``avidity model´´ on our understanding of peripheral t cell regu
báo cáo khoa học: " Effect of Chemokine Receptors CCR7 on Disseminated Behavior of Human T cell Lymphoma: clinical and experimental study" pps
... promote tumor cell proliferation and invasion This result provides a theoretical foundation for the targeting of CCR7 and the PI3K/Akt signal pathway with antibodies for the treatment of T- NHL ... different concentration of CCL21 The relative grey scale of PI3K mRNA in Hut cell was higher than that in Jurkat cell with corresponding concentration of CCL21 there were some difference on the grey ... the group with different concentration of CCL21 of each cell lines b-actin is positive control in RT-PCR amplication Figure The expression of Akt mRNA, Akt protein and p-Akt protein in Jurkat...
- 9
- 410
- 0
Báo cáo khoa học: Analysis of the NADH-dependent retinaldehyde reductase activity of amphioxus retinol dehydrogenase enzymes enhances our understanding of the evolution of the retinol dehydrogenase family pot
... positive control of the reaction The bars represent the net retinal production per mg of total protein after h of incubation with 5, 10 and 20 lM all-trans-retinol that nuclear or cytosolic staining ... represent the net retinol production per mg of total protein after h of incubation with the three substrate concentrations (B) Retinol oxidation in transfected cells was also evaluated for RDH1, RDH2 ... Dalfo et al To analyze the contribution of protein domains to the ER anchorage, the localization of the full-length enzyme was compared with those of five truncated forms The pattern of the full-length...
- 14
- 477
- 0
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf
... protease (black doted arrows) The F protein is generated by translation of an alternative reading frame but no functions have yet been attributed to this protein acute phase of infection that ... sufficient to detect viral RNA by northern blot analysis Improvement of the system was obtained after the discovery of cell- culture-adaptative mutations that enhanced the replication efficiency by up to ... inoculation of chimpanzees with a Con1 sequence containing these adaptative mutations failed to establish a productive infection [7] On the other hand, production of infectious particles in Huh7 cells...
- 14
- 532
- 0
Báo cáo khoa học: Multidrug efflux pumps: The structures of prokaryotic ATP-binding cassette transporter efflux pumps and implications for our understanding of eukaryotic P-glycoproteins and homologues ppt
... written subsequent to these retractions and the most pertinent comments appear in Petsko [32], with its cautionary reminder that structural data should be consistent with the majority of the ... how is the extent of domain separation controlled? What are the attractive forces that bring the domains back into contact – is it possible that electrostatic attraction across a solventfilled ... Kerr et al The structure of eukaryotic ABC multidrug pumps ˚ short of the goal of an atomic resolution (3 A or better) structure that could allow rational interpretation of the MDR phenomenon in...
- 14
- 401
- 0
Báo cáo y học: "Recent advances in our understanding of human host responses to tuberculosis" doc
... components of the initiation of the immune response, because it has recently been demonstrated that CD43 is involved in the stable interaction of mycobacteria with other cell- surface receptors that ... tuberculosis infection, and in response to stimulation with M tuberculosis-infected target cells produced significant amounts of interferon-γ Interestingly, recognition of infected cells by CD8+ T cells ... relative contributions of the TLR2 and TLR4 subsets of receptors when they are activated by different mycobacterial components Both of these receptors can be activated by live M tuberculosis, although...
- 7
- 240
- 0
Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf
... intra-epitopic mutations within the first year following presentation and the majority of these mutations were confirmed to confer T cell escape There are, however, limitations to the use of this ... association with intra-epitopic sequence variation, and in one of these cases it appeared that an escape mutation had been transmitted that then reverted, stimulating expansion of T cells able to ... T cell receptor (TCR) The impact of escape from any given epitope-specific T cell response will depend on the relative contribution of that response to overall containment of virus replication...
- 13
- 370
- 0
Báo cáo y học: "Distinct roles of CD4+ T cell subpopulations in retroviral immunity: lessons from the Friend virus mouse model" pptx
... infections In the same context, Tregs also inhibit antitumor immune responses and restoration of anti-tumor immunity requires attenuation of Treg functions [40] The general importance of CD4 + T cells ... subpopulation of natural regulatory T cells at sites of infection The natural regulatory T cells suppressed effector T cell responses, which interfered with immune control of virus replication and contributed ... Surprisingly, it was suggested that the protective effect of the CD4 epitope vaccine was dependent on NK cells, as NK cell depletion after vaccination abolished the effect of peptide immunization [79] Studies...
