vì ai gây dựng cho nên nỗi này

Báo cáo khoa học: "Cell death by the quinoxaline dioxide DCQ in human colon cancer cells is enhanced under hypoxia and is independent of p53 and p21" pdf

Báo cáo khoa học: "Cell death by the quinoxaline dioxide DCQ in human colon cancer cells is enhanced under hypoxia and is independent of p53 and p21" pdf

... (100 U/ml) and 10% heat-inactivated FBS All cells were obtained from ATCC and maintained in a humidified atmosphere of 5% CO2 and 95% air 10 mg of DCQ was dissolved in ml of DMSO and stored in ... treatment were analyzed using the CometScore™software Percentage of DNA in the tail region, and tail moment (% DNA in tail × by tail length (μm)) were used as parameters to assess DNA damage p-ATM immunocytochemistry ... induced by DCQ including % DNA in comet’s tail (representing damaged DNA migrated away from nucleus), and tail moment (% DNA in comet’s tail multiplied by the tail length) Under normoxia, DCQ induced...

Ngày tải lên: 09/08/2014, 09:20

13 268 0
Báo cáo khoa học: The in vitro effects of CRE-decoy oligonucleotides in combination with conventional chemotherapy in colorectal cancer cell lines potx

Báo cáo khoa học: The in vitro effects of CRE-decoy oligonucleotides in combination with conventional chemotherapy in colorectal cancer cell lines potx

... methods Cell culture HCT116 and SW620 colorectal cell lines were obtained from the Cancer Research UK laboratories, and were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% ... so we stained cells for SA-b-gal activity, and showed that CDO alone did not increase the extent of staining However, in cells that had been cocultured with CDO and a cytotoxic drug, staining ... gene-specific inhibition of tumor growth J Biol Chem 274, 1573–1580 18 Lee, Y.N., Park, Y.G., Choi, Y.H., Cho, Y.S & Cho- Chung, Y.S (2000) CRE-transcription factor decoy oligonucleotide inhibition of MCF-7...

Ngày tải lên: 07/03/2014, 15:20

9 331 0
Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx

Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx

... also containing lysozyme (1 mgÆmL)1; Sigma), a CompleteTM EDTA-free protease inhibitor cocktail tablet, and DNase I (5 lM; both Ó FEBS 2003 Phosphorylation of the T-cell receptor f chain (Eur ... subsequent tyrosines in the whole cTCRf chain in vitro, relative to the single-tyrosine-containing peptides, may well be due to the presence of an SH2 domain in Lck which binds to phosphotyrosines ... may influence the ability of its catalytic domain to reach the remaining unphosphorylated tyrosines of TCRf However, our studies using peptides containing single tyrosines show that Lck is capable...

Ngày tải lên: 08/03/2014, 02:20

8 571 0
Báo cáo khoa học: Protein folding and disulfide bond formation in the eukaryotic cell pptx

Báo cáo khoa học: Protein folding and disulfide bond formation in the eukaryotic cell pptx

... (2007) How tails guide tail-anchored proteins to their destinations Curr Opin Cell Biol 19, 368–375 26 Riemer J, Bulleid N & Herrmann JM (2009) Disulfide formation in the ER and mitochondria: two ... antibody diversity NMR analysis showed that, unlike the CL domain, the CH1 domain of IgG does not fold properly in isolation The CH1 domain needs the context of CL for productive antibody folding ... heavy and light chains This is consistent with reports that the ER chaperone BiP targets the CH1 domain [11,12], and labelled peptide-binding studies are ongoing to reveal the details of the BiP–CH1...

Ngày tải lên: 29/03/2014, 22:21

7 358 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx

Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx

... Aurora kinase inhibitor VX-680 against Bcr/Abl-positive acute lymphoblastic leukemias Mol Cancer Ther 2010, 9:1318-1327 30 Noronha G, Cao J, Chow CP, Dneprovskaia E, Fine RM, Hood J, Kang X, Klebansky ... review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution ... phenotype Not surprisingly, three CML lines with hyperdiploidy (>2n) and hypertriploidy (>3n) still maintained a sensitive response profile The sensitivity observed in CML cell lines, even with the polyploid...

Ngày tải lên: 18/06/2014, 22:20

10 618 0
báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

... offspring were analyzed at days of age In brief, tissues obtained by tail clipping were digested at 55°C for 18 h in a lysis buffer containing mg/ml proteinase K, 0.5% lauryl sulfate (SDS), 100 ... infiltration of inflammatory cells in focal brain ischemia of hypertensive rats [38] Astrocytes are main cytokine/ chemokine-producing cells in the brain [34,37], and astrocyte-produced MCP-1 directs ... 23:7922-7930 Kumai Y, Ooboshi H, Takada J, Kamouchi M, Kitazono T, Egashira K, Ibayashi S, Iida M: Anti-monocyte chemoattractant protein-1 gene therapy protects against focal brain ischemia in...

