flatfish with a needle biosensor

... TCCTTCAACAACTTGCTCTAT ned R: AACTAGCAGCCAGGGGTAT F: ATGGGCTCAGTTCATAAACAT ned R: CCAGGGCAGGAGTCTGT F: AATGTGCAAGTAAGCGTATGT ned R: CGGAGACGGGCACATAATCAG F: TCATAGGACGAGGCGATGGTG fam R: CAACAAACACCCAGATGCT ... CAGAAGCTTAATTGGCCTAAT ned R: GCACACAGGCACACAGAATA F: ACGCACCTTAAGAACAAATGT fam 52 54 F: GAGCGGTATCATCTCACTCA hex R: CACATGTTTTTCTTGCGTTAT Ta (°C) Primer sequence (50 ? 30 ) Exact tests of Hardy-Weinberg ... CAACAAACACCCAGATGCT F: TTATCATTTGCAGACTCAAGG ned R: AGAAGCTAGGCCATAACATTA F: TCCTTCAACAACTTGCTCTAT fam 52 54 52 55 52 54 54 R: GATATGCGGATACGGACAC F: GCAGTGTGTATCGGTGTGT ned R: CATGTGTTCTGATTCGAGTTA 56...

Ngày tải lên: 19/07/2016, 19:43

... of fatty acid of clam Ruditapes decussatus reared in sea water and effluent from a fish farm in Galicia (JaraJara et al., 1997) The fatty acid variation and the factors affecting to this variation ... intertidal areas, the natural feed and environmental factors are uncontrollable and are dependent of nature Dynamic of tide, wave and current create the availability of algae, organic matter that ... important factors affecting growth and survival of clam larvae The results indicated that clam larvae can tolerate a salinity range from 10ppt to 30ppt At a salinity of 35ppt, all larvae had died...

Ngày tải lên: 21/06/2014, 05:20

... the natural feed and environmental factors are uncontrollable and are dependent on nature Dynamics of tide, wave and current create the availability of algae, organic matter that are regarded as ... stage when the fatty acids normally accumulated Our result confirmed the variation of fatty acid of clam Ruditapes decussatus reared in sea water and effluent from a fish farm in Galicia (Jara-Jara ... Soudanta, P., Paillarda, C., Choqueta, G., Lamberta, C., H.I Reidb, Marhica, A. , Donaghya, L., Birkbeck, T.H., 2004 Impact of season and rearing site on the physiological and immunological parameters...

Ngày tải lên: 22/06/2014, 12:20

... individuals of each species with an estimated age of 15–20 years The same individuals were measured for the above variables in May, July and September Samples for measuring leaf water status and gas ... (Friuli-Venezia Giulia, Northeastern Italy) The Karstic areas are characterized by high soil drainage [24] so that even in presence of sufficient annual rainfall, plants may suffer summer (and winter) water ... of leaf conductance to water vapour (gL), transpiration (EL) and water potential (YL) as measured in Prunus mahaleb L field-growing plants Vertical bars are SD of the mean The mean leaf water...

Ngày tải lên: 08/08/2014, 01:21

... Percentage covers of algae and seagrass （%） Sargassum fusiforme Calliarthron yessoense Serraticardia maxima Corallina pilulifera Gigartinales Codium fragile Phyllospadix iwatensis Undaria pinnatifida ... between January and March, while natural U pinnatifida plants maturated after spring (Taniguchi et al., 1981; Akiyama et al., 1982; Tokuda et al., 1987; Saitoh et al., 1999) Thus, prematurity and withering ... Percentage covers of algae and seagrass （%） Sargassum fusiforme Calliarthron yessoense Sargassum horneri Grateloupia turuturu Phyllospadix iwatensis Undaria pinnatifida Crustose coralline algae Cladophora...

