 to change the layout of a slide

... have the help of sophisticated information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar to ... and other parameters related to the customer, whereas the role of the employees, their satisfaction, loyalty and the link between these variables and profitability is not often included in marketing...

Ngày tải lên: 20/12/2013, 17:15

... daily, and vendors frequently make new signatures available, so antivirus software will be most effective if the signatures are up to date Many antivirus and antispyware programs offer automatic ... automatic updating Enable that feature so your software always has the most current signatures If automatic updates aren’t offered, be sure to install the software from a reputable source, like the vendor’s ... sure to research these features before disabling or modifying them The AutoRun feature in Microsoft Windows systems was a default feature at the time of the Conficker malware and was one of the...

Ngày tải lên: 14/03/2014, 22:20

... existing data management offices and databases that could support ocean acidification observational and research data The FOARAM Act also calls for an “Ocean Acidification Information Exchange” that ... surface waters has already been observed in the Canada Basin of the Arctic Ocean (Bates et al., 2009; Yamamoto-Kawai et al., 2009) Persistent undersaturation of surface waters with respect to aragonite ... eventually, over thousands of years, changes in CaCO3 cycling will neutralize most of the excess acidity and restore the pH of the ocean to near-present day value Natural glacial-interglacial changes...

Ngày tải lên: 15/03/2014, 15:20

... Scientific Software Development GmBH, Berlin, Germany), a qualitative data management software [58], will be used to manage and analyze all qualitative data Quantitative analysis All tests will ... dominant language (e.g., Spanish) to reduce language barriers and drafting all patient educational materials at the appropriate reading level (e.g., fourth grade) to enhance health literacy Surface ... Scale [77], a 24-item self-report measure that uses separate four-point scales to tap acculturation-related changes in two languages Barriers to medical care: a list of 11 common factors that...

Ngày tải lên: 10/08/2014, 11:20

... with footwear being a major cause of traumatic ulcers [8] Lack of awareness of risk factors associated with diabetic foot ulcer by health care professionals and patients adds to unnecessary morbidity ... and Management of Diabetes in Canada [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management ... managerial involvement, commitment and attitude toward change, role clarity, and leadership styles are significantly associated with maintaining the momentum of innovation adoption in organizations...

Ngày tải lên: 11/08/2014, 05:21

... with footwear being a major cause of traumatic ulcers [8] Lack of awareness of risk factors associated with diabetic foot ulcer by health care professionals and patients adds to unnecessary morbidity ... and Management of Diabetes in Canada [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management ... managerial involvement, commitment and attitude toward change, role clarity, and leadership styles are significantly associated with maintaining the momentum of innovation adoption in organizations...

Ngày tải lên: 11/08/2014, 16:21

... HOW TO TELL THE SEX OF A BIRD THIS IS AMAZING !!! Until now I never fully understood how to tell the difference between Male and Female birds I always thought it had to be determined surgically ... now Below are two birds Study them closely See if you can spot which of the two is the Female It can be done Even by one with limited bird watching skills…! Send this to all of the men you ... watching skills…! Send this to all of the men you know, who could with a good laugh, and to all women who have a great sense of humor !!! Collection by FGMLGMU 06/03/2011 ...

Ngày tải lên: 22/10/2014, 20:00

... but also generalisable to other healthcare settings The use of a theoretical framework to underpin the diagnostic analysis has resulted in the collection of a far broader range of data than if a ... Christian S: Achieving change in health care practice Journal of Evaluation in Clinical Practice 2003, 9:225-238 Armenakis A, Bedeian A: Organizational change: a review of theory and research in the ... opinion leaders : effects on professional practice and health care outcomes The Cochrane Database of Systematic Reviews 2005:4 Armenakis AA, Bedeian AG: Organizational change: a review of theory and...

Ngày tải lên: 11/08/2014, 05:22

... increase the competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand ... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its ... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together...

Ngày tải lên: 24/09/2012, 17:19

... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also worked as a Professor and Head of department in the Department of Mechanical Engineering,...

