• work with a partner read the dialogues

Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

Ngày tải lên : 18/03/2014, 01:20
... In all cases, the optimal amount of arachidonic acid was determined and used to analyze the effect of S10 0A8 /A9 on oxidase activation After an incubation of 10 at 20 °C, the oxidase activity was ... from Amersham Protein concentration was assayed with the bicinchonic acid reagent (BCA) (Bio-Rad) using bovine serum albumin as standard Arachidonic acid was dissolved in ethanol and stored as a ... and S10 0A9 appeared to be the two major proteins (insert a, Fig 2C) Separate immunodot blots carried out with anti Rac1 and anti Rac2 antibodies revealed that more than 90% of Rac was the Rac2 isoform,...
  • 10
  • 396
  • 0
Báo cáo hóa học: "Research Article Harnack Inequality for the Schrödinger Problem Relative to Strongly Local Riemannian p-Homogeneous Forms with a Potential in the Kato Class" potx

Báo cáo hóa học: "Research Article Harnack Inequality for the Schrödinger Problem Relative to Strongly Local Riemannian p-Homogeneous Forms with a Potential in the Kato Class" potx

Ngày tải lên : 22/06/2014, 22:20
... Milano, Piazza Leonardo Da Vinci 32, Italy; Accademia Nazionale delle Scienze detta dei XL, Via L Spallanzani 7, Italy Email address: marbir@mate.polimi.it Silvana Marchi: Dipartimento di Matematica, ... Riemannian p-homogeneous forms; we define a suitable notion of Kato class of measures We assume that the potential is a measure in the Kato class and we prove a Harnack inequality (on balls that are ... Biroli and S Marchi 19 [9] J Mal´ and W P Ziemer, Fine Regularity of Solutions of Elliptic Partial Differential Equations, y vol 51 of Mathematical Surveys and Monographs, American Mathematical Society,...
  • 19
  • 326
  • 0
The Project Gutenberg eBook, American Addresses, with a Lecture on the Study of Biology, by Thomas potx

The Project Gutenberg eBook, American Addresses, with a Lecture on the Study of Biology, by Thomas potx

Ngày tải lên : 28/06/2014, 19:20
... day was signalised by the apparition of the sun, the stars, the moon, and the planets; that, on the fifth day, aquatic animals originated within the waters; that, on the sixth day, the earth gave ... actuated by malice It has constantly happened that even an accurate man has declared that a thing has happened in this, that, or the other way, when a careful analysis of the circumstantial evidence ... that these operations of degradation and elevation might compensate each other; and that thus, for any assignable time, the general features of our planet might remain what they are And inasmuch...
  • 330
  • 324
  • 0
A Woman with a mass in the liver pot

A Woman with a mass in the liver pot

Ngày tải lên : 13/07/2014, 20:20
... carcinoma chạy tới gan, ch a dùng chemotherapy agents mà thường dùng cho ch a ung thư thấy phổi, tức dùng combination Carboplatin etoposide "first line" - Kinh nghiệm "small cell cancer of the ... hợp : CAT scan PET scan phổi normal (không thấy ung thư), ung thư từ đâu ra? Bởi draining từ portal system, bắt buộc phải tìm ruột già (colon) case này, làm colonoscopy thấy large cecal mass Biopsy ... differentiated: carcinoid tumor hay pancreatic endocrine tumor (b) poorly differentiated có lẽ từ phổi (small cell cancer) Case khó chỗ: (1) tìm poorly diff neuroendocrine carcinoma, tức thuộc small cell...
  • 4
  • 249
  • 0
Báo cáo y học: "Characterization of an H3N2 triple reassortant influenza virus with a mutation at the receptor binding domain (D190A) that occurred upon virus transmission from turkeys to pigs" potx

Báo cáo y học: "Characterization of an H3N2 triple reassortant influenza virus with a mutation at the receptor binding domain (D190A) that occurred upon virus transmission from turkeys to pigs" potx

Ngày tải lên : 12/08/2014, 01:22
... Both amino acids are negatively charged, while Ala is a neutral amino acid We assume that Ala at the corresponding position (Figure 1) might not affect the configuration, but rather the charge at ... primary tracheal/bronchial epithelial cells Parental virus has Asp at residue 190 of the RBD, while the mutant virus has Ala at the corresponding position A strain with Glu627Lys mutation in the PB2 ... antisera reacted equally to both 190Asp and 190Ala viruses On the other hand, anti-190Ala antisera exhibited 4-8 folds less reactivity to the heterologous parental-190Asp virus To further evaluate...
  • 7
  • 512
  • 0
Unit 3: A trip to the countryside ( Read)

Unit 3: A trip to the countryside ( Read)

