1 oscillator pulling in a broadband transceiver and b

Báo cáo khoa học: C-terminal truncated cannabinoid receptor 1 coexpressed with G protein trimer in Sf9 cells exists in a precoupled state and shows constitutive activity ppt

Ngày tải lên : 23/03/2014, 07:20

... proteins increased GTPcS binding The cannabinoid receptor agonist WIN 55,212–2 (A) further increased GTPcS binding This binding was inhibited by the cannabinoid selective antagonist AM251 (IA) ... Thomas KL & Abu-Shaar M (1993) Molecular characterization of a peripheral receptor for cannabinoids Nature 365, 61–65 Rinaldi-Carmona M, Calandra B, Shire D, Bouaboula M, Oustric D, Barth F, Casellas ... 17–22 Rinaldi-Carmona M, Barth F, Heaulme M, Shire D, Calandra B, Congy C, Martinez S, Maruani J, Neliat G & Caput D (1994) SR14171 6A, a potent and selective antagonist of the brain cannabinoid...

10
313
0

Báo cáo y học: "Mortality associated with HIV-1, HIV-2, and HTLV-I single and dual infections in a middle-aged and older population in Guinea-Bissau" potx

Ngày tải lên : 13/08/2014, 05:22

... studies, and SA was responsible for the laboratory test strategies PV and HR were responsible for the statistical analyses BH carried out the data management and data analyses and wrote the first draft ... Andersson S, Biague AJ, Dias F, Biberfeld G, Naucler A: Clinical features, immunological changes and mortality in a cohort of HIV-2-infected individuals in Bissau, Guinea-Bissau Scand J Infect Dis ... determinants in an urban population in Guinea-Bissau, West Africa J Acquir Immune Defic Syndr 2000, 25:157-163 van der Loeff MF, Aaby P, Aryioshi K, Vincent T, Awasana AA, Da Costa C, Pembrey...

9
336
0

Regulation of substance p and neurokinin 1 receptor expression in a mouse model of acute pancreatitis

Ngày tải lên : 09/09/2015, 17:54

... Yung-Hua Koh, Ramasamy Tamizhselvi, Shabbir Moochhala, Jin-Song Bian and Madhav Bhatia Role of protein kinase C in caerulein induced expression of substance P and neurokinin-1-receptors in murine pancreatic ... of Pharmacology and Experimental Therapeutics and Journal of Cellular and Molecular Medicine Yung-Hua Koh, Ramasamy Tamizhselvi, and Madhav Bhatia Extracellular signalregulated kinase 1/2 and ... presented as nanograms per microgram of DNA 2.2.5 DNA assay Determination of DNA concentration in the samples was performed fluorometrically as described by Labarca and Paigen (Labarca and Paigen,...

190
432
0

Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"

Ngày tải lên : 25/10/2012, 10:35

... AR, AQ and LG participated in study conception, study design, data acquisition, data analysis and interpretation, and drafting of the manuscript, NS, MB, JT, JV, JV, CA, PA, EV, JCH, AY, WP and ... for citation purposes) Critical Care Vol 12 No De La Rosa et al Table Insulin therapy and control of blood glucose levels Variable Standard treatment (N = 250) Administration of insulin (%) Intensive ... peak plasma creatinine > 2.5 mg/dl, Peak plasma urea nitrogen > 60 mg/dl, dialysis or continuous venovenous haemofiltration Table Causes of mortality in the patient group Variable Standard treatment...

9
635
0

The JSP Files (Part 1) - Purple Pigs in a Fruitbasket

Ngày tải lên : 19/10/2013, 02:15

... the application server for JavaBeans and servlets, and the database server for database connectivity Additionally, you can combine JSP with JavaBeans and Java servlets to create complex Web applications ... increases and the load on the database and Web servers goes up The JSP architecture, on the other hand, involves more than one level, immediately making it more scalable and maintainable In case ... include object references such as this one Java In A Teacup Enter John Doe Variables are the bread and butter of every programming language and JSP has them too A variable can be thought of as a programming...

16
324
0

Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot

Ngày tải lên : 23/03/2014, 17:21

... hydrazine caused the Soret absorbance peak to initially shift to 438 nm and increase in intensity then greatly diminish over several minutes, while absorbance at 500 nm decreased and absorbance at ... 5¢-AAATGCTTCAATGATAT CGAAAAAGGAAG-3¢, converted a unique SspI site on the vector to an EcoRV site The mutagenesis oligonucleotides were 5¢-GTAACTGTAAGAGAACTGGTCAC-3¢ (Lys70 to Arg), 5¢-GTAACTGTAGCAGAACTGGTCA ... phosphate solution, pH 7.5, caused the Soret band to increase slightly while absorbance at 500 nm decreased and absorbance at approximately 620 nm increased (data not shown) Incubation of ferric-cytochrome...

