1  creating a project with storyboards

Báo cáo y học: " Disseminated cutaneous Herpes Simplex Virus-1 in a woman with rheumatoid arthritis receiving Infliximab: A case report" docx

Báo cáo y học: " Disseminated cutaneous Herpes Simplex Virus-1 in a woman with rheumatoid arthritis receiving Infliximab: A case report" docx

... no additional adverse events compared with placebo The most frequently reported adverse effects during acyclovir therapy are headache, nausea and abdominal cramping Whilst oral acyclovir has a ... Khan and Sarah Logan declare that they have no competing interests Dr Paresh Jobanputra has been involved in commercially sponsored trials of adalimumab and etanercept in rheumatic diseases He has ... virus following latency in the sensory ganglia can happen years later and manifest usually as cold sores Characteristically painful vesicles develop in a localised area such as the lip which...

Ngày tải lên: 11/08/2014, 21:22

4 259 0
picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease

picture yourself building a website with joomla! 1.6[electronic resource] step-by-step instruction for creating a high-quality, professional-looking site with ease

... use it After you create a database, you must associate a user with a username and password with the database Joomla! asks you for that information during the installation process so, again, write ... PTR: Stacy L Hiquet Associate Director of Marketing: Sarah Panella Manager of Editorial Services: Heather Talbot Marketing Manager: Jordan Castellani Acquisitions Editor: Megan Belanger Project ... Installing Joomla! 1.6 requires a series of steps on a Webserver Ǡ A MySQL database with a username, password, and database name is required Ǡ The database is created via the Website control panel...

Ngày tải lên: 29/05/2014, 23:54

320 858 0
Lab 4.1.4 Creating a Network Map using CDP

Lab 4.1.4 Creating a Network Map using CDP

... for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged EXEC mode, enter the command erase startup-config Router#erase startup-config ... type of router as well as how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers ... ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 4-4 CCNA 2: Routers and Routing Basics v 3.0 - Lab 4.1.4 Copyright...

Ngày tải lên: 04/11/2013, 16:15

4 505 0
Tài liệu Creating the project office 1 pdf

Tài liệu Creating the project office 1 pdf

... content that appears in print may not be available in electronic books Library of Congress Cataloging-in-Publication Data Englund, Randall L Creating the project office : a manager’s guide to leading ... JOSSEY-BASS BUSINESS & MANAGEMENT SERIES CONTENTS Preface xi The Authors and Contributors xvii PART ONE: CREATING THE CONDITIONS FOR CHANGE Leading Organizational Change Clear Danger: Creating a Sense ... CREATING THE PROJECT OFFICE Y CREATING THE PROJECT OFFICE A Manager’s Guide to Leading Organizational Change Randall L Englund Robert J Graham Paul C Dinsmore Copyright...

Ngày tải lên: 26/01/2014, 18:20

10 299 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... potential coadjuvants of those antimicrobial agents that are already available after incubation for 18–20 h at 37 °C Antibacterial activity was expressed as MIC, the concentration of peptide at which ... Sigma All other chemicals were reagent grade For antimicrobial assays, the commercially available quality control strain E coli ATCC 25922 was used The bactericidal activity of Esc(1–18) against...

Ngày tải lên: 16/03/2014, 00:20

18 494 0
CREATING A SUPPORTIVE ENVIRONMENT FOR ELDERLY WITH CHRONIC ILLNESS potx

CREATING A SUPPORTIVE ENVIRONMENT FOR ELDERLY WITH CHRONIC ILLNESS potx

... (1985) National Strategies for Health Care Organization: A World Overview Ann Arbor: Health Administration Press Rothman, J & Sager, J.S (1998) Case Management (2nd Edition) MA: Allyn & Bacon, ... hand, feedback from front- line paid care workers and volunteers reflected that the linkage between hospitals and social welfare agencies was inadequate (Department of Social Work and Social Administration, ... visitors are able to build up trustful relationship with the elderly and possess a certain level of skills in providing emotional support A local study has shown that a natural locality-based social...

