1  promoting a domain controller

Các giải pháp ảo hóa Domain Controller – Phần 1 pptx

Các giải pháp ảo hóa Domain Controller – Phần 1 pptx

... cho vấn đề thực thi domain controller tách máy chủ khỏi miền Trong mô hình miền này, toàn Active Directory forest ảo h a, nhiên máy chủ cư trú workgroup bên miền Mô hình domain controller làm việc ... tất host ảo sử dụng System Center Data Protection Manager 2007 (DPM 2007) làm giải pháp backup Vấn đề DPM 2007 phụ thuộc vào Active Directory Điều có ngh a l a chọn để join máy chủ DPM 2007 vào ... cài System Center Virtual Machine Manager 2008 (SCVMM 2008) vào máy chủ hosting máy thử nghiệm Bạn thấy hình capture từ giao diện điều khiển SCVMM 2008 hình A Lưu ý hình mục All Hosts liệt kê máy...

Ngày tải lên: 29/03/2014, 13:20

3 251 0
Báo cáo hóa học: " Research Article A Domain-Specific Language for Multitask Systems, Applying Discrete Controller Synthesis" pdf

Báo cáo hóa học: " Research Article A Domain-Specific Language for Multitask Systems, Applying Discrete Controller Synthesis" pdf

... control automaton can be constructed Each declared application has a name, and is launched on the occurrence of a signal req name The automaton of an application named A is shown in Figure 8 (a) On ... G Delaval and E Rutten 11 s2 ∧ a3 s2 ∧ a3 ∧ a1 s1 a2 ∧ a1 s1 s2 ∧ a3 ∧ a1 a2 ∧ a1 a1 ∧ a3 s1 ¬s1 ∧ a2 a3 a3 ∧¬s1 a1 ∧ ¬s2 Err Err Err (a) Always t1 between (t2,t3) s2 s2 ∧ ¬s1 (b) Always t1 ... here, in a classical way, and which are detailed elsewhere [2] 4.1.1 Transition systems The labelled transition systems we use in this paper are Mealy automata An automaton A is a tuple A = Q,...

Ngày tải lên: 22/06/2014, 19:20

17 288 0
Các giải pháp ảo hóa Domain Controller – Phần 1 ppsx

Các giải pháp ảo hóa Domain Controller – Phần 1 ppsx

... lập domain controller lại chủ đề có nhiều tranh luận đến Chúng nghe thấy số người so sánh việc thiết lập domain controller phức tạp câu hỏi “vịt có trước hay trứng có trước” Một mặt, domain controller ... bạn mua thêm đăng ký cần thiết cho domain controller bổ sung mà bạn triển khai Kết luận Cho đến đây, giới thiệu cho bạn hai mô hình thực thi domain controller khác bên môi trường ảo h a Tuy nhiên ... máy chủ ảo h a có ngh a bạn cần máy chủ vật lý để hoạt động điều khiển miền (domain controller) Tất nhiên, có miền với domain controller đề nghị nguy hiểm, thực tế bạn chắn dành hai nhiều máy...

Ngày tải lên: 11/07/2014, 20:20

8 363 0
Giáo trình hướng dẫn thực hiện kỹ thuật mở rộng trên Domain Controller của Server phần 1 doc

Giáo trình hướng dẫn thực hiện kỹ thuật mở rộng trên Domain Controller của Server phần 1 doc

... dung logon tai server thi khong lam gi ca ff %computername%.== tvthanh goto END rem xoa cac o dia anh xa dang ton tai net use h: /delete >nul net use j: /delete >nul rem anh xa o dia h va j net use ... [/comment:"text"]] [ /domain] net group groupname {/add [/comment:"text"] | /delete} [ /domain] net group groupname username[ ] {/add | /delete} [ /domain] Ý ngh a tham số: - Không tham số: dùng để hiển ... [ /domain] net localgroup groupname {/add [/comment:"text"] | /delete} [ /domain] net localgroup groupname name [ ] {/add | /delete} [ /domain] Ý ngh a tham số: - Không tham số: dùng hiển thị tên server...