7
384
1

Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

Ngày tải lên : 28/03/2014, 23:20

... pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantiﬁcation of the splicing ratio by RT-PCR ... conservation in 52 HBV genomes was calculated and the graphic representation was created by WebLogo [47] The HP1 and HP2 regions are indicated, with stems being marked by cyan bars and the RNase-accessible ... cleavage signal are present at the joint of some single-stranded and doublestranded regions, such as L1–S2 and S2–J1 ⁄ 2, suggesting that base pairing at these joint sites is dynamic (breathing)...

14
379
0

báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot

Ngày tải lên : 18/06/2014, 17:20

... St Lucia, St Vincent & the Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Barbuda, Dominica, Grenada, and Turks & Caicos in 2005 Clinical Skills ... number of people trained in clinical skills, clinical training skills and advanced training skills, as well as the number of trainings each clinical trainer and advanced trainer had conducted since ... Caribbean; and to Barbara McGaw (The Caribbean HIV/AIDS Regional Training network [CHART], Kingston, Jamaica), who oversaw the VCT training program Thanks also to the facilities, providers and...

8
450
0

báo cáo hóa học:" CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion" pdf

Ngày tải lên : 20/06/2014, 07:20

... 0.01) between treated and untreated OvCa cells decrease CCL25 also induced a gradual increase in Akt phosphorylation and 10 minutes after treatment Wortmannin treatment abrogated this increase, but ... Ohta T, Ohmichi M, Hayasaka T, Mabuchi S, Saitoh M, Kawagoe J, Takahashi K, Igarashi H, Du B, Doshida M, Mirei IG, Motoyama T, Tasaka K, Kurachi H: Inhibition of Phosphatidylinositol 3-Kinase Increases ... Ohshima C, Hayakawa J, Kimura A, Takahashi K, Nishio Y, Sakata M, Kurachi H, Tasaka K, Murata Y: Inhibition of phosphorylation of a forkhead transcription factor sensitizes human ovarian cancer...

8
316
0

Báo cáo khoa học: "Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern Spain" pdf

Ngày tải lên : 08/08/2014, 18:21

... vegetation is subject to external environmental factors net such as soil and climate, and to inherent facsuch as age and the kind of tree cover (Santa Regina et al, 1991).Plants retain a substantial ... reproductive organs + indeterminate organs) are indicated in table IV DISCUSSION Total biomass we can see On eter comparing biomass according to diamclasses, much higher in the beech forest, it may be seen ... = In Fagus sylvatica Calamini et al (1993) obtained a trunk biomass of 287 mg ; -1 ie, 90.1 % with respect to total biomass The branch fractions behave in a manner similar to the trunks; mean...

9
261
0

Báo cáo y học: "The active metabolite of leflunomide, A77 1726, increases the production of IL-1 receptor antagonist in human synovial fibroblasts and articular chondrocytes" ppsx

Ngày tải lên : 09/08/2014, 01:23

... white bars) with ng/ml IL-1β (hatched bars), the combination of IL-1β and µg/ml indomethacin (gray bars), or the combination of IL-1β and 100 µmol/l A7 7 1726 (black bars) for 48 hours Indomethacin ... inflammation and joint damage [30] In RA, Effect of indomethacin on IL-1 receptor antagonist (IL-1Ra) secretion in human synovial fibroblasts and articular chondrocytes (a) Human osteoarthritis (OA) ... such as lymphocytes and macrophages, into the joint Local release of proinflammatory mediators and metalloproteinases causes joint cartilage destruction and leads to the perpetuation of joint inflammation...

9
437
0

báo cáo khoa học: "CCR9-CCL25 interactions promote cisplatin resistance in breast cancer cell through Akt activation in a PI3K-dependent and FAK-independent fashion" pptx

Ngày tải lên : 09/08/2014, 01:24

... Yoshida H, Mamada Y, Taniai N, Mizuguchi Y, Nakamura Y, Nomura T, Okuda T, Uchida E, Fukuda Y, Watanabe M, et al: Spurt bleeding from a calcificated gastrointestinal stromal tumor in the stomach ... study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have ... Other gastrointestinal tumors may also contain calcification At least three types of calcification have been reported in gastric cancer: mucin pool calcifications, psammomatous calcifications, and...

4
231
0

Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps

Ngày tải lên : 09/08/2014, 14:20

... CCTTACCATCTCCAGAAACTGC [22], and bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG ... NKG2D and its MIC ligands in rheumatoid arthritis Proc Natl Acad Sci USA 2003, 100:9452-9457 Kochi Y, Yamada R, Kobayashi K, Takahashi A, Suzuki A, Sekine A, Mabuchi A, Akiyama F, Tsunoda T, Nakamura ... Martinez A, Fernandez-Arquero M, Balsa A, Rubio A, Alves H, Pascual-Salcedo D, Martin-Mola E, de la Concha EG: Primary association of a MICA allele with protection against rheumatoid arthritis Arthritis...