- 12
- 264
- 0
Báo cáo sinh học: " Protection against the allergic airway inflammation depends on the modulation of spleen dendritic cell function and induction of regulatory T cells in mice" docx
... with the animal ethics regulations of the Home Office, UK Construction of OVA-Fc-pcDNA3.1 immunization vector To construct the DNA vaccine containing OVA and Fc fusion gene targeting DCs, the ... immature and mature DCs, resulting in tolerogenic interaction with T cells in SIT We found that the combination of DNA vaccination with Fc and OVA had better effects onOVAinduced alterations in the ... novel pathway of regulation of type immunity in asthma Competing interests The authors declare that they have no competing interests Authors' contributions YL performed all analyses and wrote the...
- 8
- 258
- 0
Our understanding of global geology during the 20th century(notes 6)
... start of this century geologists started to uncover evidence that contradicted the existing theories of global geology Firstly, the data on cooling indicated that too little contraction of the ... magnetized in this way By studying both the horizontal and vertical components of the remnant magnetism one can tell not only the direction to magnetic north at the time of the rock's formation, ... Planet Earth • Steven Earle • 2010 part of the core is in motion - and it is this motion - of a material that conducts electricity - that gives the earth its magnetic field Seismologists continue...
- 13
- 125
- 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
... primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the first PCR 5¢ primer ... 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen SSA (Eur J Biochem 271) 4077 TAAGGTGAAC-3¢) that had NcoI and BamHI restriction sites, respectively ... Vb5.2 concentrationdependent binding to both SSA species was observed The association rate constant (kass) was too fast to be accurately measured On the contrary, the dissociation rate constant (kdiss)...
- 9
- 485
- 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc
... [42]) This tandem co-regulation of inhibitory receptors [45-47] raised the possibility that this phenomenon, consisting of the generation of specific T cells that fail to up-regulate PD-1, extends ... restrictions on the expansion and activity of this key subset of T cells? To test our hypothesis, we compared the global gene expression in epitope-specific CD8+ T cells generated by vaccination ... production by monocytes impairs CD4 + T cell activation, further amplifying the pathogenesis [55] Instead of supporting Bot et al Journal of Translational Medicine 2010, 8:132 http://www.translational-medicine.com/content/8/1/132...
- 11
- 505
- 0
Báo cáo y học: "Patterns of Expression of Vaginal T-Cell Activation Markers during Estrogen-Maintained Vaginal Candidiasis" doc
... appearance of the localized response This is consistent with the current understanding that CMI at the mucosa level partially derives from the systemic immune circuit.17 Persistent upregulation of CD152, ... possibly by upregulating the expression of CD152 on vaginal and peripheral T cells Furthermore, resolution of the infection may depend on the ability of T lymphocytes to counter immunosuppression, possibly ... Abu- lteen KH Vaginal candidiasis induces a E systemic acute phase reactant rotein- ependent iron- estrictive envip d r ronment that limits dissemination of the infection Medimond International...
- 7
- 346
- 0
Báo cáo y học: " Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" docx
... cell- cell interaction in the rheumatoid synovium The essential factor in this situation appears to be the T cell- monocyte interaction to the extent that T- cell isolation renders the cells sensitive ... interaction are essential for the induction of the T- cell apoptosis-resistant phenotype To further investigate the mechanism responsible for the resistance of T cells to glucocorticoid-induced apoptosis, ... analyzed the importance of cellular contact versus soluble factor(s) Isolated T cells were cultured in the presence of, but without direct contact with, isolated SF-derived monocytes Incubation with...
- 9
- 304
- 0
Báo cáo y học: "Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" pdf
... cell- cell interaction in the rheumatoid synovium The essential factor in this situation appears to be the T cell- monocyte interaction to the extent that T- cell isolation renders the cells sensitive ... interaction are essential for the induction of the T- cell apoptosis-resistant phenotype To further investigate the mechanism responsible for the resistance of T cells to glucocorticoid-induced apoptosis, ... analyzed the importance of cellular contact versus soluble factor(s) Isolated T cells were cultured in the presence of, but without direct contact with, isolated SF-derived monocytes Incubation with...