Ngày tải lên: 22/03/2014, 14:20

7 507 0
Báo cáo khoa học: Molecular basis for substrate recognition and drug ˚ resistance from 1.1 to 1.6 A resolution crystal structures of HIV-1 protease mutants with substrate analogs pptx

Báo cáo khoa học: Molecular basis for substrate recognition and drug ˚ resistance from 1.1 to 1.6 A resolution crystal structures of HIV-1 protease mutants with substrate analogs pptx

... of CA-p2 interacted with PR (Fig 5A) Compared with p2-NC, the CA-p2 analog lacked an acetyl group at P4 and cannot form the same van der Waals interactions with PR However, the CA-p2 analog with ... complexes with substrate analogs Phe-Glu-Ala-Nle-amide, L6525; Sigma-Aldrich), which is an analog of the CA-p2 cleavage site The assay solution contained 50 mm sodium acetate, pH 5.0, 0.1 m NaCl and ... Georgia Cancer Coalition Distinguished Cancer Scholar award (I.T.W and R.W.H.), and the Georgia Research Alliance We thank the staff at the SER-CAT beamline at the Advanced Photon Source, Argonne...

Ngày tải lên: 30/03/2014, 20:20

13 302 0
Creating a glass object with max and vray

Creating a glass object with max and vray

... cheked and on V-ray shadows parameters check Transparent shadows and area shadow Use a plane for the scene and assign a white color to this It looks fine, but not really :) The glass need something ... Image Sampler(Antialising), turn of the Adaptive subdivision For the glass materials use this settings: and for the liquid this For the lighting I have used an Omni light, V-ray shadows cheked and ... reflect To this use a HDRI map You can find some HDRI images at this address http://athens.ict.usc.edu/Probes/ and assign this to V-ray Environment and the result And with caustics the scene will...

Ngày tải lên: 01/04/2014, 17:32

14 279 0
Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc

Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc

... Takeo S, Harada T, Okazawa T, Yanai H, Okita K: Matrix metalloproteinase-7 and matrix metalloproteinase-9 are associated with unfavourable prognosis in superficial oesophageal cancer Br J Cancer ... Barrett metaplasia; GERD, Gastro-Esophageal Reflux Disease; EAC, esophageal adenocarcinomas; ESCC, esophageal squamous-cell carcinomas; †significance is related to GERD; ††significance is related ... alteration in esophageal carcinoma J Gastroenterol Hepatol 2007, 22(12):2303-2309 35 Okazaki I, Wada N, Nakano M, Saito A, Takasaki K, Doi M, Kameyama K, Otani Y, Kubochi K, Niioka M, et al: Difference...

Ngày tải lên: 18/06/2014, 16:20

11 647 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

... 5'-AGGGCGGGGGCATCGGGCACCGGGATGGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated ... (5'gatttcgcgcaggtgatgag-3') for UL8; and 18S rRNA-f (5'-actcaacacgggaaacctca-3') and 18S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18S rRNA Reactions were performed using SYBER Premix Ex Taq II (Takara) with ... Real-time PCR amplifications were performed with primers UL6-f (5'-aaattctgtgtcaccgcaacaac-3') and UL6-r (5'-gcccgaagcactgactcaa-3') for UL6; UL8-f (5'-cttgctggacgcagagcacta-3') and UL8-r (5'gatttcgcgcaggtgatgag-3')...

Ngày tải lên: 20/06/2014, 01:20

13 463 0
Báo cáo sinh học: " Research Article Aλ3 λ1 , λ2 , Ω -Weighted Inequalities with Lipschitz r and BMO Norms" doc

Báo cáo sinh học: " Research Article Aλ3 λ1 , λ2 , Ω -Weighted Inequalities with Lipschitz r and BMO Norms" doc

... is called the The nonlinear elliptic partial differential equation d A x, du homogeneous A- harmonic equation or the A- harmonic equation, and the differential equation d A x, du B x, du 1.7 is called ... conjugate A- harmonic tensors,” Journal of Mathematical Analysis and Applications, vol 203, no 1, pp 278–288, 1996 S Ding, “Estimates of weighted integrals for differential forms,” Journal of Mathematical ... maximal operators and ı fractional integrals on non-homogeneous spaces,” Indiana University Mathematics Journal, vol 50, no 3, pp 1241–1280, 2001 T Iwaniec and A Lutoborski, “Integral estimates...