11
460
0

báo cáo khoa học: "A cytogenetic survey was carried out on fattening male and female pigs of different lines in a local herd and on " ppsx

Ngày tải lên : 09/08/2014, 22:22

... information about a IYAKE Robertsonian translocation in swine observed in a local unselected pig herd and in A. I boars in GDR reciprocal reciprocal II Materials and methods Blood samples were obtained ... from a local herd which had been studied However, it is remarkable that this type of aberration was found only in A. I boars of the Landrace Among 62 Landrace animals analysed, boars showed a heterozygote ... earlier in the Landrace of GDR The increased local use of an aberrant boar in artificial insemination can lead to higher frequency, as could be observed in the present study in a local herd of fattening...

7
313
0

Báo cáo y học: "Acute lymphocytic crisis following herpes simplex type 1 virus hepatitis in a nonimmunocompromised man: a case report" pptx

Ngày tải lên : 11/08/2014, 14:20

... creat, creatinine (mg/dL); tBil, total bilirubin (mg/dL); dBil, direct bilirubin (mg/dL); ALP, alkaline phosphatase (U/L); AST, aspartate aminotransferase (U/L); ALT, alanine aminotransferase (U/L); ... point gradual improvement in the laboratory findings was observed One week after discharge, he reported a mild sense of weakness and the laboratory findings were as shown in Table One month after ... today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com Page of (page number not for citation...

4
315
0

Báo cáo y học: "Role of viral evolutionary rate in HIV-1 disease progression in a linked cohort" pptx

Ngày tải lên : 13/08/2014, 09:21

... 2005, 2:41 Background The rate of HIV disease progression varies greatly among infected individuals, which is defined invariably by increasing plasma viral loads and concomitant decline in the CD4+ ... A small but rare subset of chronically-infected individuals comprising stable CD4+ and CD8+ T cell counts, low to undetectable ... values still indicate the hallmark of recombination, but the recombination indices become slightly varied and are no longer comparable between the two tests If this recombination signal is also...

10
318
0

towards sustainability of land use in a highly vulnerable and degraded

Ngày tải lên : 11/09/2015, 15:45

... mapping scales and it is possible for individual databases on different scales later to be merged into a global database (van Engelen, 1995) Beyond the existing map of establishing SOTER databases ... fields as well According to van Engelen and Wen (1995), the soils and terrain database consists of information of soils and terrain characteristics in a Relational Database Management System (RDBMS) ... important in capturing spatial variations of soils and if they are correctly spatially delineated, loss of soil information can be minimized and spatial soil gradation can be better seen as a continuum...

230
583
0

3 4 1 brave settlers in a strange land

Ngày tải lên : 20/04/2017, 16:04

... 06 05 Birds were swooping and drifting through the air above the harbor Their glaring eyes watched the ferry as it passed by Tommy and Lisa stood by the ferry railing and listened as Grandpa spoke ... ports in Boston, Philadelphia, Baltimore, San Francisco, Miami, and New Orleans.” The park ranger gave them a moment to think about all of America’s immigrants “Now, let’s move on to the main building,” ... Germany, Canada, Mexico, Britain, Italy, and Latin America Today, many immigrants to the United States come from Asia and Mexico.” The Ellis Island Immigration Museum From 1880 to 1930 about twelve...

10
218
0

a study of injection locking and pulling in oscillator

Ngày tải lên : 08/07/2014, 17:03

... observations can be made 1) The periodic variation of at a rate of implies that the output beats with the input, exhibiting sidebands with a spacing of Note that is a function of both and (and ... constant for a shorter part of the period and exhibits a faster variation at the beginning and end; for a shorter duand 3) the instantaneous frequency is near ration [Fig 9(c)], producing a smaller ... aswhile phasesume the oscillator is pulled by a component at locked so as to operate at We also assume that the oscillator control has a gain of and contains a small perturbation, , around a...

10
848
0

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

Ngày tải lên : 18/02/2014, 06:20

... Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identiﬁcation and expression of a cDNA encoding human 6622 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 a- amino -b- carboxymuconate-e-semialdehyde ... recently, abnormally high brain levels of PA have been reported in a murine model of cerebral malaria, a frequently fatal complication of Plasmodium falciparum infection; in the same model, pharmacological ... shows a molecular architecture that closely resembles that described for PfACMSD [18], comprising a distorted (a ⁄ b) 8 barrel domain and a small insertion domain (Fig 2) hACMSD and PfACMSD can ˚ indeed...

9
796
0