Ngày tải lên: 05/09/2013, 09:38

... classification 100 80 Overall Accuracy Class Low accuracy Class High accuracy 78 76 90 Accuracy (in percentage) Accuracy (in percentage) 95 85 80 75 70 74 Overall Accuracy Class Low accuracy Class ... the group averages are within the same range and hence are treated fairly when posed as a classification problem On the other hand, the ‘ideal’ case is when a machine can replicate the task of robustly ... regions, and performing a robust region-based matching with other images Primarily meant for image retrieval applications, we use it here to quantify familiarity Given a pre-determined anchor database...

Ngày tải lên: 07/03/2014, 17:20

... drainage area, has reached an alarming level The Hg content in the Yellow River mouth is low and has remained nearly unchanged compared with that of the 1980s, but the waters at Dongying Harbour ... higher than that in other waters The high values were presumably caused by oil leakage from ships at ports and in harbours Compared with the data from 1980s (EPA of China, 199 0A; EPA of China, 1990B), ... eutrophication by the National Research Institute of Disaster in Japan No general standard or method to evaluate the degree of eutrophication has been established Much research has reported that the...

Ngày tải lên: 29/03/2014, 21:20

... Italy.2 As early as in 1350, the Fabriano paper was applied as far as in Finland for writing a document.3 Also the Fabriano art of papermaking spread from Italy to other European countries, starting ... Vantaa 1998 (IPH Monograph Series, Vol 2), pp 81ff José C Balmaceda: La Contribución Genovesa al Desarrollo de la Manufactura Papelera Española Fuengirola 2004 (Collecion Apapiris) of Fabriano ... Vlad Atanasiu: Assessing Paper Origin and Quality by Means of Large-Scale Laid Lines Density Measurements In: Rosella Graziaplena, Mark Livesey (eds.): Paper as a Medium of Cultural Heritage Archaeology...

Ngày tải lên: 01/04/2014, 00:20

... year Table Overall and classified prevalence of canine intestinal parasites in 1997, 2002 and 2007 Parasites Giardia intestinalis Group 1a b Others Isospora spp Group 1a b Others Toxocara canis ... decreased compared to 10 years ago, since the knowledge of owners regarding canine intestinal parasites and parasitic zoonoses has been increased provably Several papers in Japan have actually ... Elliot AD, Thompson RCA High prevalence of Giardia detected in cats by PCR Vet Parasitol 2003, 110, 197-205 10 Nakamura-Uchiyama F, Hiromatsu K, Ishiwata K, Sakamoto Y, Nawa Y The current status...

Ngày tải lên: 07/08/2014, 23:22

... 10 a a b b b b c ab a b abc abc a a a a a a a Mg (mg g -1) 1.5 a b a b c 0.5 b b b c heartwood a a a a a a transitional ab b a a a sapwood c c b bark Figure Interspecific comparisons of mean ... immobilization and DBH and tree age Homogeneity of variance for ANOVA analysis was assessed with the Bartlett test and logarithmic transformations were used when required No variable transformations ... In a recent study, soil pH decreases in a sequence starting with sugar maple (Acer saccharum Marsh.) > white ash (Fraxinus americana L.) > red maple (Acer rubrum L.) > beech (Fagus grandifolia...

Ngày tải lên: 08/08/2014, 14:21

... extract was made alkaline by adding 200 µl of 2N NaOH A 300 µl saturated sodium bicarbonate and ml Dns-Cl was added to the alkaline extract The reaction mixture was transferred to a 40°C incubator ... histamine and microbial analyses in tuna muscle by time and temperature - Preparation of samples: Fresh tuna (Thunnus albacares) was preserved at 4oC and 0°C Samples were taken at the appropriate ... indicate that the quality of these samples may be a serious problem for public health In Asia and in particular those areas with an extensive coastline and high ambient temperatures such as Vietnam,...

