§ 791 2 number of votes required for board action

... variance ( 2 ) and dominance variance ( 2 ) can a d be written as η = 2na(p − q) + 2npqd1 + 2npqd2 2 = 2npq[a + d1 (q − p) ]2 + 2npq[a + d2 (q − p) ]2 a (9) 2 = n(2pqd1 )2 + n(2pqd2 )2 , d where ... 4 02 L.R Totir et al 10 11* 12* 13* 14* Figure Simple Pedigree Genetic evaluations were obtained for individuals marked by * 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 ... 403 Number of loci in finite locus models 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31* 32* 33* 34* Figure Inbred Pedigree Genetic evaluations were obtained for individuals...

Ngày tải lên: 14/08/2014, 13:22

... upon expression of A2 and A2(R2 & 3) (Fig 4A) Expression of variant A1(R3) resulted in very low amounts of PepX released, as is the case with FEBS Journal 27 2 (20 05) 28 54 28 68 ª 20 05 FEBS A Steen ... and muramidase -2, a homolog of AcmA produced by Enterococcus hirae (six LysM domains) [20 ] FEBS Journal 27 2 (20 05) 28 54 28 68 ª 20 05 FEBS The N-acetylglucosaminidase AcmA The aim of this study ... AGCGGAATTCAATAATTTATTTTATTCGTAGATACTGACC EcoRI EcoRI EcoRI 28 64 SpeI NheI BglII NruI EcoRI FEBS Journal 27 2 (20 05) 28 54 28 68 ª 20 05 FEBS A Steen et al resulted in a nonsense mutation of codon 24 2 The PCR product was subsequently...

Ngày tải lên: 19/02/2014, 18:20

... Biochem Parasitol 78, 24 925 7 14 Verschuur, A.C., Van Gennip, A.H., Leen, R., Voute, P.A., Brinkman, J & Van Kuilenburg, A.B (20 02) Cyclopentenyl 21 22 23 24 25 26 27 28 29 30 31 32 cytosine increases ... catalytic subdomain catalyzes all three partial reactions J Biol Chem 27 2, 29 25 529 2 62 Walker, M.S & DeMoss, J.A (1986) Organization of the functional domains of anthranilate synthase from Neurospora crassa ... 4.5 0 .24 5.4 22 .6 5.01 0.08 0.1 0 .2 0.04 0.8 4.5 0.18 K187A R 429 A 0.13 0.03 1.60 7.3 4.6 0.40 0.36 0.9 0.48 0.08 0.3 0.3 0.03 0.04 0.1 0.03 1. 82 6.5 3.6 0. 32 0.39 1 .2 0.49 0.07 0. 02 c...

Ngày tải lên: 23/03/2014, 17:22

... 2n−1,τ {u2n−1 3n ˜ |(fu,Xn ) (xj )| − ≤ M2 γn } : j=0 ≤ 4M2 (2n − 1)! τ 3n+1 3n M2 γn (2n − 1)! 1 /2 25 /2 M2 ≤ γn n 2 τ m=0 |xn−1 − xm | The Fubini theorem, Lemma 2. 2 .2, and the definition of the ... W

Ngày tải lên: 29/03/2014, 07:20

Ngày tải lên: 05/08/2014, 15:20

... 81 3 .2. 5 EMSA Analysis of AB Region of RPA p70 82 3 .2. 6 Preparation of 1 ,2 Cisplatin Damaged DNA 82 3 .2. 7 EMSA Analysis of W361A and WT RPA Binding to DNA 83 3 .2. 8 EMSA Analysis of ... 42 2 .2. 12 Indirect Immunofluorescence 43 2. 2.13 Western Blot Analysis 44 2. 3 Results 45 2. 4 Discussion 71 Determining the Mode of Inhibition of TDRL-505 ... 38 2. 2.7 Fluorescence Anisotropy 39 2. 2.8 Crystal Violet Cell Viability Assays 39 2. 2.9 Cell Cycle Analysis 40 2. 2.10 Analysis of BrdU Incorporation 41 2. 2.11...

Ngày tải lên: 24/08/2014, 11:28

Ngày tải lên: 14/11/2014, 06:20

... (Sections 2. 3.1 and 2. 3 .2) Page 43 ► For grant contracts, a certificate of origin is required only for equipment or vehicles with a unit cost in excess of EUR 000 (but please note that the rules of ... by a “certificate of origin”, i.e an official document delivered by the relevant authorities of the country of origin of the supplies (for example, a Chamber of Commerce) ► For programme estimates, ... OVERVIEW INTRODUCTION USE OF THE TOOLKIT AND BASIC TERMS This toolkit is for use by Recipients of EU funds for external actions Recipients of EU funds for external actions refers to organisations...

