fi cation and detection of hiv 1 rna

... lamina propria J Immunol 19 92, 14 9:2 816 -2822 Page 10 of 11 (page number not for citation purposes) AIDS Research and Therapy 2009, 6:20 10 11 12 13 14 15 16 17 18 19 20 21 Brenchley JM, Schacker TW, ... picture of RT nested PCR products of human beta-actin mRNA B: Representative gel picture of RT nested PCR products of HIV- 1 RNA Detection of HIV- 1 DNA /RNA from the urine samples The HIV env region ... (data not shown) Detection of HIV- 1 DNA /RNA in feces Four groups of study participants were recruited in 2008 (Table 1) Group A: 10 HIV- 1 negative individuals; Group B: 11 HIV- 1 infected individuals,...

Ngày tải lên: 10/08/2014, 05:21

... ASF/SF2 HIV- 1 + SC35 0 ,15 HIV- 1 + 9G8 0 ,10 0,05 1: 0.5 1: 1 1: 3 1: 0.5 1: 1 1: 3 +9G8 1: 3 +SC35 1: 1 +ASF/SF2 B HIV- 1 1:0.5 Pr55Gag p48 p 41 αCAp24 CAp24/p25 p66 p 51 gp160 αRT αVpr αTMgp 41 TMgp 41 Figure ... RNAs from cells expressing HIV- 1 and either one of the SR proteins and subjected 10 µg total RNA to Northern blot analysis with an HIV- 1 env-specific probe In control HIV1 cells, % of HIV- 1 RNA ... tat RNA is determined by both a suboptimal 3' splice site and a 10 nucleotide exon Page 12 of 13 (page number not for citation purposes) Retrovirology 2005, 2:33 13 14 15 16 17 18 19 20 21 22...

Ngày tải lên: 13/08/2014, 09:21

... superposition of unliganded C95M/C1095A structure with each of the six cyclic urea-complexed structures shown in Fig 2B 1LV1 1LV1 1HWR 1DMP 1QBS 1HVR 1QBR 1QBT 1HWR 1DMP 1QBS 1HVR 1QBR 1QBT 0.00 ... containing C95A HIV- 1 protease Structural features of C95A mutation in HIV- 1 protease Eight structures deposited in the PDB (files 1DAZ, 1A94, 1HWR, 1HVR, 1QBS, 1DMP, 1QBR and 1QBT) are of complexes ... C95A HIV- 1 protease in PDB file 1DAZ (shown by green carbons) on unliganded HIV- 1 protease structure in PDB file 1LV1 (shown by yellow carbons) The water molecule is present only in the unliganded...

Ngày tải lên: 31/03/2014, 07:20

... 2002, 18 6: 617 -625 Abstract Page of (page number not for citation purposes) Journal of the International AIDS Society 2005, 7: 71 10 11 12 13 14 15 http://www.jiasociety.org/content/7 /1/ 71 Kantor ... Robertson DL, Anderson JP, Bradac JA, et al.: HIV- 1 Nomenclature Proposal: A Reference Guide to HIV- 1 Classification Human Retroviruses and AIDS: A Compilation and Analysis of Nucleic and Amino Acid ... analyses of RT and protease sequences from persons infected with nonsubtype B HIV- 1 Program and abstracts of the 10 th Conference on Retroviruses and Opportunistic Infections; February 10 14, 2003;...

Ngày tải lên: 20/06/2014, 08:20

... interfering RNA against CCR5 Proc Natl Acad Sci USA 2003, 10 0 :18 3 -18 8 Page 10 of 11 (page number not for citation purposes) AIDS Research and Therapy 2004, 1: 2 10 11 12 13 14 15 16 17 18 19 20 21 22 ... inhibitor of HIV- 1 replication Proc Natl Acad Sci USA 2002, 99 :14 047 -14 052 Rossi J: The application of ribozyme to HIV- 1 infection Curr Opin Mol Ther 19 99, 1: 316 -322 Coburn GA, Cullen BR: Potent and ... http://www.aidsrestherapy.com/content /1/ 1/2 Figure HIV- 1 challenge of differentiated macrophages HIV- 1 challenge of differentiated macrophages: HIV- 1 Tar, Tar-CCR5Rz and control EGFP vector transduced and unmanipulated...

