— strength design of masonry pg cc 43

control of deflection in concrete structuresstate-of-the-art report on fiber reinforced plastic (frp) reinforceme

control of deflection in concrete structuresstate-of-the-art report on fiber reinforced plastic (frp) reinforceme

... by weave type, which can be at and S-glass range 65 25 10 C-glass range 64-68 3-5 4-6 7-10 2-4 11-25 0-1 0-0.8 90 deg; at deg, +45 deg, -45 deg, and other orientations ... 440R-35 6.1 Strength of FRP prestressed concrete beams 6.2 Strength of FRP post-tensioned concrete beams Chapter 7—External reinforcement, p 440R-39 7.1 Strength of FRP post-reinforced beams 7.2—Wrapping ... 4.7—Shear design Chapter 5—Behavior of structural elements, p 440R-27 5.1 Strength of beams and slabs reinforced with FRP 5.2—Serviceability 5.3—RP tie connectors for sandwich walls Chapter 6—Prestressed...

Ngày tải lên: 24/10/2014, 17:25

68 379 0
Báo cáo y học: "Parallel evolution of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humans" doc

Báo cáo y học: "Parallel evolution of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humans" doc

... exact number of elements shared between any set of species varies depending on the precise definition of similarity and the divergence of the genomes used For example, a comparison of the human ... regulate the expression of a core set of regulatory genes The extreme sequence conservation of CNEs likely reflects the functional importance of these elements as components of the gene regulatory ... of identity with the genome of C briggsae and show no evidence of transcription We used MegaBlast (with soft masking, e-value threshold of 0.001 and with the rest of the parameters set to the...

Ngày tải lên: 14/08/2014, 17:22

14 257 0
Tài liệu ELEMENTS OF Structural and Systematic Botany doc

Tài liệu ELEMENTS OF Structural and Systematic Botany doc

... the most important topics of all the departments of botany As a thorough understanding of the structure of any organism forms the basis of all further intelligent study of the same, it has seemed ... examination is made of the structure of the different parts A special department of Morphology called “Embryology” is often recognized This embraces a study of the development of the organism from ... × 150 Very many of the lower forms of life consist of but a single cell which may occasionally be destitute of a cell wall Such a form is shown in Figure Here we have a mass of protoplasm with...

Ngày tải lên: 13/02/2014, 12:20

323 352 1
Báo cáo hóa học: " Global behavior of 1D compressible isentropic Navier-Stokes equations with a non-autonomous external force" docx

Báo cáo hóa học: " Global behavior of 1D compressible isentropic Navier-Stokes equations with a non-autonomous external force" docx

... dxds x which, by virtue of Gronwall’s inequality, (2.1) and (2.14), gives (2.19) Proof of Theorem 2.1 By Lemmas 2.1-2.3, we complete the proof of Theorem 2.1 Global existence of solutions in H2 For ... 0 ≤ C2 (T) The proof is complete Proof of Theorem 3.1 By Lemmas 3.2-3.3, Theorem 2.1 and Sobolev’s embedding theorem, we complete the proof of Theorem 3.1 Global existence of solutions in H4 ... proof of Theorem 4.1 can be divided into the following several lemmas Huang and Lian Boundary Value Problems 2011, 2011 :43 http://www.boundaryvalueproblems.com/content/2011/1 /43 Page 13 of 19...

Ngày tải lên: 20/06/2014, 22:20

19 549 0
Fundamentals of Structural Analysis Episode 1 Part 5 pdf

Fundamentals of Structural Analysis Episode 1 Part 5 pdf

... displacement of node of the loaded truss shown, given E=10 GPa, A=100 cm2 for all bars The magnitude of the pair of loads is 141.4 kN 1 2 3 4m 3@4m=12m Problem 5-2 (3) The lower chord members 1, 2, and of ... however, the displacement of node c of the primary structure due to a unit load in the direction of Rc as shown This displacement is denoted by cc , the double subscript cc signified displacent ... rotation of bar 2, we note that the –9.83 computed represents a relative vertical movement between node and node of 9.83 mm in the opposite direction of what was assumed for the pair of unit loads...

Ngày tải lên: 05/08/2014, 09:20

20 462 0
Fundamentals of Structural Analysis Episode 1 Part 5 pps

Fundamentals of Structural Analysis Episode 1 Part 5 pps

... displacement of node of the loaded truss shown, given E=10 GPa, A=100 cm2 for all bars The magnitude of the pair of loads is 141.4 kN 1 2 3 4m 3@4m=12m Problem 5-2 (3) The lower chord members 1, 2, and of ... however, the displacement of node c of the primary structure due to a unit load in the direction of Rc as shown This displacement is denoted by cc , the double subscript cc signified displacent ... rotation of bar 2, we note that the –9.83 computed represents a relative vertical movement between node and node of 9.83 mm in the opposite direction of what was assumed for the pair of unit loads...