Ngày tải lên: 23/07/2014, 07:22

11 346 0
Giáo trình hướng dẫn cách sử dụng các dạng điều khiển của Domain controller phần 1 pptx

Giáo trình hướng dẫn cách sử dụng các dạng điều khiển của Domain controller phần 1 pptx

... dung logon tai server thi khong lam gi ca ff %computername%.== tvthanh goto END rem xoa cac o dia anh xa dang ton tai net use h: /delete >nul net use j: /delete >nul rem anh xa o dia h va j net use ... [/comment:"text"]] [ /domain] net group groupname {/add [/comment:"text"] | /delete} [ /domain] net group groupname username[ ] {/add | /delete} [ /domain] Ý ngh a tham số: - Không tham số: dùng để hiển ... [ /domain] net localgroup groupname {/add [/comment:"text"] | /delete} [ /domain] net localgroup groupname name [ ] {/add | /delete} [ /domain] Ý ngh a tham số: - Không tham số: dùng hiển thị tên server...

Ngày tải lên: 24/07/2014, 19:20

11 437 1
Tìm hiểu các tab thuộc tính trong Domain Controller phần 1 ppt

Tìm hiểu các tab thuộc tính trong Domain Controller phần 1 ppt

... dung logon tai server thi khong lam gi ca ff %computername%.== tvthanh goto END rem xoa cac o dia anh xa dang ton tai net use h: /delete >nul net use j: /delete >nul rem anh xa o dia h va j net use ... [/comment:"text"]] [ /domain] net group groupname {/add [/comment:"text"] | /delete} [ /domain] net group groupname username[ ] {/add | /delete} [ /domain] Ý ngh a tham số: - Không tham số: dùng để hiển ... [ /domain] net localgroup groupname {/add [/comment:"text"] | /delete} [ /domain] net localgroup groupname name [ ] {/add | /delete} [ /domain] Ý ngh a tham số: - Không tham số: dùng hiển thị tên server...

Ngày tải lên: 27/07/2014, 03:21

11 374 0
Giáo trình hướng dẫn tìm hiểu về cách sử dụng các tab thuộc tính trong Domain Controller phần 1 ppt

Giáo trình hướng dẫn tìm hiểu về cách sử dụng các tab thuộc tính trong Domain Controller phần 1 ppt

... dung logon tai server thi khong lam gi ca ff %computername%.== tvthanh goto END rem xoa cac o dia anh xa dang ton tai net use h: /delete >nul net use j: /delete >nul rem anh xa o dia h va j net use ... [/comment:"text"]] [ /domain] net group groupname {/add [/comment:"text"] | /delete} [ /domain] net group groupname username[ ] {/add | /delete} [ /domain] Ý ngh a tham số: - Không tham số: dùng để hiển ... [ /domain] net localgroup groupname {/add [/comment:"text"] | /delete} [ /domain] net localgroup groupname name [ ] {/add | /delete} [ /domain] Ý ngh a tham số: - Không tham số: dùng hiển thị tên server...

Ngày tải lên: 07/08/2014, 21:22

11 455 0
Báo cáo y học: "Antiviral activity of a-helical stapled peptides designed from the HIV-1 capsid dimerization domain" pps

Báo cáo y học: "Antiviral activity of a-helical stapled peptides designed from the HIV-1 capsid dimerization domain" pps

... linear analog of NYAD201 (NYAD-209) and a mutant analog of NYAD-201 (NYAD-233) after mutating two key dimer-interface residues, W18 4A and M18 5A CD analysis confirmed that NYAD-201 and the mutant ... microscopy, isothermal titration calorimetry and sedimentation equilibrium analyses and analyzed data; FC carried out the antiviral assays and analyzed data; XZ helped in preparing and purifying proteins; ... 18 and subjected to SDS-PAGE Quantification was performed by Phosphorimager analysis, and virus release efficiency was calculated as the amount of virion-associated Gag as a fraction of total...

Ngày tải lên: 13/08/2014, 01:20

18 232 0
Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps

Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps

... TGTTAACGCGGCCAATGCCAATGCCACAGC3’, LL814AARP - 5’GGCATTGGCCGCGT TAACAGCACTATTC3’, LL855AAFP - 5’GGGCTTGGAAAGGATTGCGGCATAAGATGGG3’, LL855ARP - 5’CCCATCTTATGCCGCAATCCTTTCCAAGCCC3’ All Env CD mutants were ... 5’CCCCCTGCGTCCCAGAAGTTCCACA-ATCCTCG3’, Y795S/LL799HQ/Y802SFP - 5’GGAAGCCCTCAAACTTGGTGGAATCACCAACAGTCTTGGAGTCAGG3’, Y795S/LL799HQ/Y802SRP - 5’CCTGACTCCAAGACTGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’, LL814AAFP - 5’GC TGTTAACGCGGCCAATGCCAATGCCACAGC3’, ... 5’GCTCCCACCGCTCGAAAGACTCACACTCGAATGTAACGAGG3’, L771/LLLI774SHSSRP - 5’CCTCGTTACATTCGAGTGTGAGTCTTTCGAGCGGTGGGAGC3’, LL784HQFP - 5’CGAGGATTGTGGAACTTCTGGGACGCAGGGGG3’, LL784HQRP - 5’CCCCCTGCGTCCCAGAAGTTCCACA-ATCCTCG3’,...

