... would not result in a deleterious anti-vector immunity The priming strategy could then be matched with heterologous vectors that expand and/ or differentiate the primed cells to therapeutically ... infections Moreover, although we focus on the functionality of CD8+ T cells in this review, we recognize the importance of CD4+ T cells and the possibility that these cells may influence the outcome ... with a DNA vaccine result in CD8 + T cells that are more resilient to negative regulatory mechanisms that would otherwise impose restrictions on the expansion and activity of this key subset of...
Ngày tải lên: 18/06/2014, 16:20
... RPQVPLRPMTY RPQVPLRPMTY d415 RPQVPLRPMTY HLA-A2 YTAFTIPSI (RT 71-81) 127-135) YTAFTIPSI YTAFTIPSI /T YTAFTIPST YTAFTIPST 127-135) d28 YTAFTIPSV d53 YTAFTIPSV d81 YTAFTIPSV d299 YTAFTIPSV/I d9 AAVDLSHFLK ... association with intra-epitopic sequence variation, and in one of these cases it appeared that an escape mutation had been transmitted that then reverted, stimulating expansion of T cells able to recognise ... Measurement of the functional avidity of CD8+ T cell responses The functional avidity of CD8+ T cell responses at sequential time-points during the first year of HIV infection was determined by peptide-titrated...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "Distinct roles of CD4+ T cell subpopulations in retroviral immunity: lessons from the Friend virus mouse model" pptx
... infections In the same context, Tregs also inhibit antitumor immune responses and restoration of anti-tumor immunity requires attenuation of Treg functions [40] The general importance of CD4 + T cells ... patients [54], is associated with an accumulation of these same cells in infected lymphatic tissues, suggesting that Tregs either redistribute to infected tissues, proliferate there, or both ... well as loss of direct cytotoxic activity against infected cells [43-45], contribute to immunodeficiency, but more important may be the loss of CD4 + T cell helper activity CD4+ T cell help is...
Ngày tải lên: 13/08/2014, 01:21
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
... primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the first PCR 5¢ primer ... 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen SSA (Eur J Biochem 271) 4077 TAAGGTGAAC-3¢) that had NcoI and BamHI restriction sites, respectively ... interest in these molecules in the treatment of several pathologies and because of the potential use of the toxins as biological weapons Alteration of their MHC and TCR binding capacity by site...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: "A robust and extensible exemplar-based model of thematic fit" ppt
... state -of- the-art thematic t models, the performance of which will be compared to that of our model Section introduces three different instantiations of our model The evaluation of the model and the ... plausibility rating In the third model, a normalization factor ensures that distance of the exemplars in the nearest neighbor set to the target item determines their weight in the calculation of the ... account to weight the exemplars Therefore, we expect the DD model to better than the kNNf model on this data set We randomly divide the data set in a 276-item development set, and a 138-items test...
Ngày tải lên: 24/03/2014, 03:20
báo cáo hóa học: " Modulation of spinal cord synaptic activity by tumor necrosis factor alpha in a model of peripheral neuropathy" potx
... hypersensitivity associated with peripheral neuropathy was attenuated by the TNFα antagonist etanercept [19, 20] The effect of TNFα is mediated by two receptors, the TNFR1 (p55) and the TNFR2 (p75) Both ... without the TNFα treatment (64.4±6.4%) TTX application in the control slices reduced the sEPSC frequency to about 80% in both TNFα untreated and treated slices Application of low concentration ... especially the tetrodotoxin-sensitive (TTXS) Nav 1.3 and tetrodotoxin-resistant (TTX-R) Nav 1.8 channels were implicated in neuropathic pain states [30] It was demonstrated that following sciatic nerve...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo y học: "Patterns of Expression of Vaginal T-Cell Activation Markers during Estrogen-Maintained Vaginal Candidiasis" doc
... show that persistent vaginal C albicans infection results in significant changes in the number, phenotypic profile, and state of activation of vaginal T cells Based on the temporal kinetics of ... experimental and control mice (data not shown) The mortality rate in the experimental group was insignificantly higher than that in the control groups (data not shown) The number of vaginal lymphocytes ... dendritic cell differentiation and activation J Immunol 2005;175:2666–75 Kametaka M, Kume A, Okada T, et al Reduction of CTLL- cytotoxic2 ity by induction of apoptosis with Fas- strogen receptor...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: " Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" docx
