-Cl; pH 7.5, 1% NP-40, 0.05% SDS, 150 mM CGAGATCCGTTCACTAATCGAATG B GGATTAACTGCGAATCGTTCTAGC C CGAGATCCGTTCACTAATCGAATG BA1 (b-actin) CATGTGCAAGGCCGGCTTCG BA4 (b-actin) GAAGGTGTGGTGCCAGATTT ... siGENOME SmartPool (UAGAUGAACUGAGUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), siGENOME Non-Targeting siRNA Pool #1 Either HeLa cells or 29 3T cells were transfected ... data AM conceived and coordinated the study, analyzed the data and wrote the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have...
- 15
- 470
- 0
Báo cáo y học: " Peptide P5 (residues 628–683), comprising the entire membrane proximal region of HIV-1 gp41 and its calcium-binding site, is a potent inhibitor of HIV-1 infection" pptx
Ngày tải lên :
13/08/2014, 05:21
... inhibitory activities against T20-resistant strains as compared with T20 (closed symbols) Sensitivity to P5 and T20 was measured in a single-cycle assay Each point represents the mean IC50 value of at ... concentration of 10 μM and in a pH 7 .2 buffer, displayed a positive peak after 195 nm and two negative maxima at 20 8 nm -22 2 nm, characteristic of α-helices (Figure 2) Quantification of the α-helical ... to the conception of the study, carried out the molecular biology, biophysical studies and neutralization assays, and drafted the manuscript DT participated to the neutralization and binding assays...
- 12
- 304
- 0
Báo cáo y học: " PDZ domain-binding motif of human T-cell leukemia virus type 1 Tax oncoprotein is essential for the interleukin 2 independent growth induction of a T-cell line" ppsx
Ngày tải lên :
13/08/2014, 09:21
... the manuscript Acknowledgements We thank William W Hall for donating the Tax2B plasmid and the antibody against Tax2B We thank the Takeda pharmaceutical company for providing recombinant human ... IL -2 We also thank Sayoko Takizawa and Chika Yamamoto for the excellent technical assistance This work was supported in part by a Grant-in-Aid for Scientific Research on Priority Areas and a Grant-in-Aid ... that Tax1 and Tax2 transform a rat fibroblast cell line (Rat-1) to induce colonies in soft agar (CFSA, colony formation in soft agar), and the activity of Tax1 is greater than that of Tax2 [ 32] ...
- 7
- 177
- 0
A study on the mutual coupling effects between 2 rectangular patch antennas as a function of their separation and angles of elevation
Ngày tải lên :
26/09/2015, 10:43
... Disadvantages of Microstrip Antennas It is actually the last advantage in the list above that makes microstrip antennas so popular today Many characteristics of a single microstrip patch antenna ... every façade of antenna communications From the battle field to commercial enterprises, the microstrip antenna is fast replacing many conventional antennas The advantages and disadvantages of the ... is an important part of studying the antenna via the cavity model The total quality factor of the antenna, Q may be expressed in terms of the Q-factors associated with the radiation into space...
- 104
- 329
- 0
Tài liệu Using a Web Service as a Data Source pdf
Ngày tải lên :
21/01/2014, 11:20
... "Order_OrderDetails_Relation"; // [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT ... between implementing the LoadOrders( )methods to retrieve a DataSet containing the Orders and Order Details data from Northwind as a local class or as a web services class [ Team LiB ] ... Fill the OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM [Order Details]", ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderDetailTable...
- 4
- 369
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
Ngày tải lên :
07/03/2014, 10:20
... peptide was identified as a major component of the amyloid plaques in AD brain [ 42, 43], global AD research focused on this peptide as a causative agent in the disease The 39–43 amino acid cleavage ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... forms amyloid plaques As amyloid plaques are prominent in the postmortem AD brain, early research theories placed the accumulation of extracellular, insoluble forms of Ab as central to the disease...
- 9
- 634
- 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
Ngày tải lên :
23/03/2014, 13:20
... methylglyoxal trypanothione hemithioacetal (Table 1) For FEBS Journal 27 2 (20 05) 23 8 823 98 ê 20 05 FEBS M Sousa Silva et al The glyoxalase pathway in Leishmania infantum Table Glyoxalase I kinetic parameters ... Database and can be accessed at http://jjj.biochem.sun ac.za/database/silva/index.html free of charge Results and Discussion The potential of the glyoxalase system as a possible therapeutic target ... concentration 23 89 The glyoxalase pathway in Leishmania infantum M Sousa Silva et al A B Fig The glyoxalase pathway in Leishmania infantum Reactions and correspond to the nonenzymatic (n.e.) formation...