Ngày tải lên: 13/08/2014, 01:20

17 362 0
Chạy Windows Server 2008 R2 – Cài đặt và tạo Lab Domain Controller (Phần 1) pdf

Chạy Windows Server 2008 R2 – Cài đặt và tạo Lab Domain Controller (Phần 1) pdf

... Enterprise (Full Installation) kích Next Hình Tích vào hộp chọn I accept the license terms trang th a thuận đăng ký kích Next Hình Với câu hỏi Which type of installation you want? bạn chọn tùy ... Tuy nhiên để cài đặt sáng s a, dễ hiểu, kích tùy chọn Custom (advanced) Lưu ý tùy chọn “Next” trang này, nhiên bạn nhanh chóng chuyển sang trang thực xong hành động l a chọn Hình Ở bạn phải định ... thống Trong ví dụ, tạo file đ a ảo động 24 GB cho hệ điều hành Các bạn cần nhớ rằng, file đ a động sử dụng không gian mà chúng cần – không định phần tất không gian cần đến Kích Next ...

Ngày tải lên: 14/08/2014, 10:21

6 418 1
Giáo trình window: Hướng dẫn kĩ thuật mở rộng dung lượng chứa cho phép trong Domain Controller phần 1 potx

Giáo trình window: Hướng dẫn kĩ thuật mở rộng dung lượng chứa cho phép trong Domain Controller phần 1 potx

... dung logon tai server thi khong lam gi ca ff %computername%.== tvthanh goto END rem xoa cac o dia anh xa dang ton tai net use h: /delete >nul net use j: /delete >nul rem anh xa o dia h va j net use ... [/comment:"text"]] [ /domain] net group groupname {/add [/comment:"text"] | /delete} [ /domain] net group groupname username[ ] {/add | /delete} [ /domain] Ý ngh a tham số: - Không tham số: dùng để hiển ... [ /domain] net localgroup groupname {/add [/comment:"text"] | /delete} [ /domain] net localgroup groupname name [ ] {/add | /delete} [ /domain] Ý ngh a tham số: - Không tham số: dùng hiển thị tên server...

Ngày tải lên: 14/08/2014, 21:22

11 292 2
Làm việc với read only domain controller phần 1

Làm việc với read only domain controller phần 1

... domain controller, hai sử dụng ngày Active Directory multi master domain (mô hình a miền chủ) Dù có vai trò PDC số vai trò đặc biệt khác, hầu hết domain controller mô hình multi master domain ... Read Only Domain Controller RODC điều khiển miền (domain controller) mà quản trị viên cập nhật trực tiếp sở liệu Active Directory Chỉ có cách để nâng cấp domain controller sử dụng thay đổi domain ... liên kết WAN hữu Kết luận Như bạn thấy, Read Only Domain Controller có vai trò quan trọng Trong phần loạt này, giới thiệu cho bạn việc lập kế hoạch triển khai cho Read Only Domain Controller...

Ngày tải lên: 04/12/2015, 20:29

4 364 0
Xây dựng Domain Controller tích hợp DNS server

Xây dựng Domain Controller tích hợp DNS server

... 0913735906 Fax: 9322734 Website: www.nhatnghe.com Ch giây lát h th ng th c hi n b p tho i Welcome to the Active Directory Domain Services Installation Wizard: ánh d u ch n “Use advanced mode installation” ... Services hoàn t t B4 B sung d li u DNS service: Log on user Administrator Start > Programs > Administrative Tools > Server Manager a s Server Manager: Ch n Roles> Ch giây lát h th ng c p nh t thông ... www.nhatnghe.com p tho i Dynamic Update: gi nguyên l a ch n “Allow only secure dynamic update…” > Next p tho i Completing…: Finish Start > Run p tho i Run: Nh p l nh cmd > OK a s Administrator...