Ngày tải lên: 19/06/2014, 22:20

15 541 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt

o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt

... Aurora kinase inhibitor VX-680 against Bcr/Abl-positive acute lymphoblastic leukemias Mol Cancer Ther 2010, 9:1318-1327 30 Noronha G, Cao J, Chow CP, Dneprovskaia E, Fine RM, Hood J, Kang X, Klebansky ... review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution ... phenotype Not surprisingly, three CML lines with hyperdiploidy (>2n) and hypertriploidy (>3n) still maintained a sensitive response profile The sensitivity observed in CML cell lines, even with the polyploid...

Ngày tải lên: 20/06/2014, 04:20

10 665 0
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" pptx

báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" pptx

... samples, the staining intensity of each specimen was scored as follows: (weak staining; less than 10% of cells were positive), (intermediate staining; 10-50% positive) and (strong staining; >50% ... samples, the staining intensity of each specimen was scored as follows: (weak staining; less than 10% of the cells were positive cells), (intermediate staining; 1050% positive) and (strong staining; ... review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution...

Ngày tải lên: 20/06/2014, 04:20

8 445 0
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" potx

báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" potx

... samples, the staining intensity of each specimen was scored as follows: (weak staining; less than 10% of cells were positive), (intermediate staining; 10-50% positive) and (strong staining; >50% ... samples, the staining intensity of each specimen was scored as follows: (weak staining; less than 10% of the cells were positive cells), (intermediate staining; 1050% positive) and (strong staining; ... review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution...

Ngày tải lên: 20/06/2014, 07:20

8 244 0
Báo cáo khoa học: " Loratadine dysregulates cell cycle progression and enhances the effect of radiation in human tumor cell lines" pot

Báo cáo khoa học: " Loratadine dysregulates cell cycle progression and enhances the effect of radiation in human tumor cell lines" pot

... The running buffer (0.5× TBE) was re-circulated and cooled to maintain a temperature of 12-15°C These electrophoresis conditions were chosen based on methods of Stamato and Denko [16], and the desire ... by ongoing attempts to repair DNA while the cell is actively progressing through the cell cycle, although this remains to be shown It is clear, however, that DNA repair proteins, such as gH2AX, ... review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution...

Ngày tải lên: 09/08/2014, 10:20

12 405 0
báo cáo khoa học: "EGFR and COX-2 protein expression in non-small cell lung cancer and the correlation with clinical features" pptx

báo cáo khoa học: "EGFR and COX-2 protein expression in non-small cell lung cancer and the correlation with clinical features" pptx

... system for 30 Tissue staining was visualized with a DAB substrate chromogen solution Slides were counterstained with hematoxylin, dehydrated, and mounted To validate each staining, the EGFR positive ... review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution ... slides were first observed for staining status under low power microscope, and then randomly selected fields under high power (200×) light microscope For assessment of staining positivity, the number...

Ngày tải lên: 10/08/2014, 10:21

8 435 0
báo cáo khoa học: " Correction: EGFR and COX-2 protein expression in non-small cell lung cancer and the correlation with clinical features" pps

báo cáo khoa học: " Correction: EGFR and COX-2 protein expression in non-small cell lung cancer and the correlation with clinical features" pps

... 23 50 There was no significant relationship between COX-2 and EGFR P > 0.05 P < 0.05 Author details Radiation Oncology, Tumor Center, West China Hospital, Sichuan University, PR China 2Department...

Ngày tải lên: 10/08/2014, 10:21

2 287 0
báo cáo khoa học: "ShRNA-mediated gene silencing of MTA1 influenced on protein expression of ER alpha, MMP-9, CyclinD1 and invasiveness, proliferation in breast cancer cell lines MDA-MB-231 and MCF-7 in vitro" pptx

báo cáo khoa học: "ShRNA-mediated gene silencing of MTA1 influenced on protein expression of ER alpha, MMP-9, CyclinD1 and invasiveness, proliferation in breast cancer cell lines MDA-MB-231 and MCF-7 in vitro" pptx

... histone deacetylase, So it was considered aid actuating factor of HDACs to restrain transcription Talukger et al[15] studied, the molecule mechanism of MTA1 restraining ER alpha expression in breast ... pair:sense:5’-AGCTTAAAAAG CAACC CTGTCAGTCTGCTATAATTCAAGAGATTATAGCAGACTGACAGGGTT GCGG-3’, antisense: 5’-GATCC CGCAACCCTGTCAGTCTGCTATAATCTCTTGA ATTATAGCAGACTGACAGGGTTGCTTTTTA-3’, the second pair:sense:5’-AGCTT ... kindly supplied by professor Wei-xue Tang (Department of Pathology Physiology, School of Basic Medicine Sciences, Chong Qing University of Medical Sciences, China) All cells were cultured in RPMI...