Ngày tải lên: 21/06/2014, 17:20

14 275 0
3 V TO 6 V INPUT, 1.5 A OUTPUT SYNCHRONOUS BUCK PWM SWITCHER WITH INTEGRATED FETs (SWIFT) pptx

3 V TO 6 V INPUT, 1.5 A OUTPUT SYNCHRONOUS BUCK PWM SWITCHER WITH INTEGRATED FETs (SWIFT) pptx

... PowerPAD to the largest area available Additional areas on the top or bottom layers also help dissipate heat Use any area available when 1.5 -A or greater operation is desired Connect the exposed area ... 10.7 kΩ instead of 10.0 kΩ R2 is then 3.92 kΩ Since capacitors are only available in a limited range of standard values, the nearest standard value was chosen for each capacitor The measured closed-loop ... This Area for Optimum Performance LAYOUT CONSIDERATIONS FOR THERMAL PERFORMANCE For operation at full rated load current, the analog ground plane must provide adequate heat dissipation area A 3-inch-by-3-inch...

Ngày tải lên: 24/07/2014, 04:20

21 347 0
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx

báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx

... Novotny EA, Garrett-Beal L, Ward JM, Libutti SK, Richard Alexander H, Cerrato A, Parisi MJ, Santa Anna-AS, Oliver B, Chandrasekharappa SC, Collins FS, Spiegel AM, Marx SJ: Molecular pathology ... 89:143-150 11 Carrasco CA, González AA, Carvajal CA, Campusano C, Oestreicher E, Arteaga E, Wohllk N, Fardella CE: Novel intronic mutation of MEN1 gene causing familial isolated primary hyperparathyroidism ... A, Gallart L, Martín-Campos JM, Catasús L, Mayoral C, Mato E, Tortosa F, Bernà L, Rodríguez-Espinosa J, Blanco-Vaca F, Matías-Guiu X, de Leiva A, Mauricio D: Genetic, clinical, and biochemical...

Ngày tải lên: 09/08/2014, 01:24

7 412 0
Báo cáo khoa học: "Combination therapy with docetaxel and S-1 as a first-line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis" docx

Báo cáo khoa học: "Combination therapy with docetaxel and S-1 as a first-line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis" docx

... Takagane A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, Toh Y, Nagaie T, Takagi S, Yamamura Y, Yanaoka K, Orita H, Takeuchi M: S-1 plus cisplatin versus S-1 alone for ... for patients with advanced gastric cancer Cancer Chemother Pharmacol 2009, 64:877-883 Yoshida K, Hirabayashi N, Takiyama W, Ninomiya M, Takakura N, Sakamoto J, Nishiyama M, Toge T: Phase I study ... combination therapy with S-1 and docetaxel (TXT) for advanced or recurrent gastric cancer Anticancer Res 2004, 24:1843-1851 Yoshida K, Ninomiya M, Takakura N, Hirabayashi N, Takiyama W, Sato Y,...

Ngày tải lên: 09/08/2014, 03:21

7 407 0
Báo cáo y học: "Segregation of a M404V mutation of the p62/sequestosome 1 (p62/SQSTM1) gene with polyostotic Paget''''s disease of bone in an Italian family" pps

Báo cáo y học: "Segregation of a M404V mutation of the p62/sequestosome 1 (p62/SQSTM1) gene with polyostotic Paget''''s disease of bone in an Italian family" pps

... years after the diagnosis of PDB, bone pain in the right pelvis increased markedly and a Available online http://arthritis-research.com/content/7/6/R1289 Table Available clinical and mutational ... by an autoanalyzer, has been performed also in all the individuals undergoing mutational analysis The upper limit of the reference range is 120 units/l DNA extraction, PCR and mutational analysis ... participated in the sequence alignment LM performed the statistical analysis AT supervised the performance statistical analysis AA helped in the clinical activity AC participated in the sequence alignment...