Ngày tải lên: 05/08/2014, 09:20

20 347 0
Fundamentals of Structural Analysis Episode 2 Part 5 pptx

Fundamentals of Structural Analysis Episode 2 Part 5 pptx

... maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c b 5m 5m d 5m Problem (1) (2) Construct the influence lines of VbL and VbR of the beam shown ... maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c 5m b 5m d 5m Problem (2) (3) Construct the influence lines of VcL, VcR and Mc and Me of the beam ... line for Mc For a single load of 10 kN, we place it at the location of the peak of the influence line and we compute (Mc )max = 10 kN (2.5 kN-m/kN)=25 kN-m For the pair of loads, we place them as...

Ngày tải lên: 05/08/2014, 09:20

20 273 0
Fundamentals of Structural Analysis Episode 2 Part 5 pdf

Fundamentals of Structural Analysis Episode 2 Part 5 pdf

... maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c b 5m 5m d 5m Problem (1) (2) Construct the influence lines of VbL and VbR of the beam shown ... maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c 5m b 5m d 5m Problem (2) (3) Construct the influence lines of VcL, VcR and Mc and Me of the beam ... line for Mc For a single load of 10 kN, we place it at the location of the peak of the influence line and we compute (Mc )max = 10 kN (2.5 kN-m/kN)=25 kN-m For the pair of loads, we place them as...

Ngày tải lên: 05/08/2014, 09:20

20 433 0
Fundamentals Of Structural Analysis Episode 1 Part 5 pptx

Fundamentals Of Structural Analysis Episode 1 Part 5 pptx

... displacement of node of the loaded truss shown, given E=10 GPa, A=100 cm2 for all bars The magnitude of the pair of loads is 141.4 kN 1 2 3 4m 3@4m=12m Problem 5-2 (3) The lower chord members 1, 2, and of ... however, the displacement of node c of the primary structure due to a unit load in the direction of Rc as shown This displacement is denoted by cc , the double subscript cc signified displacent ... rotation of bar 2, we note that the –9.83 computed represents a relative vertical movement between node and node of 9.83 mm in the opposite direction of what was assumed for the pair of unit loads...

Ngày tải lên: 05/08/2014, 11:20

20 327 0
Fundamentals Of Structural Analysis Episode 2 Part 5 pot

Fundamentals Of Structural Analysis Episode 2 Part 5 pot

... maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c b 5m 5m d 5m Problem (1) (2) Construct the influence lines of VbL and VbR of the beam shown ... maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c 5m b 5m d 5m Problem (2) (3) Construct the influence lines of VcL, VcR and Mc and Me of the beam ... line for Mc For a single load of 10 kN, we place it at the location of the peak of the influence line and we compute (Mc )max = 10 kN (2.5 kN-m/kN)=25 kN-m For the pair of loads, we place them as...

Ngày tải lên: 05/08/2014, 11:20

20 265 0
the behavior of stock market prices eugene f fama the journal phần 5 pdf

the behavior of stock market prices eugene f fama the journal phần 5 pdf

... pcr ccnt = 0.98fractilt 0.02 fractile; per cent = 0.99fract1lt - fracjilc T h e fractiles arc the fractilcs of the distributions of all price changes and not of the distrlbut~ons of successors ... the distribution of successors 5.7 per cent of the observations fall outside of the per cent range, whereas by definition only per cent of the observations in the distribution of all changes are ... different types of rates of return are of interest, gross and net of any loading charges Most funds have a loading charge of about per cent on new investment That is, on a gross investment of $10,000...

Ngày tải lên: 09/08/2014, 20:20

14 300 0
The Behavior of Structures Composed of Composite Materials Part 5 pps

The Behavior of Structures Composed of Composite Materials Part 5 pps

... grow until one of four things happens: (1) The amplitude of vibration grows until the ultimate strength of a brittle material is exceeded and the structure fails (2) Portions of the structure ... with increased values of m and n, i.e., with the increased ratio of plate thickness to the wavelength of the m-nth mode of vibration One major reference on the free vibrations of rectangular isotropic ... determine the value of and only the lowest value of is of any importance usually However, it is not clear which value of m and n result in the lowest critical buckling load All values of n appear in...

Ngày tải lên: 10/08/2014, 12:21

30 211 0
Báo cáo khoa học: " Phylogenetic analysis of the non-structural (NS) gene of influenza A viruses isolated from mallards in Northern Europe in 2005" ppsx

Báo cáo khoa học: " Phylogenetic analysis of the non-structural (NS) gene of influenza A viruses isolated from mallards in Northern Europe in 2005" ppsx

... Chambers T, Palese P: Attenuation of equine influenza viruses through truncations of the NS1 protein J Virol 2005, 79: 8431 - 8439 Seo SH, Hoffmann E, Webster RG: The NS1 gene of H5N1 influenza viruses ... investigate the evolutionary stasis of the NS gene, we analyzed the nucleotide and protein sequences of NS1 and NEP of isolated viruses Each of the NS genes consisted of 890 nucleotides; there were ... comparison of nucleotide sequences of isolated viruses revealed a substantial number of silent mutations, which results in high degree of homology in protein sequences The degree of variation...