Ngày tải lên: 10/08/2014, 10:21

11 281 0
Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx

Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx

... Heart failure Pneumonia of unknown origin; respiratory failure Septic shock; ALI/respiratory failure Aspiration pneumonia; respiratory failure and shock Mycoplasma pneumoniae pneumonia – Heart failure ... remain unclear When properly standardized, for instance with respect to cell numbers in bronchoalveolar fluid or tracheal aspirates, quantitative cultures, viral RNA and DNA by polymerase chain ... eliciting an infectious host response, as demonstrated by a rise in serum antibodies, by bronchoscopic airway disease, by ‘typical’ findings on computed tomography of the lungs, or by the presence...

Ngày tải lên: 12/08/2014, 20:20

6 284 0
Unit 1: A day in the life of. Listening

Unit 1: A day in the life of. Listening

... passengers:/'pæsindʒə/ ride:/raid/ WHILE-LISTENING Look at the pictures and describe them WHILE-LISTENING Pre order these pictures WHILE-LISTENING Listen and order these pictures WHILE-LISTENING Listen again and decide ... POST-LISTENING V HOMEWORK - T asks ss to remember the story about Mr Lam and write about him and his daily routine ...

Ngày tải lên: 21/06/2013, 01:26

10 12,6K 39
Unit 1-A day in the life of...

Unit 1-A day in the life of...

... 1: A day in the life of Period 4: Writing Vocabulary land (v): h¹ c¸nh take off (v): cÊt c¸nh air-hostess (n): n÷ tiÕp viªn hµng kh«ng seat belt (n): d©y an toµn fasten (v): th¾t announce (v): ... Task Task black smoke cough Unit 1: A day in the life of Period 4: Writing a fire fire brigade choke firemen Unit 1: A day in the life of Period 4: Writing Last year/ I / spend / summer holidays ... panic / People/ run toward / fire exits / One door / be / block / Many people / begin /cough / choke Then / just as we / think / we / have / only / minutes / live, fire brigade / arrive Firemen...

Ngày tải lên: 18/09/2013, 05:10

20 2,8K 5
Gián án Ụnit 1: A day in the life of...

Gián án Ụnit 1: A day in the life of...

... watch TV 11 go to the bed * lead in: - It is Linh’sdaily routine -Do you have a daily routine? -is it same or different from Linh? 5ms 2.Pre-task: BRAIN STORM -ask ss think about some their activities ... ACTIVITIES * Instruction: -Divide class in to two teams: team A & team B -Show a video about linh’ daily routine in minute -ask ss to remember activities and time’s activities of Linh -2 ms for teams ... get up? Lan:: I often get up at 6.oo T: Phong, what you often in the afternoon? Phong: I go to school T: Hoa, what time you often go to the bed? Hoa: I always go to the bed at 23.00 *T introduce...

Ngày tải lên: 02/12/2013, 19:11

3 2,1K 12
Tài liệu Activity 5.1: Identifying Keys in the Logical Model pdf

Tài liệu Activity 5.1: Identifying Keys in the Logical Model pdf

... MaintenanceCost1 MaintenanceDesc1 MaintenanceDate1 MaintenanceMiles1 MaintenanceCost2 MaintenanceDesc2 MaintenanceDate2 MaintenanceMiles2 MaintenanceCost3 MaintenanceDesc3 MaintenanceDate3 MaintenanceMiles3 ... Identifying Keys in the Logical Model 23 Contract Contracts With ∞ Employee Timesheet Name Address SSN E-Mail Type Salary BillableRate ∞ Completes Invoice EmployeeFirstName EmployeeLastName ClientName ClientLocation...

Ngày tải lên: 21/12/2013, 06:16

4 391 0
Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through specific protein interactions in the methionine synthase–methionine synthase reductase complex docx

Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through specific protein interactions in the methionine synthase–methionine synthase reductase complex docx

... starter culture Throughout growth, the temperature was maintained at 29 °C, and agitation was constant at 900 r.p.m A pH of 5.0 was maintained using 14% (w ⁄ v) ammonium hydroxide The glycerol ... available: Fig S1 Fluorescence titration of the FMN domain with the hMS AD Fig S2 Comparison of the electrostatic potentials of the surface of the CPR FMN domain and of a model of the FMN domain ... Redox form MS activity (nmolÆmin)1) Control – no hMS Without flavoproteina FMN domain oxidizedb FMN domain 1e) FMN domain 2e) MSR oxidized MSR 1e) MSR 2e) MSR 4e) < 0.01 0.24 ± 0.66 ± 1.86 ± 2.65...

Ngày tải lên: 18/02/2014, 08:20

10 699 0
w