1  preventing duplicates from occurring in a table

Tài liệu Find Records in a Table Without Corresponding Entries in a Related Table pptx

Tài liệu Find Records in a Table Without Corresponding Entries in a Related Table pptx

... Store the SQL String Me.lblSQLString.Text = strSQL ' Use the SQL String to build the data adapter and fill the data table Dim odaResults As New OleDb.OleDbDataAdapter(Me.lblSQLString.Text, _ BuildCnnStr("(local)", ... BuildCnnStr("(local)", "Northwind")) Dim dtResults As New DataTable() Try odaResults.Fill(dtResults) Catch excp As Exception MessageBox.Show(excp.Message) Exit Sub End Try ' Assign the data table to the data ... is to find bad data, such as non-relational data that could result from importing data from other systems Use a SELECT statement similar to the one used for the left outer join type: SELECT Customers.CustomerID,...

Ngày tải lên: 21/01/2014, 12:20

5 274 0
Báo cáo Y học: The mechanism of nitrogen monoxide (NO)-mediated iron mobilization from cells NO intercepts iron before incorporation into ferritin and indirectly mobilizes iron from ferritin in a glutathione-dependent manner pot

Báo cáo Y học: The mechanism of nitrogen monoxide (NO)-mediated iron mobilization from cells NO intercepts iron before incorporation into ferritin and indirectly mobilizes iron from ferritin in a glutathione-dependent manner pot

... ferritin and Sper were obtained from Sigma SperNO was obtained from Cayman Chemicals Eagle’s minimum essential medium (MEM) was obtained from Gibco BRL DFO was obtained from Novartis Pharmaceutical ... using a c-scintillation counter (LKB Wallace 1282 Compugamma, Finland) Determination of intracellular iron distribution using native-PAGE-59Fe-autoradiography Native-PAGE-59Fe-autoradiography was ... work was supported by an Australian Research Council Large Grant and Grants 970360 and 981826 from the National Health and Medical Research Council of Australia REFERENCES Moncada, S., Palmer,...

Ngày tải lên: 08/03/2014, 22:20

10 503 0
báo cáo khoa học: "A massive abdominal wall desmoid tumor occurring in a laparotomy scar: A case report" potx

báo cáo khoa học: "A massive abdominal wall desmoid tumor occurring in a laparotomy scar: A case report" potx

... tumors are rare in clinical practice and their management remains quite challenging due to their variable clinical behavior Wide excision with tumor free margins may be adequate in the management ... which was reported as desmoid tumor after incisional biopsy was done An abdominal CT scan showed hepatomegaly and a mass measuring 16 cm × 15 cm × 4.6 cm confined to the anterior abdominal wall ... disease or similar condition in any of the close relatives On examination, his general condition was fair and he had a huge ulcerated anterior abdominal wall mass with everted edges measuring...

Ngày tải lên: 09/08/2014, 01:24

4 201 0
Báo cáo y học: "Severe synergistic toxicity from docetaxel in a patient treated concurrently with protease inhibitors as part of HIV post-exposure prophylaxis: a case report" doc

Báo cáo y học: "Severe synergistic toxicity from docetaxel in a patient treated concurrently with protease inhibitors as part of HIV post-exposure prophylaxis: a case report" doc

... widespread ulceration in the esophagus and gastric antrum that was biopsied Meanwhile, a galactomannan antigen assay for Aspergillus and fungal cultures from her biopsies were negative Figure Appearance ... 64:7426-7431 Parameswaran RSC, Einhorn LH: Interaction between highly active antiretroviral therapy, (HAART) and taxanes: a report of two cases 38th Annual Meeting of the American Society of Clinical Oncology ... 2002 Abstract 2194 Bundow D, Aboulafia DM: Potential drug interaction with paclitaxel and highly active antiretroviral therapy in two patients with AIDS-associated Kaposi sarcoma Am J Clin Oncol...

