New generation molecular epidemiology overview

New generation molecular epidemiology:  Lecture 14: Overview National Institute of Infectious Disease January 19, 2017 Infectious disease epidemiological problems addressed by  molecular biology techniques (2016) • • • • • • • • • • • • • • Tracking strains across time and geography Distinguishing endemic from epidemic disease occurrence Stratification of data to refine study designs Distinguishing pathovars vs commensal flora or saprophytes Identifying new modes of transmission Studying microorganisms associated with healthcare or institutional infections Surveillance and monitoring response to intervention Characterizing population distribution and determinants of distribution of parasites Identifying genetic basis for disease transmission Validating microdiversity genotyping methods applied to epidemiology Virus quasispecies population structure analysis Identifying direction and chain of transmission Identifying hidden social networks and transmission links Analyzing microbiomes to study non‐infectious disease epidemiology NGS Laboratory‐based data stratification—core principle in molecular  epidemiology Microbial  population in a  “sterile” niche Pure culture DK Find Out! Microbial  population in a  non‐sterile niche Separation Identification to  the species level www.hyserve.com Phenotypic subtyping -serotype -drug resistance Genotyping HealthDefine.com www.webmd.boots.com Clone or  San Jose Functional Medicine clonal  complex What is a “clone” or “clonal complex”? • What happens when whole genome sequences (WGS) are compared? • What is the threshold (number or type of nucleotide substitutions) needed to  exclude or include a group of bacterial strains in a same clonal group or complex.    A E coli: MLST 69; Nearly identical PFGE Strain A ATGTCTACGAGAAGAGAAGTTATTCTTTCCTGGTTGTGTGAGAAACGTCAAACCTGGCGTCTATGC TATTTGTTGGGTGAGGCTGGAAGTGGAAAAACCTGGCTGGCGCAGCAACTGCAAAAAGATAAACA TCGCCGTGTGATTACTTTAAGCCTCGTTGTTTCCTGGCAAGGTAAGGCCGCATGGATCGTTACCGA CGATAACGCGGCT Strain B ATGTCTACGAGAAGAGAAGTTATTCAAACCTGGTTGTGTGAGAAACGTCAAACCTGGCGTCTATGC TATTTGTTGGGTTAGGCTGGAAGTGGAAAAACCTGGCTGGCGCAGCAACTGCAAAAAGATAAACAT CGCCGTGTGATTACTTTAAGCCTCGTTGTTTGGAGGCAAGGTAAGGCCGCATGGATCGTTACCGA CGATAACGCGGCT B What is a “clone” or “clonal complex”? • What happens when whole genome sequences (WGS) are compared? • What is the threshold (number or type of nucleotide substitutions) needed to  exclude or include a group of bacterial strains in a same clonal group or complex.    A E coli: MLST 69; Nearly identical PFGE Strain A ATGTCTACGAGAAGAGAAGTTATTCTTTCCTGGTTGTGTGAGAAACGTCAAACCTGGCGTCTATGC TATTTGTTGGGTGAGGCTGGAAGTGGAAAAACCTGGCTGGCGCAGCAACTGCAAAAAGATAAACA TCGCCGTGTGATTACTTTAAGCCTCGTTGTTTCCTGGCAAGGTAAGGCCGCATGGATCGTTACCGA CGATAACGCGGCT Strain B ATGTCTACGAGAAGAGAAGTTATTCTTTCCTGGTTGTGTGAGAAACGTCAAACCTGGCGTCTATGC TATTTGTTGGGTGAGGCTGGAAGTGGAAAAACCTGGCTGGCGCAGCAACTGCAAAAAGATAAACA TCGCCGTGTGATTACTTTAAGCCTCGTTGTTTCCTGGCAAGGTAAGGCCGCATGGATCGTTACCGA CGATAAC GCT B Evolutionary vs epidemiologic relatedness • Evolutionary relatedness: • Based on a model or consensus definition • Epidemiologic relatedness: • Based on evolutionary relatedness data • Based on empirically‐validated data • Outbreak investigation • Analytical study that identified a risk factor associated with clone  or clonal complexes • Other empirically‐determined relatedness data independent of  genetic information Phylogenetic tree based on 1278 core genes of 186 E. coli strains (Kaas et al,  2012) Phylogenetic tree of E. coli O157:H7 by their core  genes (Kaas RS et al, 2012) Scope of investigations covered by next generation molecular  epidemiology Identifying … • risk factors that could not be identified by conventional or early‐ generation molecular biology laboratory methods • new or hidden transmission pathways • direction of transmission of an infectious agent • endogenous reactivation vs exogenous reinfection • ecological niche from which  clonal pathogenic strains are selected and  disseminate • pathogen microbial population structures associated with a syndrome  • host commensal microbial population structures that determine non‐ communicable disease outcomes Types of sequencing applications • Targeted sequencing • Whole genome sequencing • Metagenomics (deep sequencing) • RNAseq WWW.clcbio.com www.sanger.ac.uk bgiamericas.com Targeted sequencing • Used to profile phylogenetic or taxonomic diversity of microbes (of  one microbial group—e.g., bacteria) • Applied to compare taxonomic relationships of isolates from different  places and time • Primarily used in phylogenetics or molecular evolution research • Data generated from targeted sequencing can be used for  epidemiologic investigations Targeted sequencing…cont • Example‐‐Bacteria: ribosomal small subunit (SSU)‐‐16S rRNA sequences • present in all bacteria,  • Has sequences that are nearly identical in all bacteria  • Has hypervariable regions that differ between different taxa • Example‐‐Fungi: Internal transcribed spacer (ITS); large subunit (LSU,  or 18S, 28S rRNA); SSU Whole genome sequencing (WGS) • Applications: • Phylogenetic or evolutionary analysis: • Strains belonging to the same species  • Assessing temporal changes of clonal lineages • Epidemiologic applications: many Metagenomics (deep sequencing) • Applied to profile microbial community‐‐phylogenetic or taxonomic  diversity analysis of all microbes (bacteria, viruses, fungi, protozoa)  within a complex microbial community • Not targeted to specific genes or microbial group • Based on fragments of all DNA extracted from a niche • Can assess taxonomic composition and functional genetic  composition • Potential function assessed by querying  sequence reads against databases: • KEGG (Kyoto Encyclopedia of Genes and Genomes)(http://www.genome.jp/kegg/pathway.html ) • COG (Clusters of Orthologous Groups of proteins) (http://www.ncbi.nlm.nih.gov/COG/ ) ... Scope of investigations covered by next? ?generation? ?molecular? ? epidemiology Identifying … • risk factors that could not be identified by conventional or early‐ generation? ?molecular? ?biology laboratory methods • new? ?or hidden transmission pathways... Analyzing microbiomes to study non‐infectious disease? ?epidemiology NGS Laboratory‐based data stratification—core principle in? ?molecular? ? epidemiology Microbial  population in a  “sterile” niche... Identifying genetic basis for disease transmission Validating microdiversity genotyping methods applied to? ?epidemiology Virus quasispecies population structure analysis Identifying direction and chain of transmission