1  spidering a website with webscarab

... control panels Assigning a User to the Database Every database must have a user assigned to it or authorized to use it After you create a database, you must associate a user with a username and password ... PHP 5.2.x and MySQL 5.0.4 Username and Password for Database After you have created the database, you must assign a username and password (U/P) that are unique to that database Joomla! needs this ... Installing Joomla! 1.6 requires a series of steps on a Webserver Ǡ A MySQL database with a username, password, and database name is required Ǡ The database is created via the Website control panel...

Ngày tải lên: 29/05/2014, 23:54

... no additional adverse events compared with placebo The most frequently reported adverse effects during acyclovir therapy are headache, nausea and abdominal cramping Whilst oral acyclovir has a ... Khan and Sarah Logan declare that they have no competing interests Dr Paresh Jobanputra has been involved in commercially sponsored trials of adalimumab and etanercept in rheumatic diseases He has ... virus following latency in the sensory ganglia can happen years later and manifest usually as cold sores Characteristically painful vesicles develop in a localised area such as the lip which...

Ngày tải lên: 11/08/2014, 21:22

... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... potential coadjuvants of those antimicrobial agents that are already available after incubation for 18–20 h at 37 °C Antibacterial activity was expressed as MIC, the concentration of peptide at which ... Sigma All other chemicals were reagent grade For antimicrobial assays, the commercially available quality control strain E coli ATCC 25922 was used The bactericidal activity of Esc(1–18) against...

Ngày tải lên: 16/03/2014, 00:20

... of CA-p2 interacted with PR (Fig 5A) Compared with p2-NC, the CA-p2 analog lacked an acetyl group at P4 and cannot form the same van der Waals interactions with PR However, the CA-p2 analog with ... complexes with substrate analogs Phe-Glu-Ala-Nle-amide, L6525; Sigma-Aldrich), which is an analog of the CA-p2 cleavage site The assay solution contained 50 mm sodium acetate, pH 5.0, 0.1 m NaCl and ... Georgia Cancer Coalition Distinguished Cancer Scholar award (I.T.W and R.W.H.), and the Georgia Research Alliance We thank the staff at the SER-CAT beamline at the Advanced Photon Source, Argonne...

Ngày tải lên: 30/03/2014, 20:20

... Takeo S, Harada T, Okazawa T, Yanai H, Okita K: Matrix metalloproteinase-7 and matrix metalloproteinase-9 are associated with unfavourable prognosis in superficial oesophageal cancer Br J Cancer ... Barrett metaplasia; GERD, Gastro-Esophageal Reflux Disease; EAC, esophageal adenocarcinomas; ESCC, esophageal squamous-cell carcinomas; †significance is related to GERD; ††significance is related ... alteration in esophageal carcinoma J Gastroenterol Hepatol 2007, 22(12):2303-2309 35 Okazaki I, Wada N, Nakano M, Saito A, Takasaki K, Doi M, Kameyama K, Otani Y, Kubochi K, Niioka M, et al: Difference...

Ngày tải lên: 18/06/2014, 16:20

... 5'-AGGGCGGGGGCATCGGGCACCGGGATGGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated ... (5'gatttcgcgcaggtgatgag-3') for UL8; and 18S rRNA-f (5'-actcaacacgggaaacctca-3') and 18S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18S rRNA Reactions were performed using SYBER Premix Ex Taq II (Takara) with ... Real-time PCR amplifications were performed with primers UL6-f (5'-aaattctgtgtcaccgcaacaac-3') and UL6-r (5'-gcccgaagcactgactcaa-3') for UL6; UL8-f (5'-cttgctggacgcagagcacta-3') and UL8-r (5'gatttcgcgcaggtgatgag-3')...

Ngày tải lên: 20/06/2014, 01:20

... is called the The nonlinear elliptic partial differential equation d A x, du homogeneous A- harmonic equation or the A- harmonic equation, and the differential equation d A x, du B x, du 1.7 is called ... conjugate A- harmonic tensors,” Journal of Mathematical Analysis and Applications, vol 203, no 1, pp 278–288, 1996 S Ding, “Estimates of weighted integrals for differential forms,” Journal of Mathematical ... maximal operators and ı fractional integrals on non-homogeneous spaces,” Indiana University Mathematics Journal, vol 50, no 3, pp 1241–1280, 2001 T Iwaniec and A Lutoborski, “Integral estimates...