... rheumatoid synovium The essential factor in this situation appears to be the T cell- monocyte interaction to the extent that T- cell isolation renders the cells sensitive to apoptosis, while coculture ... apoptosis Coculturing of TTcells inin the presence of, but without direct contact with, monocytes rescues isolated T cells from glucocorticoid-induced apoptosis Graphs demonstrate that dexamethasone ... end-labeling of mediators contributes to the glucocorticoid-induced apoptosis-resistant phenotype of SF-derived T cells To confirm this, SF-isolated T cells were treated in vitro with different synthetic...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" pdf
... rheumatoid synovium The essential factor in this situation appears to be the T cell- monocyte interaction to the extent that T- cell isolation renders the cells sensitive to apoptosis, while coculture ... apoptosis Coculturing of TTcells inin the presence of, but without direct contact with, monocytes rescues isolated T cells from glucocorticoid-induced apoptosis Graphs demonstrate that dexamethasone ... end-labeling of mediators contributes to the glucocorticoid-induced apoptosis-resistant phenotype of SF-derived T cells To confirm this, SF-isolated T cells were treated in vitro with different synthetic...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc
... Activation of CD8+ cell subsets We next investigated the effect of ART on T cell activation HIV-infected individuals had higher T- cell activation in the blood as indicated by expression of HLA-DR ... Proliferation of CD8+ cell subsets Proliferating subsets are calculated by measurement of Ki67 expression The median of percentage of Ki67+CD8+ T cells elevated slightly at the first weeks of ART, then ... However, little is known about the change of CD8+ cell subsets during early period of ART In this study we investigated the dynamic changes not only in CD8+ cell subsets, but also in their activation...
Ngày tải lên: 10/08/2014, 05:22
báo cáo khoa học: " Effect of Chemokine Receptors CCR7 on Disseminated Behavior of Human T cell Lymphoma: clinical and experimental study" pps
... forward 5’-CATCACTTCC TCCTGCTCTAT-3’ and reverse 5’-CAGTTGTTGGCAATCTTCTTC-3’ (377 bp fragment); Akt, forward 5’GGACAACCGCCATCCAGACT-3’ and reverse 5’GCCAGGGACACCTCCATCTC-3’ (121 bp fragment) For amplification, ... promote tumor cell proliferation and invasion This result provides a theoretical foundation for the targeting of CCR7 and the PI3K/Akt signal pathway with antibodies for the treatment of T- NHL ... influenced tumor cell migration in vitro and the metastatic Figure The expression of PI3K mRNA in Jurkat and Hut cells after CCL21 co-culture in vitro RT-PCR amplication of the two cell lines under the...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo y học: "Lymphopenia is an important prognostic factor in peripheral T-cell lymphoma (NOS) treated with anthracycline-containing chemotherapy" docx
... performed at the time of diagnosis and prior to treatment No patients showed clinical signs of severe infection at the time of laboratory testing The study protocol was approved by the institutional ... patients with PTCL-NOS treated with anthracycline-containing chemotherapy Patients and methods Patients Patients diagnosed with PTCL between January 2000 and December 2009 from Korean institutions ... used to predict treatment outcomes or further stratify patients with the same IPI scores Castillo et al reported that a PIT score > and lymphopenia were independent prognostic factors for predicting...
Ngày tải lên: 10/08/2014, 21:23
báo cáo khoa học: "An unusual presentation of precursor T cell lymphoblastic leukemia/lymphoma with cholestatic jaundice: case report" pot
... manifestations of precursor T- ALL /T- LBL, namely, the rare initial presentation of cholestatic jaundice and the aberrant expression of synaptophysin by the tumor cells both of which, to the best of ... copy of the written consent is available for review by the Editor-in-Chief of this journal Competing interests The authors declare that they have no competing interests Authors' contributions ... represent an intermediate intrathymic maturation stage for T lymphoblasts The lack of tumor cell expression of CD34 and TdT markers, as seen in this patient, is more common in precursor T- ALL than...
Ngày tải lên: 10/08/2014, 22:20
báo cáo khoa học: " Genetic control of mammalian T-cell proliferation with a synthetic RNA regulatory system - illusion or reality?" pps
... in the near future Abbreviations ACT, adoptive cell transfer Competing interests The authors declare that they have no competing interests Authors’ contributions Both authors wrote the article ... central memory T cells with this system In vitro results showed that the population of live central memory T cells increased by 24% and that apoptotic cell popu lation was decreased by 54% in the ... Department of Experimental Therapeutics, University of Texas, MD Anderson Cancer Center, Houston, TX 77030, USA 2Institute of Gastroenterology, Department of Internal Medicine, Yonsei University...