Ngày tải lên: 31/03/2014, 13:20

... together with others for common goal These are the reasons why I feel physical courses should be part of the graduation requirements of any university or college; they are of high value for a student’s ... equally on the basis of mutual interactive behavior among individuals By this definition we learn that a cooperatives situation requires at least one competitor to fail for each competitor that ... helps reinforce his self-confidence, self-reliance Team sports like football, basketball…helps develop social skills, when participating in them, we can recognize the true meaning of cooperation...

Ngày tải lên: 02/08/2013, 01:27

... using atomic force microscopy Glycobiology 20 04, 14:969-977 Page of (page number not for citation purposes) Virology Journal 20 06, 3 :29 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Esko JD, ... between level of surface HSPG and susceptibility to rAAV -2 infection [2] Page of (page number not for citation purposes) Virology Journal 20 06, 3 :29 The largest effect of removal of cell membrane ... rAAV -2 infection are particularly important for pulmonary applications because of the known lack of surface HSPG on apical membranes of respiratory epithelial cells [21 ,22 ] The purpose of this...

Ngày tải lên: 20/06/2014, 01:20

... Cells 45 1 024 15 768 5 12 B 25 6 A 25 6 5 12 768 Forward Scatter 1 024 1 02 101 700 55,87% 3,19% 12, 26% 100 104 20 ,44% Live Cells 525 103 350 175 100 27 ,99% 103 7AAD Counts Sideward Scatter 30 12, 96% 10 ... Retrovirology 20 10, 7:47 http://www.retrovirology.com/content/7/1/47 A) Page 11 of 18 300 700 29 3T Counts 22 5 CEMx174 PBMC 525 150 350 75 175 100 1 02 101 103 104 100 101 1 02 103 100 104 1 02 101 103 ... anti-PDPN 25 0 20 0 150 p = 0.0 12 40 30 20 100 10 50 0 CEMx174 29 3T pcDNA3 29 3T PDPN + Fc-Control + :Dox PDPN-Fc Figure Podoplanin is expressed on 29 3T cells and binds to CLEC -2 (A) 29 3T cells...

Ngày tải lên: 12/08/2014, 23:23

... ml) 120 ± 25 126 ± 23 133 ± 57 Plasma [glucose] posttraining (mg / 100 ml) 115 ± 22 120 ± 22 122 ± 35 Significance n.s n.s n.s HbA1C At baseline the HbA1c amounted to 6,7 % ± 0 ,26 (FT), 6,8 % ... group (number of subjects) Age (years) Weight (kp) Height (cm) Stretching (13) Strength (13) 63,3 ± 5,9 62, 9 ± 7,3 62, 2 ± 4,0 88,6 ± 24 ,1 86,5 ± 14,7 83,3 ± 13,4 173 ± 14 ,2 1 72 ± 6,7 177 ± 7 ,2 Vibration ... Sports Med 20 02; 23 : 428 – 32 Roelants M, Delecluse C, Verschueren SM Whole body vibration training increases knee-extension strength and speed of movement in older women JAGS 20 04; 52: 901 – Rohlfing...

Ngày tải lên: 26/10/2012, 10:04

... the fraction molar of the measured value of CO2 RESULTS AND DISCUSSION Temperature profiles The bed temperature profiles of each of the composting runs are shown in Fig At the beginning of the ... - 22 9 - Journal of Water and Environment Technology, Vol.1, No .2, 20 03 -1 Composting rate (h ) 0.04 0.03 0. 02 0.01 0 Number of pipe (-) Fig Relationship between the composting rate and the number ... experimental runs However, it was - 22 8 - Journal of Water and Environment Technology, Vol.1, No .2, 20 03 unfortunately difficult to accurately determine the amount of CO2 evolved and its evolution rate,...

Ngày tải lên: 05/09/2013, 08:40

... suecica Walne 2. 29 13.31 6 .20 7.04 ES 2. 58 16.98 6.93 7 .22 F /2 2.38 21 .75 8.37 7. 92 Algal-1 4.11 32. 22 8.83 8.65 Walne 4.04 13.37 13 .22 22 .28 ES 4 .24 14.88 15.73 23 .94 F /2 4.97 13 .26 17.91 23 .67 Algal-1 ... 8.45 18. 82 11.08 18.18 Walne 10.11 5.17 4 .28 25 .95 ES 12. 09 7 .23 5 .21 28 .38 F /2 10.81 8.13 5.59 26 . 82 Algal-1 16.15 9.57 4 .28 20 .68 Walne 19.01 2. 65 6. 42 6.51 ES 16 .23 5 .21 9 .20 6.45 F /2 24.65 3.34 ... CoCl2.6H2O 0.01 1-liter stocks of (g.l-1 DW) 10.0 g CoCl2, 9.8 g CuSO4.5H2O 0.01 CuSO4, 180 g MnCl2, 6.3 g Na2MoO4, 22 .0 g ZnSO4 FeCl3.6H2O 3.15 MnCl2.4H2O 0.18 Na2MoO4.2H2O 0.006 ZnSO4.7H2O 0. 022 ...