Ngày tải lên: 13/08/2012, 16:40

15 1.3K 8
Hướng dẫn cài đặt domain controller và cấu hình DNS Window2000 Server

Hướng dẫn cài đặt domain controller và cấu hình DNS Window2000 Server

... cần thiết muốn cho phép clients giải FQDNs (Full Qualify Domain Name) từ đ a IP Nó tốt cài mail server Phần III: Hướng dẫn cài đặt Domain Controller DNS hệ điều hành Windows 2000 Server ... server khác mạng LAN bạn A host record tạo forward lookup zones, bạn tạo A host record có ngh a bạn map host name IP cài đặt server Thí dụ: Bạn có web server nằm đ a 192.168.2.10 A host record bạn ... hình Pointer Record Nguyên lý làm việc map đ a IP host name, ngược lại với phần forward lookup zones map host name IP Thí dụ: Forward Lookup Zones: ns1.vanesoft.com chuyển đổi thành IP 192.168.2.10...

Ngày tải lên: 31/08/2012, 09:33

30 1.2K 11
Cài đặt và quản trị WINDOWS 2000 Domain controller

Cài đặt và quản trị WINDOWS 2000 Domain controller

... controller • Danh sách Available controller In liệt kê máy điều khiển khả dụng vùng Xác định mặc định Any Writable Domain controller QTSC – CISCO Network Acadamy Hall 7, Quang Trung Software City ... Acadamy Hall 7, Quang Trung Software City MS 2K-NT: Quản trị hệ điều hành Windows 2000-NT page 41 Sử dụng Preconfigured MMC C a sổ Computer Management QTSC – CISCO Network Acadamy Hall 7, Quang ... 2000-NT page 43 Tạo Custom MMC (tt) Trên thực đơn Console chọn mục Add/Remove Snap-in Bấm chọn nút Add trang Standalone c a sổ Add/Remove Snap-in để mở c a sổ hình QTSC – CISCO Network Acadamy Hall...

Ngày tải lên: 17/09/2012, 10:04

120 698 3
Báo cáo y học: "Hb J- Meerut [α 120 (H3) Ala -Glu (α1)] In A Turkish Male"

Báo cáo y học: "Hb J- Meerut [α 120 (H3) Ala -Glu (α1)] In A Turkish Male"

... Yunoki H, Yagi H, Nagashima K, Kuroume T Hb J-Meerut [α120 (H3) Ala ->Glu] found in a Japanese family Hemoglobin 1989; 13(2): 169-175 Yalçin A, Avci F, Beyhan C, Gürgey A, Ural AU A case of Hb ... Meerut : α120 Ala ->Glu Biochim Biophys Acta 1974; 351: 7-12 Kamuzora H, Lehmann H, Griffiths KD, Mann JR, Raine DN A new hemoglobin variant hemoglobin J Birmingham α120 (H3) Ala ->Glu Ann clin biochem ... 53-55 Molchanova TP, Pobedimskaya DD, Huisman THJ The differencs in quantities of α2- and α1-globin gene variants in heterozygotes Br J Haematol.1994; 88: 300-306 Harano T, Harano K, Imai K, Yunoki...

Ngày tải lên: 02/11/2012, 10:09

2 503 0
Chương 1-active directory domain

Chương 1-active directory domain

... Install Wizard nhấp chọn vào Domain Controller for a new domain nhấp Next  L a chọn tạo Domain, Domain, rừng Domain Server Domain Domain B4 Nhấp chọn Domain in a new forest sau nhấp Next L a chọn ... Chương 1: Active Directory Domain Replication Domain Controller Domain Controller Domain Mô hình Domain Controller II CÁC THÀNH PHẦN C A ACTIVE DIRECTORY – DOMAIN, TREE, FOREST DOMAIN  Người ... 1: Active Directory Domain Tree Forest (Root ) Two-Way, Transitive Trust contoso.msft Tree Asa.contoso.m sft Nwtradera.msft au.contoso.ms ft Two-Way, Transitive Trust Tree Asa.nwtradera msft au.nwtradera...

Ngày tải lên: 31/01/2013, 16:09

24 607 8
Domain Controller Security Policy - Domain Security Policyx

Domain Controller Security Policy - Domain Security Policyx

... Tên l a chọn Mô tả Interactive logon: not display last user name Không hiển thị tên người dùng logon hộp thoại Logon Account: rename administrator account Cho phép đổi tên tài khoản Administrator ... nối mạng Audit Account Management Hệ thống ghi nhận tài khoản người dùng nhóm có thay đổi thông tin hay thao tác quản trị liên quan đến tài khoản người dùng Audit Directory Service Access Ghi ... cao chế độ bảo mật tuỳ chỉnh Windows ta sử dụng công cụ Group Policy chúng nâng cấp Windows lên DC ta có công cụ :  Domain Controller Sercurity Policy  Domain Sercurity Policy Phân biệt  Domain...

Ngày tải lên: 31/03/2013, 19:38

27 3.5K 84
w