Ngày tải lên: 11/08/2014, 12:21
Báo cáo y học: " Increased production of viral proteins by a 3''''-LTR-deleted infectious clone of human T-cell leukemia virus type 1" ppsx
... epithelial 29 3T cell line RT-PCR of the transfected 29 3T cells with Δ3' LTR and Δ3' LTR BstEII demonstrated that the cells expressed mRNA sequences corresponding to the tax gene However, the cells ... complete provirus clone These results suggest that the sequence between 40 nucleotides (nt) and 113 nt at the AatII site downstream from the beginning of the 3' LTR, which constitutes the C-terminal ... or with the Δ3' LTR clone 2-3 days after transfection or with pUC19 two days after transfection MT-2, total RNA extracted from the HTLV-1-infected cell line MT-2 was used as the positive control;...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps
... equivalent to that of Tax300 (Fig 3B) However, the substitutions of only the first three or the last two minimally and partially reduced the activities, respectively, although the amount of Tax1231-232 ... A) http://www.retrovirology.com/content/6/1/83 Tax Figure The transforming activities of the Tax1 chimeric proteins with Tax2B The transforming activities of the Tax1 chimeric proteins with Tax2B ... performed the most of analysis RK and MT produced Tax mutant constructs YT provided the anti-Tax antibody MF made substantial contributions to the conception and design of the study, wrote and drafted...
Ngày tải lên: 12/08/2014, 23:22
Báo cáo y học: "ATF3, an HTLV-1 bZip factor binding protein, promotes proliferation of adult T-cell leukemia cells" docx
... directly and without ubiquitination, of some proteins that interact with HBZ [17] Thus, HBZ interacts with host factors and modulates their function, which is likely to contribute to persistent ... without interfering with the suppressive function of ATF3 These results suggest that ATF3 suppresses Taxmediated ATF/CRE-dependent transcription both of cellular genes and the HTLV-1 LTR ATF3 has ... ATL patient immunoprecipitation assay detected ATF3 bound to the proximal AP-1 site, but ATF3 bound to ATF site was non-specific (Figure 5E) Transient transfection of Jurkat T cells by electroporation...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Inactivation of tumor suppressor Dlg1 augments transformation of a T-cell line induced by human T-cell leukemia virus type 1 Tax protein" ppsx
... 5'-gaaagaacgagcccgattaTTCAAGAGAtaatcgggctcgttctttcTTTTT-3' for hDlg1-1, 5'gtgttcagtctgtacgagaTTCAAGAGAtctcgtacagactgaacacTTTTT-3' for hDlg1-3, 5'gagtggatgccacgacggtttGTGTGCTGTCCaaatcgtcgtggtattcactcTTTTT-3' ... respectively The sequences of these oligonucleotides are 5'-ggatggcgagctttaggttggGTGTGCTGTCCccaatctgaagcttgccatccTTTTT-3' for Dlg1-1, 5'ggatgtttaggagtataagttGTGTGCTGTCCaacttatgctcctgaatatccTTTTT-3' for ... CAT, 5'-ggcctttcactgctcctgcgaGTGTGCTGTCCtcgtaggagtagtgaaaggccTTTTT-3' for LUC, and 5'gcctttcactactcctacgTTCAAGAGAcgtaggagtagtgaaaggcTTTTT-3' for Rluc The oligonucleotides Dlg1-1, Dlg1-3, CAT,...
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: " The HBZ-SP1 isoform of human T-cell leukemia virus type I represses JunB activity by sequestration into nuclear bodies" ppsx
... combination with other transcription factors [11] The production of IL-2 by activated T cells is critical for T- cell proliferation and differentiation, and the development of T- cell- dependent immune ... demonstrated that the relocalization of endogenous JunB into HBZ-NBs is associated with repression of its activity It is worth noting that we have previously demonstrated that the DNAbinding activity ... HeLa cells In contrast to untransfected cells, quiescent cells transfected with pEGFP-HBZ-SP1 failed to progress through the G1/S transition when they were stimulated by serum to enter the cell...
Ngày tải lên: 13/08/2014, 09:20