1  oscillator pulling in a broadband transceiver and b

... proteins increased GTPcS binding The cannabinoid receptor agonist WIN 55,212–2 (A)< /b> further increased GTPcS binding This binding was inhibited by the cannabinoid selective antagonist AM251 (IA) ... Thomas KL & Abu-Shaar M (1993) Molecular characterization of a < /b> peripheral receptor for cannabinoids Nature 365, 61–65 Rinaldi-Carmona M, Calandra B, Shire D, Bouaboula M, Oustric D, Barth F, Casellas ... 17–22 Rinaldi-Carmona M, Barth F, Heaulme M, Shire D, Calandra B, Congy C, Martinez S, Maruani J, Neliat G & Caput D (1994) SR14171 6A,< /b> a < /b> potent and < /b> selective antagonist of the brain cannabinoid...

Ngày tải lên: 23/03/2014, 07:20

... studies, and < /b> SA was responsible for the laboratory test strategies PV and < /b> HR were responsible for the statistical analyses BH carried out the data management and < /b> data analyses and < /b> wrote the first draft ... Andersson S, Biague AJ, Dias F, Biberfeld G, Naucler A:< /b> Clinical features, immunological changes and < /b> mortality in < /b> a < /b> cohort of HIV-2-infected individuals in < /b> Bissau, Guinea-Bissau Scand J Infect Dis ... determinants in < /b> an urban population in < /b> Guinea-Bissau, West Africa J Acquir Immune Defic Syndr 2000, 25:157-163 van der Loeff MF, Aaby P, Aryioshi K, Vincent T, Awasana AA, Da Costa C, Pembrey...

Ngày tải lên: 13/08/2014, 05:22

... Yung-Hua Koh, Ramasamy Tamizhselvi, Shabbir Moochhala, Jin-Song Bian and < /b> Madhav Bhatia Role of protein kinase C in < /b> caerulein induced expression of substance P and < /b> neurokinin-1-receptors in < /b> murine pancreatic ... of Pharmacology and < /b> Experimental Therapeutics and < /b> Journal of Cellular and < /b> Molecular Medicine Yung-Hua Koh, Ramasamy Tamizhselvi, and < /b> Madhav Bhatia Extracellular signalregulated kinase 1/2 and < /b> ... presented as nanograms per microgram of DNA 2.2.5 DNA assay Determination of DNA concentration in < /b> the samples was performed fluorometrically as described by Labarca and < /b> Paigen (Labarca and < /b> Paigen,...

Ngày tải lên: 09/09/2015, 17:54

... AR, AQ and < /b> LG participated in < /b> study conception, study design, data acquisition, data analysis and < /b> interpretation, and < /b> drafting of the manuscript, NS, MB, JT, JV, JV, CA, PA, EV, JCH, AY, WP and < /b> ... for citation purposes) Critical Care Vol 12 No De La Rosa et al Table Insulin therapy and < /b> control of blood glucose levels Variable Standard treatment (N = 250) Administration of insulin (%) Intensive ... peak plasma creatinine > 2.5 mg/dl, Peak plasma urea nitrogen > 60 mg/dl, dialysis or continuous venovenous haemofiltration Table Causes of mortality in < /b> the patient group Variable Standard treatment...

Ngày tải lên: 25/10/2012, 10:35

... the application server for JavaBeans and < /b> servlets, and < /b> the database server for database connectivity Additionally, you can combine JSP with JavaBeans and < /b> Java servlets to create complex Web applications ... increases and < /b> the load on the database and < /b> Web servers goes up The JSP architecture, on the other hand, involves more than one level, immediately making it more scalable and < /b> maintainable In < /b> case ... include object references such as this one Java In < /b> A < /b> Teacup Enter John Doe Variables are the bread and < /b> butter of every programming language and < /b> JSP has them too A < /b> variable can be thought of as a < /b> programming...

Ngày tải lên: 19/10/2013, 02:15

... hydrazine caused the Soret absorbance peak to initially shift to 438 nm and < /b> increase in < /b> intensity then greatly diminish over several minutes, while absorbance at 500 nm decreased and < /b> absorbance at ... 5¢-AAATGCTTCAATGATAT CGAAAAAGGAAG-3¢, converted a < /b> unique SspI site on the vector to an EcoRV site The mutagenesis oligonucleotides were 5¢-GTAACTGTAAGAGAACTGGTCAC-3¢ (Lys70 to Arg), 5¢-GTAACTGTAGCAGAACTGGTCA ... phosphate solution, pH 7.5, caused the Soret band to increase slightly while absorbance at 500 nm decreased and < /b> absorbance at approximately 620 nm increased (data not shown) Incubation of ferric-cytochrome...