Ngày tải lên: 11/08/2014, 14:20

5 296 0
Báo cáo y học: " Mucocele-like tumor and columnar cell hyperplasia of the breast occurring in a morphologic continuum" pptx

Báo cáo y học: " Mucocele-like tumor and columnar cell hyperplasia of the breast occurring in a morphologic continuum" pptx

... proliferations, including intraductal carcinoma, invasive carcinoma, atypical ductal hyperplasia and hyperplasia of the usual type [2-4] Most invasive carcinomas that arise in this setting are of ... observations suggest an association, perhaps in a nonobligate precursor role, between flat epithelial atypia and lobular neoplasia, tubular carcinoma and low-grade intraductal carcinoma [5-7] ... Ayala AG: Mucocelelike tumor of the breast associated with atypical ductal hyperplasia or mucinous carcinoma A clinicopathologic study of seven cases Arch Pathol Lab Med 1991, 115:137-140 Weaver...

Ngày tải lên: 11/08/2014, 23:21

4 249 0
Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps

Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps

... 5’CCTGACTCCAAGACTGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’, LL814AAFP - 5’GC TGTTAACGCGGCCAATGCCAATGCCACAGC3’, LL814AARP - 5’GGCATTGGCCGCGT TAACAGCACTATTC3’, LL855AAFP - 5’GGGCTTGGAAAGGATTGCGGCATAAGATGGG3’, LL855ARP - 5’CCCATCTTATGCCGCAATCCTTTCCAAGCCC3’ ... 5’GCGGTGGGAGCTGAAGTGGCACAGGC3’, L771/LLLI774SHSSFP - 5’GCTCCCACCGCTCGAAAGACTCACACTCGAATGTAACGAGG3’, L771/LLLI774SHSSRP - 5’CCTCGTTACATTCGAGTGTGAGTCTTTCGAGCGGTGGGAGC3’, LL784HQFP - 5’CGAGGATTGTGGAACTTCTGGGACGCAGGGGG3’, ... 5’CGAGGATTGTGGAACTTCTGGGACGCAGGGGG3’, LL784HQRP - 5’CCCCCTGCGTCCCAGAAGTTCCACA-ATCCTCG3’, Y795S/LL799HQ/Y802SFP - 5’GGAAGCCCTCAAACTTGGTGGAATCACCAACAGTCTTGGAGTCAGG3’, Y795S/LL799HQ/Y802SRP - 5’CCTGACTCCAAGACTGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’,...

Ngày tải lên: 13/08/2014, 01:20

17 362 0
Báo cáo y học: "Dynamic features of the selective pressure on the human immunodeficiency virus type 1 (HIV-1) gp120 CD4-binding site in a group of long term non progressor (LTNP) subjects" pptx

Báo cáo y học: "Dynamic features of the selective pressure on the human immunodeficiency virus type 1 (HIV-1) gp120 CD4-binding site in a group of long term non progressor (LTNP) subjects" pptx

... to act on patients E, F and G In particular, a conformational epitope appeared to be present in patient E and G and formed by Thr278, Asp279 and Ala 281 In patient F, a complex and large area ... The average viral mutation rate among all patients was estimated to be around 2.34E-02 mutations/site/year In patients A, B (normal progressors; NP), the average mutation rate (μ) was significantly ... domain, and sera from these patients show broad cross-neutralizing responses against primary HIV-1 isolates, mainly due to antibodies against this epitope [19-22] In the past few years, a growing...

Ngày tải lên: 13/08/2014, 05:21

15 525 0
Verb tenses in a table with examples

Verb tenses in a table with examples

... englisch-hilfen.de – LEARNING ENGLISH ONLINE while I was working I wasn't working Was I working? He was working He wasn't working Was he working? I was going I wasn't going Was I going? He was going Past Progressive ... gone? I have been working an action happened in the middle of another action someone was doing sth at a certain time (in the past) - you was/were + infinitive + ing don't know whether it was finished ... since for action began in the past and has just stopped how long the action has been happening emphasis: length of time of an action have/has + been + infinitive + ing englisch-hilfen.de – LEARNING...

Ngày tải lên: 07/08/2015, 15:32

5 412 0
Study on the fate of metal elements from biomass in a benchscale fluidized bed gasifier

Study on the fate of metal elements from biomass in a benchscale fluidized bed gasifier

... Furusawa T, Kuchonthara P, et al Release behavior of tar and alkali and alkaline earth metals during biomass steam gasification Energy Fuels 2008;22(6):4235–9 [17] Sasaoka E, Hirano S, Kasaoka S, ... syngas, and filter char were included in the mass balance calculations Metal elements are assumed to distribute from input streams into output streams by leaving in the gas phase or binding/retaining ... Experiences from peat and coal gasification and hot gas filtration; Valtion Teknillinen Tutkimuskeskus, Espoo, Finland; 1995 p 74 [48] Iwashita A, Nakajima T, Takanashi H, Ohki A, Fujita Y, Yamashita T...