Ngày tải lên: 06/10/2015, 13:05

... Association Chart No W77 W106 Wl31 Wl5 0A W150C H-30 5A CHART Title Kii Suido and Approaches Osaka Wan and Harima Nada Akasi Kaikyo and Approaches OsakaWan Kii Suido Maritime Traffic Information Chart for ... O b a t a k e Se t o Bisan Setoand Binso Nada Uno Ko and Approiches Iyo Nada and Approaches Aki Nada and Hirosima Wan Mizusima Ko and Approaches Sa k a i d e K o A p p r o a c h e st o N a b ... direction of Akasi Kaikyo and Osaka Port (except Hamadera Passage and its southern area), Amagasaki Nisinomiya Asiya Port or Kobe Port (except Kobe Nishi Passage II and its western area), should pass...

Ngày tải lên: 03/05/2016, 22:51

... the yearly PAHs loadings were estimated using the meteorological data of 2006 The meteorological data was obtained from the Japan Meteorological Agency, and the data at Higashihiroshima was used ... standard deviation) Loadings of PAHs The loadings of PAHs for each precipitation event was calculated with the change in PAH concentration and flow rate with time An example of the calculation ... this area (Figure 17; in order to compare with the road traffic loading, the loading for 10 PAHs (Pyr~Ind) was also calculated similarly because the road traffic was calculated was only for 10 PAHs)...

Ngày tải lên: 05/09/2013, 09:38

... carries a semantic sense H i r a g a n a are basic Japanes e phonograms representing syllables About fifty of them constitute the syllabary K a t a k a n a are characters corresponding to hiragana, ... h a r a c t e r Sort There are three clearly identifiable character sorts in Japanese: K a n j i are Chinese characters adopted for historical reasons and deeply rooted in Japanese Each character ... the great advantages By using a dictionary, a morphological analyzer has to deal with unknown words and unknown tags, 14 and is also fooled by many words sharing common substrings In practical contexts,...

Ngày tải lên: 20/02/2014, 18:20

Ngày tải lên: 07/03/2014, 02:20

... Dell’ Ariccia and Vladkova-Hollar (2003) and Backé and Zumer (2005) Croatia, Czech Republic, Estonia, Hungary, Latvia, Lithuania, Poland, Romania, Slovakia and Slovenia An analogous line of reasoning ... dataset is unbalanced as the length of the individual data series depends largely on data availability All data are transformed into logs, except for spread2 Data for bank credit to the private ... case in Estonia, Latvia 13 and Croatia and also perhaps in Hungary and Slovenia On the other hand, initial undershooting might not be a serious problem for Lithuania, Poland and Romania because...

Ngày tải lên: 15/03/2014, 04:20

... These data were obtained from a similarly aged (ca 50 years) Castanopsis cuspidata stand near the study site This adjacent stand has almost same average tree height and DBH values as the study site ... coppices have reached a stand age of 40–50 years and 20 m in tree height without any silvicultural management and have covered large areas in southwestern Japan [6] Over the last few decades, the ... hit a large area of western Japan The local maximum instantaneous wind speed of T9119 was 52.6 m·s–1 at the Kumamoto Local Meteorological Observatory [47] Based on the local maximum instantaneous...

Ngày tải lên: 08/08/2014, 01:21

... animals sampled from each area could vary according to livestock density, access to transportation and availability of logistic facilities Study animals include all animals aged year and above in a ... The prevalence of Brucella antibodies at the individual level was established by the Stata survey command considering village as a primary sampling unit and each variable as a stratum and sampling ... that females showed higher seropositivity than male animals, and this variable (sex) showed collinearity with age may also substantiate this fact In the study areas, female animals are maintained...

Ngày tải lên: 12/08/2014, 18:22

... and estimates of age at maturity of two species of skates (Raja binoculata and Raja rhina) from Monterey Bay, California NOAA (National Oceanic and Atmospheric Administration) Technical Report ... 10.269 na na Mean size at ages 0–8 (including fractional ages for young of the year) for male and female Cownose Rays sampled in Chesapeake Bay (DW = disc Age (years) Variable 0.12 0.30 Mean DW ... National Oceanic and Atmospheric Administration (NOAA) Award Number NA07NMF4570324 and in part by NOAA Award Number NA10OAR4170085 to Virginia Sea Grant This is Virginia Institute of Marine Science...

Ngày tải lên: 04/09/2015, 08:08