Ngày tải lên : 27/09/2013, 13:10
... Peter play Van likes the Parkers, and he enjoys being a of their family A Vietnamese boy named Van is living with the Parker family in the American state of Ohio Mr Parker is a farmer and ... on Saturday afternoon and they watch Peter play baseball Van likes the Parkers, and he enjoys being a member of their family ANSWER THE QUESTIONS 1.What does Van after finishing his homework? ... Parker works part-time at a grocery store in a nearby town They have two children, Peter and Sam Van often does chores after school Sometimes, he also has to help on the farm The family relaxes...
  • 10
  • 805
  • 1
UNIT 3: A TRIP TO THE COUNTRYSIDELesson 3: Read. P25

UNIT 3: A TRIP TO THE COUNTRYSIDE Lesson 3: Read. P25

Ngày tải lên : 10/10/2013, 05:11
... he also ……… on the farm The (5) helps family relaxes on Saturday(6) afternoons watches and Peter play baseball Van likes theenjoys he(8) ………… being (7)Parkers, and member a of their family ... Reading * The text P25 * Answer key: *** Answers: How long will Van stay in Parker family? He will stay there till the beginning of October What Mr and Mrs Parker do? Mr Parker is a farmer and ... food to eat part - time d corn collect e shorter or less than standard time V/ Comple ting the s ummary A Vietnamese boy .…… Van is living with the (1) named Parker family in the American state of...
  • 17
  • 889
  • 3
Tài liệu Work with the XML Document Object Model pdf

Tài liệu Work with the XML Document Object Model pdf

Ngày tải lên : 21/01/2014, 12:20
... dcLastName.ColumnName = "LastName" dcLastName.Caption = "Last Name" mdtData.Columns.Add(dcLastName) Session("MyDataTable") = mdtData Else mdtData = CType(Session("MyDataTable"), DataTable) End If BindTheGrid() ... then adding them to the data table The DataTable object is then saved to the Session object with the name MyDataTable If the Session object entry already exists, it is reassigned to the module variable ... mdtData data table, thus creating a new DataRow object The two columns in drNew are replaced with the values in txtLastName and txtFirstName The new row is added to the data table, and the text...
  • 7
  • 419
  • 0
It’s Not You, It’s Your Strategy: The HIAPy Guide to Finding Work in a Tough Job Market

It’s Not You, It’s Your Strategy: The HIAPy Guide to Finding Work in a Tough Job Market

Ngày tải lên : 09/02/2014, 20:53
... talk more about that Whereas in Part I, I wrote a lot about your reasonable fears as a job applicant, now let’s talk about the hirer’s reasonable fear of making a bad hire, which can be a catastrophic ... one as quickly and easily as possible so they can get back to all their other work 2) Additionally, many hirers are taught that it’s important to treat every candidate exactly the same way, as a ... hip (The New York Times recently reported that, “more than five million Americans who are 44 to 70 are already engaged in a stage of work after their first careers that has a social impact, mainly...
  • 48
  • 560
  • 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

Ngày tải lên : 18/02/2014, 04:20
... GAL4-GRASP55 revealed that, apart from the VP16-MT1 FFR (Fig 5A, lane 3) and VP16-MT1 DKV mutants (Fig 5A, lane 9), all the other triple mutants (Fig 5A, lanes 4–8) displayed a marked and significant ... transfected with pCDNA3.1 Zeo+ and MT1/MYC (lane 2), pCDNA3.1 Zeo+ and GRASP55F (lane 3) and MT1/MYC and GRASP55F (lane 4) were immunoprecipitated with the FLAG M2 monoclonal antibody and the associated ... decrease of protease activity at the cell surface Our data also revealed that intracellular furin levels are critical for the efficient activation of MT1-MMP The results obtained suggest that GRASP55...
  • 18
  • 603
  • 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Ngày tải lên : 20/02/2014, 02:21
... Medical Research Council of Australia, the Australian Research Council, the National Heart Foundation of Australia (to RNP and AMB), Research Grants HL-06350 and HL-32656 from the National Institutes ... affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin – Heparin Heparin ⁄ calcium 4 2 4 1 3 Factor Xa HCII ... and the rates of interaction in the presence and absence of heparin pentasaccharide (Table 1), one can calculate that the half-life of enzyme activity in the absence of heparin pentasaccharide would...
  • 10
  • 668
  • 0
The World with a Thousand Moons pdf