Ngày tải lên: 21/06/2014, 17:20

... PowerPAD to the largest area available Additional areas on the top or bottom layers also help dissipate heat Use any area available when 1.5 -A or greater operation is desired Connect the exposed area ... 10.7 kΩ instead of 10.0 kΩ R2 is then 3.92 kΩ Since capacitors are only available in a limited range of standard values, the nearest standard value was chosen for each capacitor The measured closed-loop ... This Area for Optimum Performance LAYOUT CONSIDERATIONS FOR THERMAL PERFORMANCE For operation at full rated load current, the analog ground plane must provide adequate heat dissipation area A 3-inch-by-3-inch...

Ngày tải lên: 24/07/2014, 04:20

... Novotny EA, Garrett-Beal L, Ward JM, Libutti SK, Richard Alexander H, Cerrato A, Parisi MJ, Santa Anna-AS, Oliver B, Chandrasekharappa SC, Collins FS, Spiegel AM, Marx SJ: Molecular pathology ... 89:143-150 11 Carrasco CA, González AA, Carvajal CA, Campusano C, Oestreicher E, Arteaga E, Wohllk N, Fardella CE: Novel intronic mutation of MEN1 gene causing familial isolated primary hyperparathyroidism ... A, Gallart L, Martín-Campos JM, Catasús L, Mayoral C, Mato E, Tortosa F, Bernà L, Rodríguez-Espinosa J, Blanco-Vaca F, Matías-Guiu X, de Leiva A, Mauricio D: Genetic, clinical, and biochemical...

Ngày tải lên: 09/08/2014, 01:24

... Takagane A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, Toh Y, Nagaie T, Takagi S, Yamamura Y, Yanaoka K, Orita H, Takeuchi M: S-1 plus cisplatin versus S-1 alone for ... for patients with advanced gastric cancer Cancer Chemother Pharmacol 2009, 64:877-883 Yoshida K, Hirabayashi N, Takiyama W, Ninomiya M, Takakura N, Sakamoto J, Nishiyama M, Toge T: Phase I study ... combination therapy with S-1 and docetaxel (TXT) for advanced or recurrent gastric cancer Anticancer Res 2004, 24:1843-1851 Yoshida K, Ninomiya M, Takakura N, Hirabayashi N, Takiyama W, Sato Y,...

Ngày tải lên: 09/08/2014, 03:21

... years after the diagnosis of PDB, bone pain in the right pelvis increased markedly and a Available online http://arthritis-research.com/content/7/6/R1289 Table Available clinical and mutational ... by an autoanalyzer, has been performed also in all the individuals undergoing mutational analysis The upper limit of the reference range is 120 units/l DNA extraction, PCR and mutational analysis ... participated in the sequence alignment LM performed the statistical analysis AT supervised the performance statistical analysis AA helped in the clinical activity AC participated in the sequence alignment...

Ngày tải lên: 09/08/2014, 07:20

... was no lid lag or proptosis His thyroid gland was not enlarged and was non-tender There was no cervical lymphadenopathy or appendicular tremor The remainder of his physical examination was within ... is desirable, as the treatment of these entities differs Graves’ disease, goiters and adenomas are treated with thionamide medications (such as methimazole or propylthiouracil), radioactive iodine ... hypothyroidism appears to increase insulin resistance independently of weight gain [9,10] and has been associated with an increased risk of symptomatic hypoglycemia [11] Protracted hypoglycemia can lead...

Ngày tải lên: 10/08/2014, 23:21

... sputum Gram stain showed no bacteria, but the polymerase chain reaction assay was positive for Legionella pneumophila in more Page of Table Laboratory results on admission Laboratory tests Values ... the pathogenesis of the disease The elevation of antinuclear antibodies, antineutrophilic and anticytoplasmic antibodies and antinative DNA was not significant Light chains, which are in the family ... abdomen was soft and non-tender without any pathological findings Her neurological examination showed no sensory or motor deficiency An arterial blood gas analysis showed a pH of 7.45, partial...

Ngày tải lên: 10/08/2014, 23:21

... lateral malleolus She had six cafb-aulait patches on her trunk and bilateral axillary freckling A radiograph of the pelvis revealed a superior dislocation of her left hip with an abnormal appearing ... that can have both focal and generalized skeletal manifestations Generalized skeletal manifestations such as osteoporosis and short stature are common Focal abnormalities such as tibial dysplasia, ... move in bed A radiograph of her hip revealed repeat dislocation Relocation of her hip was performed under general anaesthetic and balanced skeletal traction was maintained by inserting a pin to...