- 11
- 515
- 0
Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf
Ngày tải lên :
24/03/2014, 00:21
... of pyruvate kinase, and 2. 5 lgámL)1 LDH in a total volume of mL The reaction was initiated by an addition of 50 ng of Na+/K+-ATPase Na+-dependent ATPase activity was also measured using the coupled ... Na+/K+-ATPase, K+-activated phosphatase, and Na+-dependent ATPase at 0.1 MPa were 124 0, 110, and 29 lmoláh)1ámg)1, respectively Na+/K+-ATPase activity was determined h later after the pressurization at ... decreased for pressures of 22 0 MPa or higher (Fig 3D) The FITC ¯uorescence of K+-activated phosphatase and Na+-dependent ATPase at 100 22 0 MPa is different but decreased in parallel at 22 0 MPa or...
- 9
- 432
- 0
Community-Based Social Marketing as a Planning Tool - Community and Regional Planning Masters Project pptx
Ngày tải lên :
29/03/2014, 23:20
... 18.4% Strangers Other Page 32 5.3% 7.9% September /20 02 Community-Based Social Marketing as a Planning Tool Community-Based Social Marketing as a Planning Tool September /20 02 Page 33 Chapter Case Studies ... the community-based social marketing model provides a program manager tools to address either factor Page 42 September /20 02 Community-Based Social Marketing as a Planning Tool 7 .2- Substantiated ... Community-Based Social Marketing as a Planning Tool September /20 02 Page 21 Chapter The EcoTeam Program and Survey Analysis This chapter provides an in-depth description and analysis of a program that...
- 70
- 425
- 0
Báo cáo khoa học: Homologous expression of a bacterial phytochrome The cyanobacterium Fremyella diplosiphon incorporates biliverdin as a genuine, functional chromophore doc
Ngày tải lên :
30/03/2014, 08:20
... Weerasuriya S & Navankasattusas S (1993) FEBS Journal 27 4 (20 07) 20 88 20 98 ª 20 07 The Authors Journal compilation ª 20 07 FEBS 20 97 Homologously expressed bacteriophytochrome 22 23 24 25 26 27 28 ... AACCAATTCAC-3¢, and CphBm C24S-antisense 5¢-GTGAA TTGGTTCGCGATCTGAATTCGTCAAGTCCACCTC-3¢ The primers used for H26 7A were: oBQ144 -2, 5¢-CACT CGGTACTCCGCAGCGTTTCGCCGTTARCCATTGAA TATTTGCACAATATGG-3¢ (R ... site of the vector pPL2.8 using the following primers: oBQ88, 5¢-CGGGA TCCTGCACGGTGCACCAATGCTTC-3¢; and oBQ89, 5¢-ACGGATCCAAAAAACCCCTCAAGACCCG-3¢ pPL2.8 is a derivative of pPL2.7 [22 ], generated...
- 11
- 440
- 0
báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot
Ngày tải lên :
18/06/2014, 19:20
... 46:1417-14 32 24 Ruiz MA, Rejas J: Calidad de vida y otras medidas de salud informadas por el paciente En A Farmacoeconom a e investigación de resultados en salud: principios y práctica Real Academia Nacional ... (HAM -A) , the Hospital Anxiety and Depression Scale (HADS, anxiety domain), and the WHO-DAS II disability questionnaire was calculated Concordance between classification criteria was assessed ... later, the GAD-7 scale was again administered to a patient subsample; the retest information was used to study the stability of questionnaire measurements over time The latter was ensured by administering...
- 11
- 537
- 0
báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot
Ngày tải lên :
20/06/2014, 15:20
... Ethnicity/Race Asian/Pacific Islander (1 ,25 5) African-American (5, 826 ) Hispanic (3, 129 ) White (19,751) Native American (23 4) Other (9 12) Marital Status Married (2, 931) Not Married (28 ,177) Fair Good ... smoking status and discharge from the military Smoking status at the one-year follow up was assessed using a 7-day point prevalence analysis [16] Discharge was assessed both after BMT and after technical ... White and Asian/Pacific Islander participants reported the poorest health and Hispanic and African Americans the highest, the opposite has been true in previous studies It is possible that this...
- 9
- 301
- 0
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
Ngày tải lên :
21/06/2014, 05:20
... in the IPM plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small ... weaver ants as a major component of the cashew IPM program At the end of the training, to examine the TOT trainee’s knowledge in cashew IPM and to get their feedback for each course and the practicals ... Binh Thuan (21 -22 /7 /20 08) Baseline survey Farmers’ opinion towards the cashew IPM program using weaver ants as a major component The baseline survey was conducted by TOT trainees in their own...
- 10
- 551
- 1
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2