— physical properties of steel reinforcing wire and bars

... weave type, which can be at and S-glass range 65 25 — — 10 — — — — — — — C-glass range 64-68 3-5 4-6 7-10 2-4 11-25 0-1 — — — 0-0.8 — 90 deg; at deg, +45 deg, -45 deg, and other orientations depending ... 440R-20 3.1 Physical and mechanical properties 3.2—Factors affecting mechanical properties 3.3—Gripping mechanisms 3.4—Theoretical modeling of GFRP bars 3.5—Test methods Chapter 4—Design guidelines, ... three-#4 steel bars; beam two with two-#4 FRP and one #4 steel reinforcing bar; beam three with three #4 FRP reinforcing bars, and beam four with two-#4 steel and one-#4 FRP reinforcing bars Concrete...

Ngày tải lên: 24/10/2014, 17:25

... of identity with the genome of C briggsae and show no evidence of transcription We used MegaBlast (with soft masking, e-value threshold of 0.001 and with the rest of the parameters set to the ... exact number of elements shared between any set of species varies depending on the precise definition of similarity and the divergence of the genomes used For example, a comparison of the human ... found in C elegans and C briggsae were similarly conserved in the genome of C remanei using MegaBlast, with soft masking, word seed length of 30 bp and e-value threshold 0.0001 Of the elements conserved...

Ngày tải lên: 14/08/2014, 17:22

... the limits of a book of moderate size anything like a thorough discussion of even the most important topics of all the departments of botany As a thorough understanding of the structure of any organism ... sewing needles into handles of pine or other soft wood); a hand lens; drawing-paper and pencil, and a note book For the study of the lower plants, as well as the histology of the higher ones, ... Classification of Mosses Chapter XII.—Pteridophytes 102 o o Germination and Prothallium; o  Bryophytes and Pteridophytes; Structure of Maiden-hair Fern Chapter XIII.—Classification of Pteridophytes...

Ngày tải lên: 13/02/2014, 12:20

... dxds x which, by virtue of Gronwall’s inequality, (2.1) and (2.14), gives (2.19) Proof of Theorem 2.1 By Lemmas 2.1-2.3, we complete the proof of Theorem 2.1 Global existence of solutions in H2 For ... 0 ≤ C2 (T) The proof is complete Proof of Theorem 3.1 By Lemmas 3.2-3.3, Theorem 2.1 and Sobolev’s embedding theorem, we complete the proof of Theorem 3.1 Global existence of solutions in H4 ... (4,43) and (4.53) The proof is complete Proof of Theorem 4.1 Using (1.8),Theorem 2.1, 3.1 and Lemmas 4.2-4.4 and the proper interpolation inequality, we readily get estimate (4.4)-(4.8) and complete...

Ngày tải lên: 20/06/2014, 22:20

... for all bars 1.0 kN 0.5 kN 4m 3 3m 3m Problem 5-1 (2) Find the horizontal displacement of node of the loaded truss shown, given E=10 GPa, A=100 cm2 for all bars The magnitude of the pair of loads ... rotation of bar 2, we note that the –9.83 computed represents a relative vertical movement between node and node of 9.83 mm in the opposite direction of what was assumed for the pair of unit loads ... downward Example 16 Find (a)the relative movement of nodes and in the direction joining them and (b) rotation of bar 2, given E=10 GPa, A=100 cm2 for all bars 5 6 4m 120 kN 3@4m=12m Example on finding...

Ngày tải lên: 05/08/2014, 09:20

... for all bars 1.0 kN 0.5 kN 4m 3 3m 3m Problem 5-1 (2) Find the horizontal displacement of node of the loaded truss shown, given E=10 GPa, A=100 cm2 for all bars The magnitude of the pair of loads ... rotation of bar 2, we note that the –9.83 computed represents a relative vertical movement between node and node of 9.83 mm in the opposite direction of what was assumed for the pair of unit loads ... downward Example 16 Find (a)the relative movement of nodes and in the direction joining them and (b) rotation of bar 2, given E=10 GPa, A=100 cm2 for all bars 5 6 4m 120 kN 3@4m=12m Example on finding...

Ngày tải lên: 05/08/2014, 09:20

... Construct the influence lines of Vb and Md of the beam shown and find the maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c b 5m 5m d 5m Problem ... Construct the influence lines of VbL and VbR of the beam shown and find the maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c 5m b 5m d 5m ... identical in shape to those of a simply supported beam and are shown below together with the influence lines of FIJ, FCD, and FCJ which are obtained by cut -and- paste of and applying the proper factors...

Ngày tải lên: 05/08/2014, 09:20

... Construct the influence lines of Vb and Md of the beam shown and find the maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c b 5m 5m d 5m Problem ... Construct the influence lines of VbL and VbR of the beam shown and find the maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c 5m b 5m d 5m ... identical in shape to those of a simply supported beam and are shown below together with the influence lines of FIJ, FCD, and FCJ which are obtained by cut -and- paste of and applying the proper factors...

Ngày tải lên: 05/08/2014, 09:20

... for all bars 1.0 kN 0.5 kN 4m 3 3m 3m Problem 5-1 (2) Find the horizontal displacement of node of the loaded truss shown, given E=10 GPa, A=100 cm2 for all bars The magnitude of the pair of loads ... rotation of bar 2, we note that the –9.83 computed represents a relative vertical movement between node and node of 9.83 mm in the opposite direction of what was assumed for the pair of unit loads ... downward Example 16 Find (a)the relative movement of nodes and in the direction joining them and (b) rotation of bar 2, given E=10 GPa, A=100 cm2 for all bars 5 6 4m 120 kN 3@4m=12m Example on finding...