Ngày tải lên: 11/08/2014, 00:23

... her family medical history, her mother had died at 68 years of age as a result of heart disease, and her father was alive at 72 years of age with Page of a history of cancer An older sister has ... implantable, programmable, rechargeable generator was permanently implanted in a subcutaneous pocket area in the left buttock For the implantation, a local anesthetic (0.25% bupivacaine with ... a total of 20 ml) was used for skin and tissue infiltration Figure An ultrasound image obtained with a linear transducer placed over the greater occipital protuberance The anatomical layers are...

Ngày tải lên: 11/08/2014, 00:23

... present a case of forearm liposarcoma in a patient with NF1 Case presentation A 41-year-old Caucasian man, known to have generalized NF1 since the age of 21, presented at our clinic complaining of a ... to adjuvant radiation [12] In our case, there were axillary metastases, but the decision not to amputate was taken intra-operatively after assuring that an R0 resection was possible The treatment ... stay in hospital, the patient was discharged The movement in the operated forearm was free, without limitation Ambulant, adjuvant radiotherapy commenced weeks later The total dose of radiotherapy...

Ngày tải lên: 11/08/2014, 17:21

... Situs at laparotomy before and after resection (A) Intra-operative ultrasound at laparotomy (B) Situs at laparotomy (asterisk indicates the tumor; S, stomach; P, pylorus; PH, pancreatic head; D, ... a tumor in the pancreatic tail with a diameter of 25 mm without any radiological signs of malignancy Endoscopic ultrasound (EUS) visualized two small lesions in the pancreatic tail (Figure 1A) ... imaging procedures This patient was scheduled for a laparoscopic distal pancreatic resection after laparoscopic ultrasound (LUS) to rule out additional tumors in the pancreatic head and body At...

Ngày tải lên: 11/08/2014, 19:21

... sequential therapy with pegasys and entecavir(Baraclude) Pegasys was administered at a dose of 180 ug intracutaneously one time per week Baraclude was administered at a dose of 0.5 mg orally one ... months Among them, serum HBV DNA was arrayed by fluorescent quantitative PCR and HBV markers were arrayed by ELISA Results Therapeutic efficacy Within less than year, serum HBV DNA loss, ALT normalization, ... help eradicate HBV infectious hepatocytes by dual anti-viral and immunomodulatory mode of action[10] In contrast to nucleoside analogues, pegylated interferon alpha- 2a has a higher rate of HBeAg...

Ngày tải lên: 12/08/2014, 04:21

... cells and natural killer cells in Behçet's disease J Rheumatol 1992, 19:588-592 Kaneko F, Takahashi Y, Muramatsu R, Adachi K, Miura Y, Nakane A, Minagawa T: Natural killer cell numbers and function ... asthma pathogenesis: natural killer cells in type cytokine predominance J Allergy Clin Immunol 2005, 115:841-847 Takahashi H, Amagai M, Tanikawa A, Suzuki S, Ikeda Y, Nishikawa T, Kawakami Y, Kuwana ... antiphosphorylated-Stat4 polyclonal antibodies (Zymed Laboratories, South San Francisco, CA, USA) and rabbit antiStat4 polyclonal antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA) The intensity...

Ngày tải lên: 12/08/2014, 12:20

... K, Frater J, Matthews P, Payne R, Addo M, Gatanaga H, Fujiwara M, Hachiya A, Koizumi H, et al: Adaptation of HIV-1 to human leukocyte antigen class I Nature 2009, 458:641-645 Gaschen B, Taylor ... Lyagoba, P Tabuga) Spain: Hospital Clinic-IDIBAPS Univ of Barcelona Barcelona (J M Miro, M López-Dieguez, F Agüero, JA Arnaiz, T Pumarola, M Plana, M Tuset, MC Ligero, C Gil, T Gallart, JM Gatell) ... Conradie, J Kaldor, M Schechter, P Claydon, P Kaleebu, G Ramjee, F Ssali, G Tambussi, J Weber Trial Physician Sarah Fidler Trial Statistician Abdel Babiker Data and Safety Monitoring Committee A...

Ngày tải lên: 13/08/2014, 01:21