Ngày tải lên: 23/03/2014, 17:21

... pgRNA and < /b> the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and < /b> U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by RT-PCR ... conservation in < /b> 52 HBV genomes was calculated and < /b> the graphic representation was created by WebLogo [47] The HP1 and < /b> HP2 regions are indicated, with stems being marked by cyan bars and < /b> the RNase-accessible ... cleavage signal are present at the joint of some single-stranded and < /b> doublestranded regions, such as L1–S2 and < /b> S2–J1 ⁄ 2, suggesting that base pairing at these joint sites is dynamic (breathing)...

Ngày tải lên: 28/03/2014, 23:20

... St Lucia, St Vincent & the Grenadines, and < /b> Surinam in < /b> 2003; to Barbados and < /b> the Bahamas in < /b> 2004; and < /b> to Anguilla, Antigua & Barbuda, Dominica, Grenada, and < /b> Turks & Caicos in < /b> 2005 Clinical Skills ... number of people trained in < /b> clinical skills, clinical training skills and < /b> advanced training skills, as well as the number of trainings each clinical trainer and < /b> advanced trainer had conducted since ... Caribbean; and < /b> to Barbara McGaw (The Caribbean HIV/AIDS Regional Training network [CHART], Kingston, Jamaica), who oversaw the VCT training program Thanks also to the facilities, providers and...

Ngày tải lên: 18/06/2014, 17:20

... 0.01) between treated and < /b> untreated OvCa cells decrease CCL25 also induced a < /b> gradual increase in < /b> Akt phosphorylation and < /b> 10 minutes after treatment Wortmannin treatment abrogated this increase, but ... Ohta T, Ohmichi M, Hayasaka T, Mabuchi S, Saitoh M, Kawagoe J, Takahashi K, Igarashi H, Du B, Doshida M, Mirei IG, Motoyama T, Tasaka K, Kurachi H: Inhibition of Phosphatidylinositol 3-Kinase Increases ... Ohshima C, Hayakawa J, Kimura A,< /b> Takahashi K, Nishio Y, Sakata M, Kurachi H, Tasaka K, Murata Y: Inhibition of phosphorylation of a < /b> forkhead transcription factor sensitizes human ovarian cancer...

Ngày tải lên: 20/06/2014, 07:20

... vegetation is subject to external environmental factors net such as soil and < /b> climate, and < /b> to inherent facsuch as age and < /b> the kind of tree cover (Santa Regina et al, 1991).Plants retain a < /b> substantial ... reproductive organs + indeterminate organs) are indicated in < /b> table IV DISCUSSION Total biomass we can see On eter comparing biomass according to diamclasses, much higher in < /b> the beech forest, it may be seen ... = In < /b> Fagus sylvatica Calamini et al (1993) obtained a < /b> trunk biomass of 287 mg ; -1 ie, 90.1 % with respect to total biomass The branch fractions behave in < /b> a < /b> manner similar to the trunks; mean...

Ngày tải lên: 08/08/2014, 18:21

... white bars) with ng/ml IL-1β (hatched bars), the combination of IL-1β and < /b> µg/ml indomethacin (gray bars), or the combination of IL-1β and < /b> 100 µmol/l A7< /b> 7 1726 (black bars) for 48 hours Indomethacin ... inflammation and < /b> joint damage [30] In < /b> RA, Effect of indomethacin on IL-1 receptor antagonist (IL-1Ra) secretion in < /b> human synovial fibroblasts and < /b> articular chondrocytes (a)< /b> Human osteoarthritis (OA) ... such as lymphocytes and < /b> macrophages, into the joint Local release of proinflammatory mediators and < /b> metalloproteinases causes joint cartilage destruction and < /b> leads to the perpetuation of joint inflammation...

Ngày tải lên: 09/08/2014, 01:23

... Yoshida H, Mamada Y, Taniai N, Mizuguchi Y, Nakamura Y, Nomura T, Okuda T, Uchida E, Fukuda Y, Watanabe M, et al: Spurt bleeding from a < /b> calcificated gastrointestinal stromal tumor in < /b> the stomach ... study, and < /b> participated in < /b> its design and < /b> coordination and < /b> helped to draft the manuscript All authors read and < /b> approved the final manuscript Competing interests The authors declare that they have ... Other gastrointestinal tumors may also contain calcification At least three types of calcification have been reported in < /b> gastric cancer: mucin pool calcifications, psammomatous calcifications, and...

Ngày tải lên: 09/08/2014, 01:24

... CCTTACCATCTCCAGAAACTGC [22], and < /b> bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and < /b> bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and < /b> MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG ... NKG2D and < /b> its MIC ligands in < /b> rheumatoid arthritis Proc Natl Acad Sci USA 2003, 100:9452-9457 Kochi Y, Yamada R, Kobayashi K, Takahashi A,< /b> Suzuki A,< /b> Sekine A,< /b> Mabuchi A,< /b> Akiyama F, Tsunoda T, Nakamura ... Martinez A,< /b> Fernandez-Arquero M, Balsa A,< /b> Rubio A,< /b> Alves H, Pascual-Salcedo D, Martin-Mola E, de la Concha EG: Primary association of a < /b> MICA allele with protection against rheumatoid arthritis Arthritis...