Ngày tải lên: 29/07/2016, 14:03

12 409 0
Tài liệu Creating a Table in the Database from a DataTable Schema docx

Tài liệu Creating a Table in the Database from a DataTable Schema docx

... ConfigurationSettings.AppSettings["Sql_ConnectString"]); MessageBox.Show( "Table " + TABLENAME + " created.", "Create DataTable from schema.", MessageBoxButtons.OK, MessageBoxIcon.Information); } private void CreateTableFromSchema(DataTable ... constructs a Data Definition Language (DDL) statement to create a table in a SQL Server database from the schema of a DataTable The complete statement that is generated is shown in Example 10-16 Example ... command If you have a number of tables in a DataSet that you want to create in a database, you can iterate through the collection of DataRelation objects for the DataSet and use the ALTER TABLE...

Ngày tải lên: 21/01/2014, 11:20

6 493 0
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

... sedimenting nuclear fraction containing the cellular DNA and proteins associated with replicating chromatin We take this material as a functional equivalent to SV40 minichromosomes elutable from the nuclei ... were washed three times for with NaCl/Pi During the last wash total DNA was stained with bisbenzimide (2 lgÆmL)1 in NaCl/Pi) Finally PCNA (Alexa FluorÒ 568 stain), replicating DNA (FITC stain) and ... Interrupting the continuity of the DNA (e.g by suitable endonucleases) yields elutable chromatin fragments preferably originating from regions far from matrix attachment points As DNA replication...

Ngày tải lên: 21/02/2014, 00:20

11 610 0
Báo cáo khoa học: Disruption of transport activity in a D93H mutant thiamine transporter 1, from a Rogers Syndrome family pdf

Báo cáo khoa học: Disruption of transport activity in a D93H mutant thiamine transporter 1, from a Rogers Syndrome family pdf

... (Stratagene Inc.) Primers used for mutagenesis of THTR1 (D93H) were: Upstream oligo: 5¢-CCTGTGTTCCTTGCCACACACTACCTCCGTTA TAAACC-3¢ and downstream oligo: 5¢-GGTTTATAACG GAGGTAGTGTGTGGCAAGGAACACAGG-3¢ ... suggesting that this domain plays an important functional role in substrate binding and/or translocation Table Sequence comparison of various members of the solute carrier family Amino-acid alignment ... of the aspartate 93 in human THTR1 with various members of the SLC19 family The conserved aspartate 93 is indicated in bold Light shading indicates the amino acids showing conservation in all members...

Ngày tải lên: 30/03/2014, 20:20

9 480 0
Báo cáo y học: "Hyperthyroidism from autoimmune thyroiditis in a man with type 1 diabetes mellitus: a case report" pdf

Báo cáo y học: "Hyperthyroidism from autoimmune thyroiditis in a man with type 1 diabetes mellitus: a case report" pdf

... considered obtaining such a comprehensive work-up, including a radioactive iodine uptake, in this setting However, a thorough evaluation was essential in our patient, as the diagnosis of thyroiditis ... and their clinical relevance in young adults with type diabetes during the first 12 years after diabetes onset J Endocrinol Invest 2004, 27:728-732 Karavanaki K, Kakleas K, Pashali E: Screening ... the last year.” Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying Page of images A copy of the written consent is available...

Ngày tải lên: 10/08/2014, 23:21

4 307 0
Báo cáo y học: "Tetra-O-methyl nordihydroguaiaretic acid (Terameprocol) inhibits the NF-B-dependent transcription of TNF-a and MCP-1/CCL2 genes by preventing RelA from binding its cognate sites on DNA" ppsx

Báo cáo y học: "Tetra-O-methyl nordihydroguaiaretic acid (Terameprocol) inhibits the NF-B-dependent transcription of TNF-a and MCP-1/CCL2 genes by preventing RelA from binding its cognate sites on DNA" ppsx

