• family and medical leave act fml a

Institutional Inequality and the Mobilization of the Family and Medical Leave Act ppt

Institutional Inequality and the Mobilization of the Family and Medical Leave Act ppt

... This page intentionally left blank Institutional Inequality and the Mobilization of the Family and Medical Leave Act How the rights created by the Family and Medical Leave Act operate in practice ... Persons and Things Edited by Alain Pottage and Martha Mundy Continued after Index Institutional Inequality and the Mobilization of the Family and Medical Leave Act Rights on Leave Catherine R Albiston ... rights to family and medical leave Some empirical research indicates that the FMLA has significantly increased unpaid leave coverage for American workers (Han & Waldfogel 2003; Waldfogel 199 9a, 2001),...

Ngày tải lên: 30/03/2014, 09:20

313 543 0
the essential guide to family and medical leave (2007)

the essential guide to family and medical leave (2007)

... year are eligible for FMLA leave Eligible employees are entitled to 12 weeks of unpaid leave FMLA leave is job-protected leave FMLA leave is available for certain family and medical reasons ... leave T he Family and Medical Leave Act (FMLA) is a law with an undeniably noble purpose: to help employees balance the demands of work with personal and family health needs Since the FMLA was ... to take pregnancy disability leave, parental leave, or other types of family and medical leave If the employee takes leave for a reason that’s covered by both state law and the FMLA, you can count...

Ngày tải lên: 18/04/2014, 14:12

453 443 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"

Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"

... will also impact provider perceptions and interprofessional relationships (5) Best practices and standardization of care Participants reported that standardizing care within professions may facilitate ... may also be standardized, and that 'best practices' for coordinating musculoskeletal chest pain care would center on the role of primary medical practitioners rather than specialist medical practitioners ... dialogue suggested several implications for current and future chiropractic practice, undergraduate and post-professional chiropractic education and clinical training, research, and professional...

Ngày tải lên: 25/10/2012, 10:06

10 789 0
Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

... board European aircraft Materials and methods This study originates from the surgical department of an academic teaching hospital (Department of General and Visceral Surgery, Augusta Krankenanstalt, ... registered commercial aircraft with more than one flight attendant or 12 seats to carry an automatic external defibrillator (AED) Although most large national European national airlines carry AEDs, some ... Braunschweig, Germany) and the European Joint Aviation Authorities (JAA; Cologne, Germany) regulate aviation on the national and continental level They regulate by law the contents of an on-board...

Ngày tải lên: 25/10/2012, 10:31

6 640 0
Báo cáo y học: "Lifetime health effects and medical costs of integrated stroke services - a non-randomized controlled cluster-trial based life table approach"

Báo cáo y học: "Lifetime health effects and medical costs of integrated stroke services - a non-randomized controlled cluster-trial based life table approach"

... population Disability-stratified stroke life-table A life-table approach was applied to extrapolate the trial findings and to arrive at estimates of lifetime health benefits and costs per patient ... home-based and ambulatory health care cost (through professional support and increased revalidation efforts) It might be that the service set-up leads to additional cost of informal care and patients ... similarity with national stroke statistics in terms of age, length of hospital stay, casefatality, functional status at discharge, and destination after discharge The research populations compare well...

Ngày tải lên: 25/10/2012, 10:35

10 569 0
Báo cáo y học: "Special considerations in the treatment of patients with bipolar disorder and medical co-morbidities"

Báo cáo y học: "Special considerations in the treatment of patients with bipolar disorder and medical co-morbidities"

... complications when taken with antiplatelet agents, warfarin or niacin Carbamazepine acts as an inducer of cytochrome 3A4 , which may increase the metabolism of some anticoagulant and cardiovascular ... olanzapine for the relief of nausea in patients with advanced cancer and pain J Pain Symptom Manage 2002, 23:526-532 Khojainova N, Santiago-Palma J, Kornick C, Breitbart W, Gonzales GR: Olanzapine ... flattening/inversion; rare 1st degree AV block & aggravation of ventricular arrhythmias Sinoatrial block; AV block/dissociation bradyarrhythmias; ventricular tachycardia/fibrillation Unlikely May exacerbate symptoms...

Ngày tải lên: 25/10/2012, 10:51

10 710 0
Data mining and medical knowledge management   cases and applications

Data mining and medical knowledge management cases and applications

... registered trademark Library of Congress Cataloging-in-Publication Data Data mining and medical knowledge management : cases and applications / Petr Berka, Jan Rauch, and Djamel Abdelkader Zighed, ... from medical transaction databases The availability of a formal ontology allows the ranking of association rules by clarifying what are the rules confirming available medical knowledge, what are ... theory and practice of handling data receives, we can say that a new field is being born, called data engineering One of the essential notions of data engineering is metadata It is “data about data”,...

Ngày tải lên: 16/08/2013, 16:24

465 632 2
Tài liệu CANCER AND MEDICAL CANNABIS doc

Tài liệu CANCER AND MEDICAL CANNABIS doc

... American Academy of Family Physicians American Medical Student Association American Nurses Association American Preventive Medical Association American Public Health Association American Society ... growing and/ or possessing medical cannabis are in place in Alaska, Arizona, California, Colorado, Hawaii, Maine, Montana, Nevada, New Jersey, New Mexico, Oregon, Rhode Island, Vermont, Washington, and ... Parallel-Group Study of the Efficicay, Safety, and Tolerability of THC:CBD Extract and THC Extract in Patients with Intractable Cancer Related pain J of Pain and Symptom Management 23 Sarfaraz...

Ngày tải lên: 15/02/2014, 04:20

28 386 0
Tài liệu The Bankruptcy Abuse Prevention and Consumer Protection Act of 2005 pdf

Tài liệu The Bankruptcy Abuse Prevention and Consumer Protection Act of 2005 pdf

... IRS uses as caps on actual expenses In other words, for transportation and housing, the taxpayer may deduct only his or her actual and reasonable expenses and is limited to the local standards even ... Beighley and Amelia Haviland designed and conducted the empirical analyses of the data extracted from the bankruptcy case samples Comments by our reviewers, Elaine Reardon of RAND and Katherine Porter ... Central District of California (C.D Cal.) District of Utah (D Utah) Middle District of Florida (M.D Fla.) Los Angeles, Riverside, Santa Ana, Woodland Hills Salt Lake City Orlando and Tampa The Bankruptcy...

Ngày tải lên: 18/02/2014, 02:20

68 403 0
Tài liệu Báo cáo khoa học: The heat shock factor family and adaptation to proteotoxic stress pdf

Tài liệu Báo cáo khoa học: The heat shock factor family and adaptation to proteotoxic stress pdf

... Takaki E, Fujimoto M, Sugahara K, Nakahari T, Yonemura S, Tanaka Y, Hayashida N, Inouye S, Takemoto T, Yamashita H et al (2006) Maintenance of olfactory neurogenesis requires HSF1, a major heat ... human heat shock factor family which lacks properties of a transcriptional activator Mol Cell Biol 17, 469–481 Tanabe M, Sasai N, Nagata K, Liu XD, Liu PC, Thiele DJ & Nakai A (1999) The mammalian ... Fujimoto M, Nakahari T, Yonemura S, Miyata Y, Hayashida N, Yamamoto K, Vallee RB, Mikuriya T, Sugahara K et al (2007) Heat shock transcription factor is required for maintenance of ciliary beating in...

Ngày tải lên: 18/02/2014, 04:20

14 688 0
Tài liệu Báo cáo khoa học: The miRNA-192 ⁄194 cluster regulates the Period gene family and the circadian clock doc

Tài liệu Báo cáo khoa học: The miRNA-192 ⁄194 cluster regulates the Period gene family and the circadian clock doc

... TACCCTTTCCAAGACGAAAACAACAGACAGACCTT TTTAAGTCCTGGACTT, GAGCCCCAAACCTTAGCCT CATTTATTTTGTTCAAAACAATAAGTCATTTTCCCC TTAGAGTGCTTGAAGAA and CATGAATGTTACCC AAAAAGCTGTGTTTTCTTTGGTCAGCAAAACAAAT TTATGAAAAACAAAATGCTGTATGAATGGAAATCA ... TTTTGTATTAAAAAAGTAGGGATCCACACAAATAT CAAAAACACAA The two mutations in Luc-Per23¢UTR-Mut were established using the following primers: GGTAGCAGTCTGCATTCTTATGGCCATTAGAAAAA CAAAACTCCTTGCCTCTAAAGTCAGATCATGAA and GCCTCTGCCAGTGTCCCCAGCACTTTTCAAAACTTT ... ATTCTGGGACCATCTCC; Per1 rev, AGATCTGGCGT TTTTATCTTTTTGTATT; Per2 forw, GAATTCTTAAC AGCCAGCGAGGTACACCAGGTGG; Per2 rev, GGA TCCGGCAAACAGGTCATAAAAAGACAC; Per3 forw, GAATTCTTAAGTGACTGTGAGGATGAACCTTC;...

Ngày tải lên: 18/02/2014, 06:20

9 481 0
Family and Friends 5 Testing and Evaluation

Family and Friends 5 Testing and Evaluation

... ordinary and wore T-shirts and jeans The boy took me to a room with a small machine in it It was a bit like a car and a bit like a plane We got on and flew into space! We landed on a strange planet ... on Monday Mandy Mandy Mandy S Mandy Mandy Mandy PHOTOCOPIABLE a guitar lesson on Tuesday to the hairdresser on Wednesday tennis on Thursday tennis on Friday a guitar lesson on Saturday Cathy on ... lights stage roller character The special clothes the actors wear in a play costume The words of a play that the characters say The place at theJront of the theatre where actors perform a play A person...

Ngày tải lên: 26/02/2014, 13:08

35 18,1K 206
As Required by Section 939(h) of the Dodd-Frank Wall Street Reform and Consumer Protection Act ppt

As Required by Section 939(h) of the Dodd-Frank Wall Street Reform and Consumer Protection Act ppt

... EJR Fitch JCR KBRA Moody’s Morningstar S&P Aaa AAA AAA AAA AAA AAA Aaa AAA AAA Aa AA AA AA AA AA Aa AA AA A A A A A A A A A Bbb BBB BBB BBB BBB BBB Baa BBB BBB Bb BB BB BB BB BB Ba BB BB B B B B ... example, AA+, AA, and AA- would be three gradations within the AA category with AA+ being the highest gradation and AA- being the lowest gradation in terms of relative creditworthiness If a rating ... rating scale has gradations within a category, the category and each gradation would constitute a “notch” in the rating scale For example, the symbols AA+, AA, and AA- would each represent a notch...

Ngày tải lên: 06/03/2014, 08:20

60 477 0
HIPAA Privacy Rule Accounting of Disclosures Under the Health Information Technology for Economic and Clinical Health Act potx

HIPAA Privacy Rule Accounting of Disclosures Under the Health Information Technology for Economic and Clinical Health Act potx

... readily capable of providing the date and time of access and the user name, and in many cases can also provide information about what information was accessed and the user’s action (such as create, ... report in a readable hard copy form For purposes of this paragraph, machine readable data is digital information stored in a standard format enabling the information to be processed and analyzed by ... generates from the access log in a format that is understandable to the individual We note that an access log also may commonly be referred to as an ‘‘audit trail’’ or ‘‘audit log’’ and an access...

Ngày tải lên: 06/03/2014, 15:20

25 592 0
w