Ngày tải lên: 12/08/2014, 04:21

13 326 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 5

Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 5

... indicating a loss of neurogenesis The scale bar indicates 100 µm In the bottom panel, the efficiencies of knockdown are indicated As expected, knockdown of any of the components of the RMST complex ... the splicing of RMST into its three isoforms However, in this current study, the functions of individual isoforms are not established 8.3.2 RMST may change the binding patterns of SOX2 to chromatin ... forms part of a complex that is required for neurogenesis In this chapter, I established that RMST interacts with hnRNPA2B1, as well as SOX2, and loss of any of these three components of the RMST...

Ngày tải lên: 09/09/2015, 17:55

34 316 0
SIMULATION OF DYNAMIC BEHAVIOR OF HOVERCRAFT HULL STRUCTURAL SUBJECTED TO UNDERWATER EXPLOSION SHOCKWAVE mô PHỎNG TÍNH TOÁN THUỘC TÍNH ĐỘNG lực học của mô HÌNH tàu đệm KHÍ dưới tác ĐỘNG SÓNG sốc gây RA bởi vụ nổ dưới nước

SIMULATION OF DYNAMIC BEHAVIOR OF HOVERCRAFT HULL STRUCTURAL SUBJECTED TO UNDERWATER EXPLOSION SHOCKWAVE mô PHỎNG TÍNH TOÁN THUỘC TÍNH ĐỘNG lực học của mô HÌNH tàu đệm KHÍ dưới tác ĐỘNG SÓNG sốc gây RA bởi vụ nổ dưới nước

... the weight of the explosive charge (Kg) R: the distance between explosive charge and target (m) P(t): the pressure profile of the shock wave (MPa) P max : the peak of the pressure of the wave ... Lần thứ IV THE SPECIAL FEATURE OF ZUBR-CLASS The Zubr-class (Project 1232.2 class, NATO reporting name Pomornik [8]) is class of aircushioned landing craft of Soviet design This class is the world’s ... selected according to literature [10], as the model shown in Fig.2 The main principle and theoretical formula of acoustic-structural coupling method can refer to the theory of ABAQUS software manual...

Ngày tải lên: 08/06/2016, 14:11

8 749 4
Báo cáo y học: " Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane"

Báo cáo y học: " Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane"

... indication of techniques for the treatment of this kind of surgical complication Spontaneous healing of to mm openings can occur, while untreated larger defects are connected with the pathogenesis of ... closing of the perforation3 Many techniques have been described in order to prevent the consequences of a chronical presence of OAC, such as buccal flap, palatal rotation-advancement flap and buccal ... characteristics of OAC/OAF; the apexes of tooth 26 were in extremely close approximation to the maxillary sinus, and an area of periapical rarefaction was evident (Fig 1) After the failure of the endodontic...

Ngày tải lên: 25/10/2012, 11:48

5 573 0
The 5 lessons of startup

The 5 lessons of startup

... a growt h plan / st rat egy Of ten the idea of ‘growth’ at start-up is considered too “f ar of f ” – it really isn’t considered… wrong Growth is the very essence of business development, and ... necessary evil Why? Because what you don’t know will always hurt you Of ten start-ups head in one of two directions: either into an abyss of obsessive research [which has no start or end], or the ‘head-inthe-sand’ ... solutions and evidence – what is compelling about your of f ering? Start with ten words and whittle it down Remember: your USP should be succinct and impactf ul # Done t he number-crunching [and...

Ngày tải lên: 18/08/2013, 12:02

3 264 1
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

... were performed NIT3, CCTGTGCTCCATGCTCCG (Wagner et al., 1995), Ntspa662, GGAATTCCGCGCTCCTCT Ntspn692, TTCCCAATATCAACGCATTT, Ntspn994, CAAGGCGGTCCCAAGCAA, Ntcoc84, TCGCCAGCCACCTTTCCG, Ntcoc206, CGGTGCGAGCTTGCAAGC ... the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r GTTTGCAGCGCTTTGTACCG ( Dionishi et al., 2002) were employed for the detection of Nitrospira ... activities of nitrite oxidizing bacteria - 31 - Journal of Water and Environment Technology, Vol.5, No.1, 2007 Figure Behavior of nitrate and nitrite at the end of the aerobic tank Behavior of Nitrobacter...

Ngày tải lên: 05/09/2013, 09:38

8 572 0
w