The World with a Thousand Moons pdf

Ngày tải lên : 06/03/2014, 00:20
... elements He made up this formula, and tried it on a gravitation-paralysis case a space-man who's lain paralyzed for years The formula was designed to strengthen the human nervous system against the shock ... varying gravitations, to re-establish an already damaged nerve-web And it worked." Kenniston's voice was husky as he concluded "It worked, and that living log became a man again The formula was ... escort of armed pirates guarding them, and Dark and Holk Or ahead, they started through the jungle toward the pirate camp 38 Chapter Asteroid Horror T he pirate encampment was a big clearing hacked...
  • 52
  • 408
  • 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Ngày tải lên : 06/03/2014, 01:20
... primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG ... et al sequence verified and named pAff8eGFPLacUV5 and pAff8eGFPTrc, respectively The gene for the T7 promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and ... this leakage, the analyzed differences in mRNA levels most probably are a slight misrepresentation of the total mRNA levels within the cell at harvest One reason for the spread in the amount...
  • 11
  • 445
  • 0
Đề tài " The distribution of integers with a divisor in a given interval " ppt

Đề tài " The distribution of integers with a divisor in a given interval " ppt

Ngày tải lên : 06/03/2014, 08:21
... (7.2) write a = a1 a2 with pβ , a1 = pβ a, β≥2 so that (a1 , a2 ) = and a2 is square-free By Lemma 3.1, L (a; σ) ≤ τ (a1 )L (a2 ; σ) ≤ στ (a1 )τ (a2 ) (7.6) Also (7.7) a1 τ (a1 ) a1 >w −3/4 a1 w−1/4 ... constant support and many helpful conversations about the paper Much of this paper was written while the author enjoyed the hospitality of the Institute of Mathematics and Informatics, Bulgarian Academy ... to lie all above their expected values An analogy from probability theory is to ask for the likelihood that a random walk on the real numbers, with each step haveing zero expectation, stays completely...
  • 68
  • 409
  • 0
Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx

Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx

Ngày tải lên : 07/03/2014, 16:20
... aaagtgaagtcc-3¢ and 5¢-attattggatccctattgctggtccgattctgccag-3¢ 3-TPR NlpI primers (residues 62–197) were 5¢-aataatccatgg gggcacagcttttatatgagcgcggag-3¢ and 5¢-aataatggatcctcactgttc cttatccgatttttcgaagtgc-3¢ ... chemically synthesized by the W M Keck Core Facility (Yale University, New Haven, CT, USA) Primers to amplify mature NlpI (residues 20–294) were 5¢-aataatccatggggagtaatacttcctggcgta aaagtgaagtcc-3¢ ... beam time Anomalous data was nevertheless complete for the remote wavelength ˚ ˚ (Table 1) Data from 30 A to 2.0 A were indexed and scaled with the hkl2000 software package [37] (Table 1) The...
  • 14
  • 433
  • 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Ngày tải lên : 07/03/2014, 17:20
... sulfate X-ray diffraction data of the wt and M100K crystals were collected on an in-house beam using a MAR345 Image Plate detector The crystals were mounted in a capillary and datasets at 295 K and ... considerably longer than the above and suggesting a weaker interaction with the positive charge on the heme-iron It could be speculated that wat3, adjacent to the M100 ˚ ligand at a distance of 6.0 A ... data collection and refinement are summarized in Table The program procheck [34] was used to analyse conformational variations from the defined norms, with the quality of the Ramachandran plots [35]...
  • 15
  • 509
  • 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Ngày tải lên : 08/03/2014, 09:20
... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the ... CNP-modified maltooligosaccharide substrates [8] and the open bars depict the subsite map with linear maltooligosaccharides [9] The apparent binding energies were calculated according to the data of Table...
  • 6
  • 387
  • 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Ngày tải lên : 08/03/2014, 09:20
... of a fluorinated alcohol, hexafluoroisopropanol (HFIP) HFIP has been chosen as a result of a vast exploratory search because it can dissolve Ab-(1–42) better than all other media and, at the same ... can solvate apolar surfaces with its strongly hydrophobic side chains; this feature has been aptly described by Rajan et al as a Teflon coating that can surround a helix [16] in the case of a ... ellipticity increases with the water concentration, reaching a plateau at approximately 20% water Correspondingly, the helix content, as estimated by standard linear combination fits of the spectra [21],...
  • 7
  • 624
  • 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

Ngày tải lên : 08/03/2014, 16:20
... environmental factors such as UV radiation and physiological stress such as starvation may affect this supraorganization are also presented MATERIALS AND METHODS Chemicals Reagent-grade phosphoric acid, ... of the amino-acid sequence The m/z values for the ions have the general form [M + zH]/z, where z equals the number of protons attached It follows that the molecular mass can be readily calculated ... allowed a quantitative estimation of the relative amount of each protein component from the area underlying each peak This was facilitated by the fact that the biliproteins are strongly conserved and...
  • 9
  • 477
  • 0