Ngày tải lên: 05/09/2013, 16:11

... situations It was found that the frequency of the use of the speech act of refusal by the Australian NSs of English was different from that by the VLEs Although the VLEs and the Australian NSs of ... Beebe et al (1987), more advanced learners are more affected by the refusal strategies of their native language, whereas the native language of the learners in Yagamashira’s study had more influence ... shift their refusal strategies noticeably according to the status of the interlocutors The above review of the related literature of the speech act of refusal shows that the use of refusal strategies...

Ngày tải lên: 07/09/2013, 13:31

... can be measured via these same factors, even if the individual case is a strategy for which new tools are used The analysis revealed that one of the essential organizational factors, because of ... with their work The results are valued on a Likert scale of to for the different items Over the last few years, the average satisfaction index—calculated as the average of the values given to each ... leadership, and the adoption of a radical change model First, Irizar’s strategy was oriented towards To know, serve and add value for the customer’ For adaptation to the customer’s requirements, the...

Ngày tải lên: 24/01/2014, 00:20

... from the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the ... Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and ... = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection of rows in the...

Ngày tải lên: 26/01/2014, 10:20

... was improved by con˚ sidering only pairs of Ca atoms < 2.5 A apart Because of the different length of a helix A, the Ca atoms N-terminal to or inside helix A are separated by large distances The ... more rapid turnover The kcat ⁄ Km values increase from G1P over PhyK to AppA by a factor of  2200 The conformational changes of AppA upon substrate binding facilitate a faster turnover of phytate ... Approximately 70% of the model was built automatically After extending the Mse data to a resolution of ˚ 2.04 A, resolve built 76% of the protein model automatically The Mse–PhyK structure was...

Ngày tải lên: 16/02/2014, 09:20

... we can easily see that the total life-years for a given age-group and year has exactly the same value as the size of the mid-year population If both are calculated from exact dates of death, ... of the population at the start of 2000; but the temporal pattern of the deaths depends will differ if the hazards are changed, and the total number of life years will change Thus one way to quantify ... each diagonal From this we calculate the number of deaths and the total life-years in each cell, as in Table We can this separately for each of the sexes These calculations are designed to quantify...

Ngày tải lên: 17/02/2014, 11:20

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...

Ngày tải lên: 19/02/2014, 17:20

... that a SAM is meant to fit into the existing national statistical and planning infrastructure That is to say that, first, a SAM is typically built on the basis of data which are already available ... consider the totals (e.g from the national accounts) as sacrosanct and break these down Since national accounts have to become available soon after the end of the year to which they refer, they are ... accounts totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative...

Ngày tải lên: 06/03/2014, 21:20

... an artifact, it is apparently strong enough to appear in the crystal and adjust the enzyme in an induced-fit-like manner: the conformation of the flap domain changes, M3 metal is introduced and Arg13 ... stalled at R-factors of 26 and 30% This may be due to real disorder in the crystal as the mean B-factor from the refinement was rather high ˚ ˚ (78.5 A2 ) – as was the Wilson B-factor (77 A2 ) It should ... Fcalc|)/( |Fobs|), where Fobs and Fcalc are observed and calculated structure factor amplitudes, respectively Rfree is an R-factor for an unrefined subset of the data (5% of the data) a the metal...

Ngày tải lên: 07/03/2014, 09:20

... The IOF Allocator as Part of a Suite of Analytical Tools xii Internetting of Fires Is the Dynamic Pooling of Resources Enabled by C4ISR The IOF Allocator as Part of the WMT Suite of Analytical ... brought into a variety of programs for analysis The details and full description of the mathematical model at the heart of the IOF Allocator and its implementation are included in Appendixes A and ... preventing the shooters from attacking dead targets (which also may lead to an overestimation of the damage to targeted systems) This too was not a limitation to the IOF Allocator but rather of the...

Ngày tải lên: 23/03/2014, 02:20