Ngày tải lên: 10/08/2014, 05:20

... 203 1. 1 0.85 -1. 46 0. 417 10 4 1. 1 0.77 -1. 56 0. 61 99 1. 2 0.75 -1. 75 0.5 31 HHD 16 7 1. 0 0.74 -1. 32 0.983 94 0.9 0.59 -1. 23 0.385 73 1. 2 0.75 -1. 92 0.442 HHE HHD/HHE 15 8 31 1 .1 1.9 0.82 -1. 51 1 .14 -3 .16 0.495 ... (15 .9) 75 (15 .6) 10 5 (16 .1) HHE 310 (13 .7) 13 8 (12 .2) 17 2 (15 .2) 61 (12 .7) 11 1 (17 .0) HHF *1 128 (5.6) 76 (6.7) 52 (4.6) 24 (5.0) 28 (4.3) HHF*2 480 ( 21. 2) 259 (22.8) 2 21 (19 .5) 99 (20.6) 12 2 (18 .7) ... HHA 6 01 (26.5) 305 (26.9) 296 (26 .1) 13 3 (27.7) 16 3 (24.9) HHB HHC 44 (1. 9) 17 8 (7.9) 25 (2.2) 69 (6 .1) 19 (1. 7) 10 9 (9.6) (1. 7) 42 (8.8) 11 (1. 7) 67 (10 .2) HHD 370 (16 .3 19 0 (16 .8) 18 0 (15 .9)...

Ngày tải lên: 13/08/2014, 01:20

... interests Page of 14 15 16 17 18 19 20 21 Received: 20 April 2 011 Accepted: June 2 011 Published: June 2 011 References Chan DC, Fass D, Berger JM, Kim PS: Core structure of gp 41 from the HIV envelope ... the HIV gp120 envelope glycoprotein Nature 19 98, 393:705- 711 12 Wyatt R, Sodroski J: The HIV- 1 envelope glycoproteins: fusogens, antigens, and immunogens Science 19 98, 280 :18 84 -18 88 13 Sterjovski ... in the CD4 binding cavity of HIV- 1 gp120 influencing gp120-CD4 interactions and fusogenicity of HIV- 1 envelopes derived from brain and other tissues Retrovirology 2 011 8:42 Submit your next manuscript...

Ngày tải lên: 13/08/2014, 01:20

... Page 11 of 13 (page number not for citation purposes) Retrovirology 2008, 5:72 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 innate immunity to retroviral infection Cell 2003, 11 3(6):803-809 ... Vif(-) HIV- 1NL4-3 P24 antigen was measured post-infected day 3, 5, 7, 10 14 , 21 a results of wild type Vif(+) HIV- 1NL4-3 infection; b results of Vif(-) HIV- 1NL4-3 Δ Vif infection Page of 13 (page ... packaging J Virol 2004, 78( 21) :11 8 41- 118 52 Schafer A, Bogerd HP, Cullen BR: Specific packaging of APOBEC3G into HIV- 1 virions is mediated by the nucleocapsid domain of the gag polyprotein precursor...

Ngày tải lên: 13/08/2014, 05:21

... http://www.retrovirology.com/content/5 /1/ 97 a RNPs Absorbance 254 nm 0 .18 Monosomes polysomes 0 .16 0 .14 0 .12 0 .1 pcDNA +EDTA 0.08 0.06 0.04 0.02 0 10 15 Fraction number 20 25 b Sam68∆C Sam68∆C +EDTA 11 13 15 17 19 21 11 13 15 17 19 ... regulation of HIV- 1 alternative RNA splicing Curr HIV Res 2006, 4 (1) :43-55 Hope TJ: The ins and outs of HIV Rev Arch Biochem Biophys 19 99, 365 :18 6 -19 1 Pollard V, Malim M: The HIV- 1 Rev Protein ... N Sonenberg, and H Schaal References 10 11 12 13 14 15 16 Schwartz S, Felber BK, Benko DM, Fenyo E-M, Pavlakis GN: Cloning and functional analysis of multiply spliced mRNA species of human immunodeficiency...

Ngày tải lên: 13/08/2014, 05:21

... dimerization of the viral RNA genome [9], packaging of the viral RNA into virions [10 -14 ], the strand transfer step of reverse transcription [15 ], and as a possible HIV- 1 derived miRNA with a role ... mRNA 3' end formation Mol Cell Biol 19 91, 11 :16 24 -16 30 Gilmartin GM, Fleming ES, Oetjen J: Activation of HIV- 1 premRNA 3' processing in vitro requires both an upstream element and TAR EMBO J 19 92, ... during reverse transcription RNA 20 01, 7 :10 97 -11 14 Bennasser Y, Le SY, Yeung ML, Jeang KT: HIV- 1 encoded candidate micro-RNAs and their cellular targets Retrovirology 2004, 1: 43 Klase Z, Kale P, Winograd...

Ngày tải lên: 13/08/2014, 05:21

... HIV RNA/ mL High Vaginal RNA Levels > 500 copies HIV RNA/ sample Low Vaginal RNA Levels < 10 0 copies HIV RNA/ sample ART Use < 200 CD4+ T lymphocytes/ul X4-like Genotypes (n = 14 ) p-value* 62 .1% 14 .3% ... virus and the absence of ART Table 1: Vaginal Genotypic Associations in 43 Women R5-like Genotypes (n = 29) High Plasma RNA Levels ≥ 10 ,000 copies HIV RNA/ mL Low Plasma RNA Levels < 1, 000 copies HIV ... 0. 01 20.7% 71. 4% 0.004 48.3% 44.4% 1. 00 41. 4% 42.9% 0. 81 38.0% 34.6% 85.7% 44% 0. 01 0.44# *Chi Square (Χ2) analyses #Fisher Exact Test; data from 81% of the cohort available for analysis Page of...

Ngày tải lên: 20/06/2014, 01:20

... UTR of Tat1 and Tat2 RNAs, to the deleted 5' UTR (delta R-U5) of Tat1 and Tat2 RNAs, to the 5' UTR of the viral genomic RNA, and to the 5' first 11 1 nt of Tat RNA In vitro RNA synthesis and translation ... form, and to Michel Léonetti (CEA, Saclay, France) for the monoclonal anti-Tat 7S and 11 S antibodies References 10 11 12 13 14 15 16 17 18 19 20 21 Strebel K: Virus-host interactions: role of HIV ... TAATAATTCTAGAAGTACAGGCAAAAAGCAGCTGCTTATATGC 3' (exon3 reverse for Tat1:← 17 18 and for Tat2:← 17 70) (11 1)NcoI rev 5' TATATACCATGGGGCACACACTACTTTGAGCACTCAAGG 3' (exon1:reverse:← 11 1) UTRTatNcoI rev 5' TATATTACCATGGTTCTTGCTCTCCTCTGTCGAGTAACG...

Ngày tải lên: 12/08/2014, 23:22

... ( 71% ) ( 61% ) 334 (18 2-535) 387 ( 214 -464) 211 (19 8- 518 ) 3.66 (2.55-4.30) 3.9 (3.6-4 .1) 4.2 (4.0-4.8) CD4 count at nadir, median cells/mm3 (IQR) 64 (18 -19 1) 13 8 ( 31- 200) 14 (6- 41) HIV- 1 RNA load ... http://www.retrovirology.com/content/7 /1/ 56 10 11 12 13 14 15 16 17 18 19 20 21 22 study of maraviroc in antiretroviral-naive patients with R5 HIV- 1: 96week results [abstract] 5th IAS Conference on HIV Pathogenesis, Treatment and ... Dual/Mixed/CXCR4-tropic 16 ( 31% ) 12 (39%) ( 31% ) 45 (9) 46 (8) 40 (12 ) Median time from HIV- 1 diagnosis, years (IQR) 17 (14 -19 ) 16 (13 -18 ) 18 (17 -22) Italian nationality, n (%) 48 (94%) 29 (93%) 12 (92%) Heterosexual...

Ngày tải lên: 13/08/2014, 01:20

... B of the complex of HIV- 1 protease with OE inhibitor 0.05 11 21 31 41 51 61 71 91 81 Residue number B factor 80 chain A 60 40 20 0 11 21 31 41 51 61 71 81 91 20 40 chain B Fig The complex of HIV- 1 ... Inhibitor N1-CA1-C1-C2 CA1-C1-C2-N2 C1-C2-N2–CA2 C2-N2–CA2-C3 N1-CA1-C1 CA2-C3-N2 OE RE SE 11 2 56 60 -89 -17 5 -17 3 16 5 -14 8 -14 2 - 21 77 67 14 1 14 8 14 8 Fig 10 Stereoview of the position of inhibitor ... hydrogen bonds to the Asp29 S3¢ OE I50 A128 D129 D130 V132 I147 G148 RE SE – 14 – – 2 11 – – 31 18 23 OE R8 D129 G148 G149 F153 RE SE 1 13 – 1 11 – 22 20 13 ˚ and Asp30 with bond-length differences...

Ngày tải lên: 19/02/2014, 16:20

... 2, pUC19 and 10 mM DTT; lane 3, pUC19 and lM FeCl3; lane 4, pUC19, 10 mM DTT, and lM FeCl3; lane 5, pUC19, 10 mM DTT, lM FeCl3, and 50 lgÆmL )1 rBcp2; lane 6, pUC19, 10 mM DTT, lM FeCl3, and 50 ... disulfide state during Prx reduction (e.g thioredoxin reductase and thioredoxin) (Fig 1) Two archaeal Prxs from Aeropyrum pernix APE2278 [10 ] and Pyrococcus horikoshii PH1 217 [11 ,12 ] have A H2O 1- Cys ... transcription factors TBP and TFB, respectively [17 ] bcp2 mRNA B 16 S rRNA Puri cation and characterization of recombinant Bcp2 (rBcp2) Fig Northern hybridization analysis of S solfataricus P2 bcp2...

Ngày tải lên: 07/03/2014, 12:20

... 3984–3989 61 Engelman, A., Mizuuchi, K & Craigie, R (19 91) HIV- 1 DNA integration: Mechanism of viral DNA cleavage and DNA strand transfer Cell 67, 12 11 12 21 62 Asante-Appiah, E & Skalka, A.M (19 99) HIV- 1 ... likened to that of a Ôright-handÕ [35] The major subdomains of the polymerase domain of p66 are termed fingers (residues 1 85, 11 8 15 5), palm (86 11 7, 15 6–237) and thumb (238– 318 ) The DNA polymerase ... FASEB J 11 , A839 11 Babe, L.M., Pichuantes, S & Craik, C.S (19 91) Inhibition of HIV protease activity by heterodimer formation Biochemistry 30, 10 6– 11 1 12 Restle, T., Muller, B & Goody, R.S (19 90)...

Ngày tải lên: 08/03/2014, 09:20

... 2-mercaptoethanol 0 .1 133 85 93 1. 0 10 .0 12 3 11 6 98 11 0 37 14 1 12 7 12 15 0 11 89 92 10 5 96 11 7 86 16 11 8 ND ND 13 0 88 93 95 activity after exposure to low concentrations (1 mM) of Ca2+, Mg2+, Co2+, Fe3+, and ... B.J (19 64) Disc Electrophoresis II Method and application to human serum proteins Ann N.Y Acad Sci 12 1, 404–427 21 Gilbert, E.J., Cornish, A & Jones, C.W (19 91) Puri cation and properties of extracellular ... indication of lipase activity in those areas of the Table Puri cation of LipA from Acinetobacter sp RAG -1 Puri cation method Protein (mg) Activity (units)a Specific activity (unitsÆmg protein )1) ...

Ngày tải lên: 23/03/2014, 21:20

... TGase 2 10 20 Factor XIII 10 20 (min) DMC DMC E6 E8 E46 E12 E125 E50 E4 E42 E10 E18 E 111 E 21 E 115 E18 E 51 E 115 E1 E2 E8 E12 E46 E10 E 51 Fig Evaluation of the reactivities of the selected peptides ... shown in Fig were expressed as * E12 * E50 E524 * E8 E47 * E 51 * E10 * E 21 E33 E9 * E1 * E18 * E6 E53 * E125 * E42 E 110 * E4 E55 E68 * E46 E17 E 510 E45 E5 * E 111 * E 115 E70 * E2 Y D Y W P M W G P ... identi cation of peptide substrates for TGase and Factor XIIIa J Biol Chem 2 81, 17 699 17 706 16 Sugimura Y, Hosono M, Kitamura M, Tsuda T, Yamanishi K, Maki M & Hitomi K (2008) Identi cation of preferred...

Ngày tải lên: 29/03/2014, 21:20

... CA-p2 P 212 12 p2-NC P 212 12 p2-NC P 212 12 p2-NC P 212 12 p6pol-PR P 212 12 p6pol-PR P 212 12 p1-p6 P 212 12 p1-p6 P 212 12 57.89 85.96 46 .19 50 1. 54 34 544 6.5 (37 .1) 13 .4 (5.8) 10 1. 54 0 .12 0 .19 19 4 58.00 ... 50 1. 40 44 2 91 10 .1 (45.6) 8.9 (2 .1) 10 1. 40 0 .15 0 .19 18 8 58.02 85.89 46. 61 50 1. 10 95 318 10 .2 (37.7) 10 .4 (2 .1) 10 1. 10 0 .13 0 .17 206 57.80 85.59 46.46 50 1. 30 55 009 7.9 (33.0) 14 .4 (3.2) 10 1. 30 ... 99.2 (93 .1) 90.3 (10 0) 89.2 (96.2) 99.9 (10 0) 0. 010 0.029 0. 011 0.029 0. 015 0.033 0. 013 0.030 0.009 0.029 0. 011 0.0 31 0. 010 0.030 0. 012 0.034 15 .9 21. 9 27.5 31. 5 8.0 12 .2 14 .0 23.7 9.0 13 .7 10 .6...

Ngày tải lên: 30/03/2014, 20:20

... 22 21 21 21 21 21 20 19 19 19 19 19 19 19 18 18 18 18 18 18 18 mIMR DNA begin 11 58 13 14 10 87 13 49 74 13 02 17 562 322 478 734 930 10 22 14 04 356 838 11 46 772 11 89 12 53 268 3 61 1238 12 74 990 63 15 9 ... AA 12 61 803 10 8 12 79 300 200 97 14 08 212 226 274 259 11 18 644 11 00 515 11 31 409 918 988 10 51 673 10 66 612 953 12 97 33 733 11 30 21 155 17 0 12 8 346 63 18 4 11 2 15 6 337 38 382 585 667 696 967 10 59 ... 15 9 19 2 305 956 10 60 14 27 468 5 41 886 919 956 13 89 14 61 end mIMR AA begin end Protein function 11 94 13 50 11 22 13 84 10 3 13 29 43 587 346 502 758 954 10 46 14 28 379 8 61 116 9 794 12 11 1274 21 288 381...

Ngày tải lên: 18/06/2014, 18:20