- 9
- 397
- 0
Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc
... lower detection limit (LDL) in most patients after month of ART (data not shown) Another reason is the potential exist of various opportunistic viral and bacterial infections T- cell proliferation ... Activation of CD8+ cell subsets We next investigated the effect of ART on T cell activation HIV-infected individuals had higher T- cell activation in the blood as indicated by expression of HLA-DR ... Proliferation of CD8+ cell subsets Proliferating subsets are calculated by measurement of Ki67 expression The median of percentage of Ki67+CD8+ T cells elevated slightly at the first weeks of ART, then...
- 7
- 338
- 0
Báo cáo y học: "Lymphopenia is an important prognostic factor in peripheral T-cell lymphoma (NOS) treated with anthracycline-containing chemotherapy" docx
... Korea Authors’ contributions YRK involved in conception, design, data interpretation, and manuscript writing JSK performed data interpretation and revising it critically for intellectual content SJK ... differential and chemistry were performed at the time of diagnosis and prior to treatment No patients showed clinical signs of severe infection at the time of laboratory testing The study protocol ... TRM, treatment related mortality; ALC, absolute lymphocyte count Kim et al Journal of Hematology & Oncology 2011, 4:34 http://www.jhoonline.org/content/4/1/34 was 53.2% (42 of 79 patients) and the...
- 9
- 312
- 0
báo cáo khoa học: "An unusual presentation of precursor T cell lymphoblastic leukemia/lymphoma with cholestatic jaundice: case report" pot
... liver function tests, per the recommendations of the treating oncologist, the treatment was initiated with cisplatin and dexamethasone (CD) for a total of cycles to be followed by cycles of Hyper ... copy of the written consent is available for review by the Editor-in-Chief of this journal Competing interests The authors declare that they have no competing interests Authors' contributions ... highlights two unusual manifestations of precursor T- ALL /T- LBL, namely, the rare initial presentation of cholestatic jaundice and the aberrant expression of synaptophysin by the tumor cells both of...
- 6
- 338
- 0
báo cáo khoa học: " Genetic control of mammalian T-cell proliferation with a synthetic RNA regulatory system - illusion or reality?" pps
... system shows tight drug-mediated regulation of growth over an extended time period Taking all these features into consideration, it is feasible that this new synthetic RNA-based regulatory system ... non-coding RNA Center and the Department of Experimental Therapeutics, University of Texas, MD Anderson Cancer Center, Houston, TX 77030, USA 2Institute of Gastroenterology, Department of Internal ... proliferation/viability) In addition to all the in vitro evidence, the authors [2] demonstrated that this system worked in vivo and effectively modulated the T- cell growth rate in mice in response to...
- 3
- 239
- 0
Báo cáo y học: " Increased production of viral proteins by a 3''''-LTR-deleted infectious clone of human T-cell leukemia virus type 1" ppsx
... first found to inhibit the Tax-mediated transactivation of viral transcription from the 5' LTR by heterodimerizing with Jun and CREB2 [17] None of the constructed Δ3' LTR clones contained the ... or with the Δ3' LTR clone 2-3 days after transfection or with pUC19 two days after transfection MT-2, total RNA extracted from the HTLV-1-infected cell line MT-2 was used as the positive control; ... TATA box 2-3 days after transfection The results of RT-PCR detection of tax mRNA in cells transfected with the various clones are shown on the left side Page of (page number not for citation...
- 5
- 260
- 0
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps
... performed the most of analysis RK and MT produced Tax mutant constructs YT provided the anti-Tax antibody MF made substantial contributions to the conception and design of the study, wrote and drafted ... classify the four HTLVs into three or four separate groups We believe that the characterizations of these two motifs of Tax will unveil the functions associated with the respective pathogenesis of the ... unstable in CTLL-2, and was excluded from consideration Taken together, these results suggest that the Tax1(185227) region negatively regulates the transforming activity of Tax1, and the activity...
- 11
- 548
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose