• early days at apple

FOUNDERS AT WORK STORIES OF STARTUPS’ EARLY DAYS

FOUNDERS AT WORK STORIES OF STARTUPS’ EARLY DAYS

Ngày tải lên : 05/01/2014, 15:30
... was that, if I know what I want for the end result—in those days it was a computer, in later days it might be a certain floppy disk that had to read and write some data—but if I knew what my ... Congress Cataloging-in-Publication Data Livingston, Jessica Founders at work : stories of startups’ early days / Jessica Livingston p cm ISBN 1-59059-714-1 New business enterprises United States Case ... seeing what startups are really like will at least show other organizations what to aim for The time may soon be coming when instead of startups trying to seem more corporate, corporations will...
  • 472
  • 374
  • 0
Early Days in North Queensland docx

Early Days in North Queensland docx

Ngày tải lên : 31/03/2014, 18:20
... etc., by water to the depôt at the head of navigation The cost of the exploration was estimated at about £1,000, to meet which it was proposed to raise that sum by subscription; unless that amount ... those days on Natal Downs, and were in the habit of cutting off the shepherds at outstations; it was reported and believed that as many as eighteen shepherds were killed at various outstations ... first scene of their death at the hands of the natives Nearly three hundred years ago, in the Gulf of Carpentaria, a boat's crew belonging to the "Duyfken," one of the early Dutch vessels exploring...
  • 111
  • 202
  • 0
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_1 pdf

The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_1 pdf

Ngày tải lên : 21/06/2014, 12:20
... minor that complements your path, whether that’s finance, marketing, computer science, or one of several other career majors A minor is also a great place to prove that you’re quantitative A minor ... information on our other products and services or for technical support, please contact our Customer Care Department within the United States at (800) 762-2974, outside the United States at (317) ... electronic formats Some content that appears in print may not be available in electronic books For more information about Wiley products, visit our web site at www.wiley.com Library of Congress Cataloging-in-Publication...
  • 29
  • 514
  • 0
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_2 docx

The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_2 docx

Ngày tải lên : 21/06/2014, 12:20
... feedback At that point, your manager may be so overwhelmed that she writes your feedback hastily, at best Asking for feedback early and frequently will demonstrate maturity, while also ensuring that ... earlier Some candidates walk up with their elevator pitch all prepared: here’s who I am, here’s what I’ve done, here’s what I’m good at, and here’s what I’d like to Other candidates walk up, hand ... the United States Period We’re like vultures fighting over what little there is to eat.” (Apple employee) “We’re always hiring great talent Always.” (Google employee) “It’s not that we don’t get...
  • 29
  • 374
  • 0
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_4 doc

The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_4 doc

Ngày tải lên : 21/06/2014, 12:20
... [Desired Qualification qualification #2] [Desired Qualification qualification #3] [Desired Qualification qualification #4] #1]: [Proof that you have #2]: [Proof that you have #3]: [Proof that you have ... integration with OS X Spotlight Search by creating tool that extracts metadata from saved video transcripts and provides metadata to a system-wide search database ■ Redesigned video file format and ... interface ■ Designed and created MySQL database and also wrote PHP script to populate the database with test data ■ Built Restful API, which allows our IPHONE application to interact with the...
  • 29
  • 359
  • 0
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_5 pptx

The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_5 pptx

Ngày tải lên : 21/06/2014, 12:20
... Passion, creativity, initiative, intelligence, and a “getting things done” attitude are all signals of that How to Prepare For at least the less technical aspects of an interview, preparation comes ... want to know that you’re excited about the job They hate having a candidate reject their offer almost as much as candidates hate getting rejected Moreover, enthusiastic candidates are more likely ... the conversation in a way that’s positive for both you and your interviewer, rather than drown her in details Alternatively, you can be more direct and say: “I can elaborate on that if you’d...
  • 29
  • 396
  • 0
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_6 ppt

The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_6 ppt

Ngày tải lên : 21/06/2014, 12:20
... that 25 percent of the United States population graduates college, so that makes one million college graduates each year Number of computer science majors Now, what percent of college graduates ... stated in many alternative or related ways: “What skills you think you bring?,” “What you see your role here being?,” and so on Your response to this question should focus on a few core (related) ... SAR (Situation, Action, Result) is an effective way to structure responses to behavioral and other questions in a way that clearly explains what the problem was, what you did, and what the result...
  • 29
  • 413
  • 0
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_7 pdf

The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_7 pdf

Ngày tải lên : 21/06/2014, 12:20
... trade-offs? If they gave you specific data (e.g., mentioned that the data is ages, or in sorted order), have you leveraged that information? There’s probably a reason that you’re given it Step 3: Pseudo-Code ... generate all permutations of a string by “chopping off ” the last character and generating all permutations of s[1 n-1] Then, insert s[n] into every location of the string Approach 5: Data ... make sure that it fails gracefully That is, the client should at most reject the attachment, but should not permanently freeze What can be automated, and what must be manually tested? Of course,...
  • 29
  • 380
  • 0
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_8 potx

The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_8 potx

Ngày tải lên : 21/06/2014, 12:20
... teammate who can’t wait to tell you how superior he is We’ve all met the type Creative/Imaginative Even in roles that don’t require an artistic flair, employees tend to be more creative and imaginative ... companies will want to know that you are imaginative, as it’s creativity that fuels their games Work Ethic It’s nice to be able to regurgitate the old line “it doesn’t matter how many hours you work, ... know that you’re interested and committed Your job, therefore, is to give an answer that communicates both of those things Let’s look at your answer from that perspective Does it show that you’ve...
  • 29
  • 323
  • 0
The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_9 doc

The Google Resume How to Prepare for a Career and Land a Job at Apple Microsoft Google or any Top Tech Company_9 doc

Ngày tải lên : 21/06/2014, 12:20
... date—but, unfortunately, the dates aren’t flexible Is there some way to accommodate this? I’d be happy to whatever you think is best—take unpaid time off, go “negative” on vacation days, etc Thank ... complication I’ve had a three-week trip to Europe (from DATE to DATE) planned for over a year I recognize that this trip is at an inconvenient time — just six weeks after my proposed start date—but, ... your first few days In the event that the company refuses to accommodate your vacation time, you may be able to appeal to your secondary contact (if any) ~Gayle Representative Representatives Dear...
  • 29
  • 339
  • 0
How to Prepare for a Career and Land a Job at Apple_2 pptx

How to Prepare for a Career and Land a Job at Apple_2 pptx

Ngày tải lên : 21/06/2014, 23:20
... [Desired Qualification qualification #2] [Desired Qualification qualification #3] [Desired Qualification qualification #4] #1]: [Proof that you have #2]: [Proof that you have #3]: [Proof that you have ... integration with OS X Spotlight Search by creating tool that extracts metadata from saved video transcripts and provides metadata to a system-wide search database ■ Redesigned video file format and ... interface ■ Designed and created MySQL database and also wrote PHP script to populate the database with test data ■ Built Restful API, which allows our IPHONE application to interact with the...
  • 29
  • 257
  • 0
How to Prepare for a Career and Land a Job at Apple_3 doc

How to Prepare for a Career and Land a Job at Apple_3 doc

Ngày tải lên : 21/06/2014, 23:20
... Passion, creativity, initiative, intelligence, and a “getting things done” attitude are all signals of that How to Prepare For at least the less technical aspects of an interview, preparation comes ... want to know that you’re excited about the job They hate having a candidate reject their offer almost as much as candidates hate getting rejected Moreover, enthusiastic candidates are more likely ... the conversation in a way that’s positive for both you and your interviewer, rather than drown her in details Alternatively, you can be more direct and say: “I can elaborate on that if you’d...
  • 29
  • 357
  • 0
How to Prepare for a Career and Land a Job at Apple_4 pot

How to Prepare for a Career and Land a Job at Apple_4 pot

Ngày tải lên : 21/06/2014, 23:20
... that 25 percent of the United States population graduates college, so that makes one million college graduates each year Number of computer science majors Now, what percent of college graduates ... stated in many alternative or related ways: “What skills you think you bring?,” “What you see your role here being?,” and so on Your response to this question should focus on a few core (related) ... SAR (Situation, Action, Result) is an effective way to structure responses to behavioral and other questions in a way that clearly explains what the problem was, what you did, and what the result...
  • 29
  • 277
  • 0
How to Prepare for a Career and Land a Job at Apple_5 pot

How to Prepare for a Career and Land a Job at Apple_5 pot

Ngày tải lên : 21/06/2014, 23:20
... trade-offs? If they gave you specific data (e.g., mentioned that the data is ages, or in sorted order), have you leveraged that information? There’s probably a reason that you’re given it Step 3: Pseudo-Code ... generate all permutations of a string by “chopping off ” the last character and generating all permutations of s[1 n-1] Then, insert s[n] into every location of the string Approach 5: Data ... make sure that it fails gracefully That is, the client should at most reject the attachment, but should not permanently freeze What can be automated, and what must be manually tested? Of course,...
  • 29
  • 290
  • 0
How to Prepare for a Career and Land a Job at Apple_6 doc

How to Prepare for a Career and Land a Job at Apple_6 doc

Ngày tải lên : 21/06/2014, 23:20
... teammate who can’t wait to tell you how superior he is We’ve all met the type Creative/Imaginative Even in roles that don’t require an artistic flair, employees tend to be more creative and imaginative ... companies will want to know that you are imaginative, as it’s creativity that fuels their games Work Ethic It’s nice to be able to regurgitate the old line “it doesn’t matter how many hours you work, ... know that you’re interested and committed Your job, therefore, is to give an answer that communicates both of those things Let’s look at your answer from that perspective Does it show that you’ve...
  • 29
  • 240
  • 0
How to Prepare for a Career and Land a Job at Apple_7 pot

How to Prepare for a Career and Land a Job at Apple_7 pot

Ngày tải lên : 21/06/2014, 23:20
... date—but, unfortunately, the dates aren’t flexible Is there some way to accommodate this? I’d be happy to whatever you think is best—take unpaid time off, go “negative” on vacation days, etc Thank ... complication I’ve had a three-week trip to Europe (from DATE to DATE) planned for over a year I recognize that this trip is at an inconvenient time — just six weeks after my proposed start date—but, ... your first few days In the event that the company refuses to accommodate your vacation time, you may be able to appeal to your secondary contact (if any) ~Gayle Representative Representatives Dear...
  • 29
  • 213
  • 0
How to Prepare for a Career and Land a Job at Apple_8 doc

How to Prepare for a Career and Land a Job at Apple_8 doc

Ngày tải lên : 21/06/2014, 23:20
... Recruited Translated Wrote Creative Skills Acted Concentrated Conceived Created Established Fashioned Founded Generated Illustrated Instituted Integrated Introduced Invented Originated Performed ... Demonstrated Diagnosed Educated Expedited 263 Facilitated Familiarized Fixed Partnered Referred Rehabilitated Represented Management Skills Assigned Attained Chaired Contracted Consolidated Coordinated ... then gathered additional data based on their responses Then, in the presentation, I presented the new data and focused the conversation not on convincing them, but rather on understanding what would...
  • 29
  • 202
  • 0
callvins days at school

callvins days at school

Ngày tải lên : 06/12/2016, 15:10
... English and Maths I love my timetable I get up at 7:30 a.m to come to school every day I have classes at 8:30 I finish at 2.30 p.m every day It gives me time to afterschool activities like theatre I ... school (about 70 words) Refer to: the different rooms in your school (buildings/facilities) your favourite subjects your classroom your timetable * Learning strategies ... ,etc When I changed school I went to a Primary School I attended lessons in Infant Education as well as Primary Education Those years were great because we used to play and have fun with all my friends...
  • 12
  • 185
  • 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"

Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"

Ngày tải lên : 26/10/2012, 09:39
... the formation of the atherosclerotic plaque Previous study demonstrated that rats lack of Cx43 expression showed 50% lower rate of attack with atherosclerotic plaque compared with normal rats (9) ... detect the expression of Cx40 and Cx43 in the artery at early stage of high fat diet induced atherosclerosis and to investigate the effects of AT1 antagonist Losartan on the Cx43 and Cx40 expression ... with hematoxylin Western blot Protein extracts were prepared in lysis buffer and then repeatedly aspirated (20 times) through a 23-gauge needle followed by centrifugation at 4°C for 30 at 10,000...
  • 8
  • 467
  • 0
Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

Ngày tải lên : 16/03/2014, 18:20
... GAGGAGGACCACCATGCATCT TTGTGCAAGCAGTCCAGAAAGA GGATGCAGGCAATACTCCTG CCATACTGCCAAGAAAAGATGAT ACAGAGGCATACAAGTGCAGATG TGTTTAGGCTTGATCTCCAGCTT CTGGGATTCCTGACCATTGGT GTTGGCTCTCTGTTTCAATGCA GGGCAGGTGTTTTTGTGTTGA ... qACT.fw1 qACT.rv1 T7 T3 GTGCGGATCTSTTCTTCACAC CACCGTCACAGATATGTACCATATAGTC GGTGGTCTTTTGCAGAGTCATTT TTCTTTAGATACTGCTGAAGCCA AGGTCTGCATCAACCCCAAG GCATCAACCCCAAGACCAAATGG CGGGACGGTGTTGAGAGTGGA GAGAGTGGACCGGCACCAACA ... GGGCAGGTGTTTTTGTGTTGA AAGAGCGACTTGCGGGTATG CCGTGGGTGACATCGTTACA TCAGGACATTGAACCTCACTGTCT CAACAGGGAAAAGATGACACAGATC GGGACAGCACAGCCTGGAT TAATACGACTCACTATAGGG CGCAATTAACCCTCACTAAAG Vector Ó FEBS 2004...
  • 13
  • 398
  • 0