Ngày tải lên: 09/08/2014, 07:20

7 355 0
Báo cáo y học: "Hyperthyroidism from autoimmune thyroiditis in a man with type 1 diabetes mellitus: a case report" pdf

Báo cáo y học: "Hyperthyroidism from autoimmune thyroiditis in a man with type 1 diabetes mellitus: a case report" pdf

... was no lid lag or proptosis His thyroid gland was not enlarged and was non-tender There was no cervical lymphadenopathy or appendicular tremor The remainder of his physical examination was within ... is desirable, as the treatment of these entities differs Graves’ disease, goiters and adenomas are treated with thionamide medications (such as methimazole or propylthiouracil), radioactive iodine ... hypothyroidism appears to increase insulin resistance independently of weight gain [9,10] and has been associated with an increased risk of symptomatic hypoglycemia [11] Protracted hypoglycemia can lead...

Ngày tải lên: 10/08/2014, 23:21

4 307 0
Báo cáo khoa học: " Post-infection immunocomplex glomerulonephritis and Legionnaires’ disease in a patient with adult Still’s disease during treatment with interleukin 1 receptor antagonist anakinra: a case report" pptx

Báo cáo khoa học: " Post-infection immunocomplex glomerulonephritis and Legionnaires’ disease in a patient with adult Still’s disease during treatment with interleukin 1 receptor antagonist anakinra: a case report" pptx

... sputum Gram stain showed no bacteria, but the polymerase chain reaction assay was positive for Legionella pneumophila in more Page of Table Laboratory results on admission Laboratory tests Values ... the pathogenesis of the disease The elevation of antinuclear antibodies, antineutrophilic and anticytoplasmic antibodies and antinative DNA was not significant Light chains, which are in the family ... abdomen was soft and non-tender without any pathological findings Her neurological examination showed no sensory or motor deficiency An arterial blood gas analysis showed a pH of 7.45, partial...

Ngày tải lên: 10/08/2014, 23:21

5 395 0
Báo cáo y học: " Recurrent spontaneous hip dislocation in a patient with neurofibromatosis type 1: a case report" potx

Báo cáo y học: " Recurrent spontaneous hip dislocation in a patient with neurofibromatosis type 1: a case report" potx

... lateral malleolus She had six cafb-aulait patches on her trunk and bilateral axillary freckling A radiograph of the pelvis revealed a superior dislocation of her left hip with an abnormal appearing ... that can have both focal and generalized skeletal manifestations Generalized skeletal manifestations such as osteoporosis and short stature are common Focal abnormalities such as tibial dysplasia, ... move in bed A radiograph of her hip revealed repeat dislocation Relocation of her hip was performed under general anaesthetic and balanced skeletal traction was maintained by inserting a pin to...

Ngày tải lên: 11/08/2014, 00:23

4 280 0
Báo cáo y học: "Occipital peripheral nerve stimulation in the management of chronic intractable occipital neuralgia in a patient with neurofibromatosis type 1: a case report" pot

Báo cáo y học: "Occipital peripheral nerve stimulation in the management of chronic intractable occipital neuralgia in a patient with neurofibromatosis type 1: a case report" pot

... her family medical history, her mother had died at 68 years of age as a result of heart disease, and her father was alive at 72 years of age with Page of a history of cancer An older sister has ... implantable, programmable, rechargeable generator was permanently implanted in a subcutaneous pocket area in the left buttock For the implantation, a local anesthetic (0.25% bupivacaine with ... a total of 20 ml) was used for skin and tissue infiltration Figure An ultrasound image obtained with a linear transducer placed over the greater occipital protuberance The anatomical layers are...

Ngày tải lên: 11/08/2014, 00:23

6 358 0
Báo cáo y học: " Liposarcoma of the forearm in a man with type 1 neurofibromatosis: a case report" ppsx

Báo cáo y học: " Liposarcoma of the forearm in a man with type 1 neurofibromatosis: a case report" ppsx

... present a case of forearm liposarcoma in a patient with NF1 Case presentation A 41-year-old Caucasian man, known to have generalized NF1 since the age of 21, presented at our clinic complaining of a ... to adjuvant radiation [12] In our case, there were axillary metastases, but the decision not to amputate was taken intra-operatively after assuring that an R0 resection was possible The treatment ... stay in hospital, the patient was discharged The movement in the operated forearm was free, without limitation Ambulant, adjuvant radiotherapy commenced weeks later The total dose of radiotherapy...

Ngày tải lên: 11/08/2014, 17:21

5 266 0
w