... [antisense: 5’ ATG TCA GAT CCA CAA CGG ATA GAT 3’; sense: 5’ ACT CCC TCA AGA TTG TCA GCA AT 3’]; TNF -a [antisense: 5’ AGA AGA GGC ACT CCC CCA AAA 3’; sense: 5’ CCG AAG TTC AGT AGA CAG AAG AGC G 3’]; ... TNF -a B3 sense (5’-AACAGGGGGCTTTCC-3’) and antisense (5’AGGAGGGAAAGCCCC-3’), and mutant TNF -a B3 sense (5’-AACAGGGGGCTGAGCCTC-3’) and antisense (5’-GAGGCTCAGCCCCCTGTT-3’) Statistical Analysis All ... TNF -a: (forward:5’-TCTCAAGCTGCTCTGCCTTC-3’; reverse:5’CACCAGGATTCTGTGGCAAT-3’) RANTES/CCL5: (Forward:5’-TGGAGGGCAGTTAGAGGCAGAG-3’; reverse:5’-AGCCAGGGTAGCAGAGGAAGTG-3’) and MCP-1/CCL2:(Forward:5’-ATTCTTCCCTCTTTCCC...

Ngày tải lên: 11/08/2014, 03:20

11 622 0
Báo cáo y học: "The characterisation of mucin in a mature ovarian teratoma occurring in an eight year old patient

Báo cáo y học: "The characterisation of mucin in a mature ovarian teratoma occurring in an eight year old patient

... teratoma Amino acid Aspartic acid (D) Threonine (T) Serine (S) Glutamic acid (E) Proline (P) Glycine (G) Alanine (A) Cysteine (C) Valine (V) Isoleucine (I) Leucine (L) Tyrosine (Y) Phenylalanine ... the gastric mucin M1 antigens reacted to monoclonal antibodies obtained against mucins isolated from a human ovarian mucinous cyst These monoclonal antibodies exclusively stained the surface gastric ... secretion and whether the organ is in a normal or diseased state As far as we know this is the first time an amino acid analysis has been done of purified mucin in an ovarian teratoma The observation...

Ngày tải lên: 26/10/2012, 10:03

9 549 0
Báo cáo y học: "Hb J- Meerut [α 120 (H3) Ala -Glu (α1)] In A Turkish Male"

Báo cáo y học: "Hb J- Meerut [α 120 (H3) Ala -Glu (α1)] In A Turkish Male"

... values in arterial whole blood In Hb J Meerut of glutamic acid residue replaced by alanine residue at α120 might interact with the side chain of arginine residue at β 30 of one of the two β chains ... Haematol.1994; 88: 300-306 Harano T, Harano K, Imai K, Yunoki H, Yagi H, Nagashima K, Kuroume T Hb J-Meerut [α120 (H3) Ala ->Glu] found in a Japanese family Hemoglobin 1989; 13(2): 169-175 Yal in ... Birmingham α120 (H3) Ala ->Glu Ann clin biochem 1974;11: 53-55 Molchanova TP, Pobedimskaya DD, Huisman THJ The differencs in quantities of α2- and α1-globin gene variants in heterozygotes Br J Haematol.1994;...

Ngày tải lên: 02/11/2012, 10:09

2 503 0
 Báo cáo y học: "A folate-rich diet is as effective as folic acid from supplements in decreasing plasma homocysteine concentrations"

Báo cáo y học: "A folate-rich diet is as effective as folic acid from supplements in decreasing plasma homocysteine concentrations"

... supported by a grant from the Foundation La Marató de TV3, Barcelona, Spain and from the Foundation for the Investigation and Prevention of Cardiovascular Diseases (FIPEC), Barcelona, Spain The authors ... synthetic folic acid from breakfast cereals Participants were asked to maintain their usual eating pattern and were randomly allocated to consume one food package or to take one capsule daily for five ... exploratory analytic techniques Basal and follow-up values were measured at the beginning and at the end of each treatment phase, respectively Multivariate analysis of variance (MANOVA) was used...

Ngày tải lên: 02/11/2012, 11:12

6 418 0
 Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

... Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized ... defective (5) and insufficient (6) Y-axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying the ... questionnaire Patients Patients included Female Male AVNRT AVRT EAT From symptom to diagnosis (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications...

Ngày tải lên: 03/11/2012, 11:44

9 679 0
w