Ngày tải lên: 15/12/2013, 00:15

... 01, 20 12 (upto and inclusive of Educational Qualification) May 31 ,20 12) Opening and closing of payment Gateway 10th July to 23 rd July, 20 12 Opening and closing of gateway for 10th July to 23 rd ... 20 12 submission of on-line application Date of Pre-Examination training for the SC 27 st August to 1st September 20 12 and the ST applicants at all centers Date of Written Test at all centers 2nd ... Applicants are required to make payment of the fee in cash at any of the branches of IDBI Bank Ltd (IDBI Bank) or State Bank of India (SBI) Proforma of the challans to be used for payment through...

Ngày tải lên: 16/02/2014, 11:20

... (20 00) The alpha, but not the beta, isoform of the human thromboxane A2 receptor is a target for prostacyclin-mediated desensitization J Biol Chem 27 5, 20 4 12 20 423 23 Reid HM & Kinsella BT (20 03) ... between the TP isoforms in terms of their mechanisms of signaling [18,19], modes of regulation ⁄ desensitization [20 23 ] and patterns of expression [24 ], this represents a question of potentially ... A2 receptor gene expression A -1394 -404 - 320 - 320 +1 Luc - 320 +1 Luc **** pGL3Basic +1 Luc Luciferase Activity (RLU) B -1394 -404 - 320 Oct (- 123 ) AP-1 Oct 1 /2 ( -27 ) (-105) +1 - 320 +1 Luc - 320 ...

Ngày tải lên: 19/02/2014, 16:20

Ngày tải lên: 21/02/2014, 09:20

... cells) F/R 53 184 1 32 101 303 22 2 100 26 0 186 51 22 8 98 ± ± ± ± ± ± ± ± ± ± ± ± 13 12 12 27 25 11 21 20 24 10 6.4 20 17 7.3 20 22 52 130 120 2. 0 8.5 5.7 ± ± ± ± ± ± ± ± ± ± ± ± 0.6 2 1.1 3.5 10 15 ... 0.03 0. 02 0. 02 0.01 0 .2 0.08 0.1 0.01 0.03 0.01 3 .2 2.0 1 .2 2.3 1.6 0.8 2. 9 1.5 1.0 3 .2 2.7 1.5 ± ± ± ± ± ± ± ± ± ± ± ± 0 .2 0 .2 0.15 0.3 0 .2 0.1 0 .2 0.15 0.1 0.4 0 .25 0 .2 Table Effect of eIF2a-S51A ... cells) 131 25 3 24 0 20 5 125 53 ± 38 ± 3 12 ± 30 27 ± 3.5 1.0 ± 0.16 0.4 0.15 1.3 0.13 0.008 Fold F/R induction F/R ± ± ± ± ± 18 29 33 25 15 ± ± ± ± ± 0.05 0. 02 0 .2 0. 02 0.001 3.1 2. 2 2. 8 3.1 0.8...

Ngày tải lên: 22/02/2014, 07:20

... Insulin 14 .2 (10.4-18) 14.4 (10.4-18.4) 0.94 Diuretics 27 .4 (22 .5- 32. 3) 23 .1 (18.3 -27 .9) 0 .23 Beta blockers 12. 9 (9 .2- 16.6) 9.7 (6.4-13.1) 0 .22 ACE inhibitors 30.6 (25 .5-35.7) 29 .1 (24 -34 .2) 0.68 ... Control PRECEDE 28 .7 24 .8 29 .3 28 0.91 0 .29 +0.6 +3 .2 0. 02 DBP (

Ngày tải lên: 05/03/2014, 22:21

... snf5D::HIS SWI1D 329 -655 SNF5D2- 327 SWI1D 329 -655, SNF5D2- 327 snf2D::KanMX4 [55] [33] Present study Present study Present study [56] a Isogenic to W303 1A FEBS Journal 27 6 (20 09) 25 57 25 65 ª 20 09 The Authors ... interacts with a conserved region of SNF2 Mol Cell Biol 15, 424 0– 424 8 FEBS Journal 27 6 (20 09) 25 57 25 65 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 25 63 Mechanism of SWI ⁄ SNF recruitment to ... Workman JL (20 01) Recruitment of HAT FEBS Journal 27 6 (20 09) 25 57 25 65 ª 20 09 The Authors Journal compilation ª 20 09 FEBS Mechanism of SWI ⁄ SNF recruitment to promoters M E Ferreira et al 32 33 34...

Ngày tải lên: 07/03/2014, 00:20