Ngày tải lên: 05/08/2014, 11:20

... Construct the influence lines of Vb and Md of the beam shown and find the maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c b 5m 5m d 5m Problem ... Construct the influence lines of VbL and VbR of the beam shown and find the maximum value of each for a distributed load of intensity 10 kN/m and indefinite length of coverage a c 5m b 5m d 5m ... identical in shape to those of a simply supported beam and are shown below together with the influence lines of FIJ, FCD, and FCJ which are obtained by cut -and- paste of and applying the proper factors...

Ngày tải lên: 05/08/2014, 11:20

... JOURNAL OF BUSINESS ences of ten stocks Six of the stocks were chosen at random They include Allied Chemical, American Can, Eastman Kodak, Johns Manville, Standard Oil of New Jersey, and U.S Steel ... fractiles arc the fractilcs of the distributions of all price changes and not of the distrlbut~ons of successors t o large changes BEHAVIOR OF STOCK-MARKET PRICES the total number of successors to large ... different types of rates of return are of interest, gross and net of any loading charges Most funds have a loading charge of about per cent on new investment That is, on a gross investment of $10,000...

Ngày tải lên: 09/08/2014, 20:20

... determine the value of and only the lowest value of is of any importance usually However, it is not clear which value of m and n result in the lowest critical buckling load All values of n appear in ... with increased values of m and n, i.e., with the increased ratio of plate thickness to the wavelength of the m-nth mode of vibration One major reference on the free vibrations of rectangular isotropic ... mid-surface of the plate This results in the last term on the left-hand side of Equations (3.88) and (3.90) becoming and respectively, as shown below: 123 where is given by where is the mass density of...

Ngày tải lên: 10/08/2014, 12:21

... analysis of NS gene of avian influenza in its natural reservoir in Europe Our findings improve the present understanding of NS gene pool of avian influenza viruses and should help in understanding of ... μl of DMPC water, μl of 5× First Strand buffer (Invitrogen), 0.5 μl of 10 mM dNTP mix (Amersham Biosciences), μl of 50 mM random primers (pdN6), 32 U of RNAguard (Amersham Biosciences), 200 U of ... locationcoast of Sweden indicated byisland of N, The sample location at Ottenby bird Observatory (56°12' N, 16°24' E) on a major European flyway, on Baltic island of Öland at southeast coast of Sweden...

Ngày tải lên: 12/08/2014, 04:21

... efficiencies of knockdown are indicated As expected, knockdown of any of the components of the RMST complex resulted in the loss of neurogenesis, indicated by decrease in the number of TUJ1+ and MAP2+ ... Figure 8.15: Co-immunoprecipitation (Co-IP) of hnRNPA2-FLAG and SOX2 in the absence of RNA Cell lysate was treated with RNase, and the co-IP of hnRNPA2 and SOX2 indicated that the two proteins could ... Since RMST physically interacts with both hnRNPA2B1 and SOX2, the question of the assembly of the “RMST complex” arose It was found that hnRNPA2 and SOX2 assembled in an RNA-independent...

Ngày tải lên: 09/09/2015, 17:55

... the weight of the explosive charge (Kg) R: the distance between explosive charge and target (m) P(t): the pressure profile of the shock wave (MPa) P max : the peak of the pressure of the wave ... coupled BEM-FEM is used to handle the interaction of the composite structures and the underwater explosion bubble, mutual effects of relative location between the bubble and the composite submersible ... FEATURE OF ZUBR-CLASS The Zubr-class (Project 1232.2 class, NATO reporting name Pomornik [8]) is class of aircushioned landing craft of Soviet design This class is the world’s largest hovercraft and...

Ngày tải lên: 08/06/2016, 14:11

Ngày tải lên: 07/08/2012, 11:48

... indication of techniques for the treatment of this kind of surgical complication Spontaneous healing of to mm openings can occur, while untreated larger defects are connected with the pathogenesis of ... characteristics of OAC/OAF; the apexes of tooth 26 were in extremely close approximation to the maxillary sinus, and an area of periapical rarefaction was evident (Fig 1) After the failure of the endodontic ... sinus over the involved tooth and the localized swelling and thickening of the sinus mucosa; only close the root of 2.7 a periapical lesion was present; radiopacity of different degrees was evident...

Ngày tải lên: 25/10/2012, 11:48

... your of f ering? Start with ten words and whittle it down Remember: your USP should be succinct and impactf ul # Done t he number-crunching [and sought t he right f inancing] A tough one, and ... income and outgoings You don’t need to be an accountant… get down to brass-tacks and understand what your business’s f inancial income and outgoings are going to look like On the subject of projections ... plan / st rat egy Of ten the idea of ‘growth’ at start-up is considered too “f ar of f ” – it really isn’t considered… wrong Growth is the very essence of business development, and you need a plan...

Ngày tải lên: 18/08/2013, 12:02

... activities of nitrite oxidizing bacteria - 31 - Journal of Water and Environment Technology, Vol.5, No.1, 2007 Figure Behavior of nitrate and nitrite at the end of the aerobic tank Behavior of Nitrobacter ... The effective reactor consisted of 45L of anoxic tank and 135L of aerobic tank, and a sedimentation tank Influent was 60L/day pH was 8.0-8.5 in the anoxic tank, and 7.0-7.5 in the aerobic tank ... the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the primer...

Ngày tải lên: 05/09/2013, 09:38