Ngày tải lên: 09/08/2014, 14:20

... information about a < /b> IYAKE Robertsonian translocation in < /b> swine observed in < /b> a < /b> local unselected pig herd and < /b> in < /b> A.< /b> I boars in < /b> GDR reciprocal reciprocal II Materials and < /b> methods Blood samples were obtained ... from a < /b> local herd which had been studied However, it is remarkable that this type of aberration was found only in < /b> A.< /b> I boars of the Landrace Among 62 Landrace animals analysed, boars showed a < /b> heterozygote ... earlier in < /b> the Landrace of GDR The increased local use of an aberrant boar in < /b> artificial insemination can lead to higher frequency, as could be observed in < /b> the present study in < /b> a < /b> local herd of fattening...

Ngày tải lên: 09/08/2014, 22:22

... creat, creatinine (mg/dL); tBil, total bilirubin (mg/dL); dBil, direct bilirubin (mg/dL); ALP, alkaline phosphatase (U/L); AST, aspartate aminotransferase (U/L); ALT, alanine aminotransferase (U/L); ... point gradual improvement in < /b> the laboratory findings was observed One week after discharge, he reported a < /b> mild sense of weakness and < /b> the laboratory findings were as shown in < /b> Table One month after ... today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in < /b> Cases Database Any patient, any case, can teach us something www.casesnetwork.com Page of (page number not for citation...

Ngày tải lên: 11/08/2014, 14:20

... 2005, 2:41 Background The rate of HIV disease progression varies greatly among infected individuals, which is defined invariably by increasing plasma viral loads and < /b> concomitant decline in < /b> the CD4+ ... A < /b> small but rare subset of chronically-infected individuals comprising stable CD4+ and < /b> CD8+ T cell counts, low to undetectable ... values still indicate the hallmark of recombination, but the recombination indices become slightly varied and < /b> are no longer comparable between the two tests If this recombination signal is also...

Ngày tải lên: 13/08/2014, 09:21

... mapping scales and < /b> it is possible for individual databases on different scales later to be merged into a < /b> global database (van Engelen, 1995) Beyond the existing map of establishing SOTER databases ... fields as well According to van Engelen and < /b> Wen (1995), the soils and < /b> terrain database consists of information of soils and < /b> terrain characteristics in < /b> a < /b> Relational Database Management System (RDBMS) ... important in < /b> capturing spatial variations of soils and < /b> if they are correctly spatially delineated, loss of soil information can be minimized and < /b> spatial soil gradation can be better seen as a < /b> continuum...

Ngày tải lên: 11/09/2015, 15:45

... 06 05 Birds were swooping and < /b> drifting through the air above the harbor Their glaring eyes watched the ferry as it passed by Tommy and < /b> Lisa stood by the ferry railing and < /b> listened as Grandpa spoke ... ports in < /b> Boston, Philadelphia, Baltimore, San Francisco, Miami, and < /b> New Orleans.” The park ranger gave them a < /b> moment to think about all of America’s immigrants “Now, let’s move on to the main building,” ... Germany, Canada, Mexico, Britain, Italy, and < /b> Latin America Today, many immigrants to the United States come from Asia and < /b> Mexico.” The Ellis Island Immigration Museum From 1880 to 1930 about twelve...

Ngày tải lên: 20/04/2017, 16:04

... observations can be made 1) The periodic variation of at a < /b> rate of implies that the output beats with the input, exhibiting sidebands with a < /b> spacing of Note that is a < /b> function of both and < /b> (and < /b> ... constant for a < /b> shorter part of the period and < /b> exhibits a < /b> faster variation at the beginning and < /b> end; for a < /b> shorter duand 3) the instantaneous frequency is near ration [Fig 9(c)], producing a < /b> smaller ... aswhile phasesume the oscillator is pulled by a < /b> component at locked so as to operate at We also assume that the oscillator control has a < /b> gain of and < /b> contains a < /b> small perturbation, , around a...

Ngày tải lên: 08/07/2014, 17:03

... Yanagihara K, Tanabe A,< /b> Egashira Y, Sanada H & Shibata K (2002) Identification and < /b> expression of a < /b> cDNA encoding human 6622 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 a-< /b> amino -b- carboxymuconate-e-semialdehyde ... recently, abnormally high brain levels of PA have been reported in < /b> a < /b> murine model of cerebral malaria, a < /b> frequently fatal complication of Plasmodium falciparum infection; in < /b> the same model, pharmacological ... shows a < /b> molecular architecture that closely resembles that described for PfACMSD [18], comprising a < /b> distorted (a < /b> ⁄ b) 8 barrel domain and < /b> a < /b> small insertion domain (Fig 2) hACMSD and < /b> PfACMSD can ˚ indeed...

Ngày tải lên: 18/02/2014, 06:20