Discovery of novel small molecule for treatment of neuropathic pain

平成30年度 博士学位論文 神経障害性疼痛改善を 目指した新規有機小分子の創製 Discovery of Novel Small Molecule for Treatment of Neuropathic Pain 富山大学大学院 生命融合科学教育部 先端ナノ・バイオ科学専攻 NGUYEN HUY DU 神経障害性疼痛改善を 目指した新規有機小分子の創製 Discovery of Novel Small Molecule for Treatment of Neuropathic Pain A dissertation submitted to the Graduate School of Innovative Life Science, University of Toyama Toyama, Japan for the degree of DOCTORATE OF PHILOSOPHY (Ph.D.) in Advanced Nanosciences and Biosciences March 2019 By NGUYEN HUY DU Contents Abbreviation Introduction Chapter.1 Recognizing prenylflavanones as novel T-type calcium channel blockers useful for pain therapy .13 1.1 Introduction 13 1.2 Results 14 1.3 Discussions 22 1.4 Conclusion 24 Chapter.2 Design and synthesis of novel anti-hyperalgesic agents based on 6-prenylnaringenin 25 2.1 Introduction 25 2.2 Results 25 2.3 Discussion 29 2.4 Conclusion 31 Chapter.3 T-type calcium channel blockers as anti-hyperalgesic agents against bortezomib-induced peripheral neuropathy 32 3.1 Introduction 32 3.2 Results 33 3.3 Discussion 37 3.4 Conclusion 39 Conclusion 40 Acknowledgment 41 Experimental section 42 Experiment of chapter.1 42 Supplementary of chapter.1 48 Experiment of chapter.2 49 Experiment of chapter.3 89 Reference 92 List of related articles 100 Page Abbreviation BBB The blood-brain-barrier BIPN BTZ-induce peripheral neuropathy BTZ Bortezomib CaV3.1-HEK cells CaV3.1-expressing HEK293 cells CaV3.2-HEK cells CaV3.2-expressing HEK293 cells CFZ Carfilzomib CIPN Chemotherapy-induce peripheral neuropathy CNS Central nervous system DRG Dorsal root ganglia ERK Extracellular signal-regulated kinases FDA U.S Food and Drug Administration GAPDH Glyceraldehyde-3-phosphate dehydrogenase HVA-channels Voltage-activated calcium channels HVA-channel-NG108-15 cells Neuron-like differentia ted NG108-15 cells expressing HVA-channels HVA-currents HVA-channel-dependent currents i.col Intracolonic i.p Intraperitoneal i.pl Intraplantar i.t Intrathecal IXZ Ixazomib KTt-45 6-(3-ethylpent-2-enyl)-5,7-dihydroxy-2-(2hydroxyphenyl)chroman-4-one, 8j L-channel L-type calcium channels LVA channels Low voltage-activated calcium channels MM Multiple myeloma MOM ether Methoxymethyl ethers NaV-channels Sodium channels NaV-channel-NG108-15 cells Neuron-like differentiated NG108-15 cells expressing NaV-channels NaV-currents NaV-channel-dependent currents OHP Oxaliplatin PFVNs Prenylflavanones PI Proteasome inhibitor PKC Protein kinase C PNG Prenylnaringenin PSNL Partial sciatic nerve ligation QoL Quality of Life SAR Structure-activity relationship SG Sophoraflavanone G T-channels T-type calcium channels T-currents T-channel-dependent currents USP5 Ubiquitin-specific peptidase VGC channels Voltage-gated calcium channels WWP1 a plasma-membrane-associated ubiquitin ligase WW Domain Containing E3 Ubiquitin Protein Ligase Page Introduction Pain is often a result of the activation of neurons to sense harmful stimuli of acute events that are able to injure peripheral tissue such as the skin and internal organs This form of pain, called nociceptive pain, is self-protective, which typically produces actions aimed at limiting or avoiding further tissue damage The nociceptive pain occurs in five phases including transduction, conduction, transmission, modulation and perception, which can be briefly described as follows In transduction phase, the pain stimuli (mechanical, chemical or thermal) are detected and converted into action potentials (electrical energy) by peripheral nociceptors (free afferent nerve ending) that innervate the skin and organ tissues In conduction phase, the peripheral action potentials propagate along the primary afferent fiber (Aδ and C type) to synaptic nerve terminals in the spinal dorsal horn The transmission phase begins when the peripheral action potentials reach the pre-synaptic terminal in the spinal dorsal horn The peripheral action potentials cause the pre-synaptic terminals of Aδ and C fibers to release a variety of pro-nociceptive substances into the synaptic cleft (neurotransmitter release) for activating of post-synaptic receptors This activation results in an influx of ions that depolarize second order neurons and interneurons When a secondary neuron is depolarized, it generates an action potential that project to central nervous system (CNS) where the perception phases of pain occur (Fig 1) [1] The pain perception is a key component of the clinical pain experience that integrates cognitive and affective (emotional) responses [2] The pain modulation which is also called as transformation or plasticity, meaning pain perception variability, may provide facilitation or inhibition of nociceptive signals by several mechanisms The pain modulation phases occur at synaptic sites and at the level of the CNS through ascending, descending, or regional facilitation and inhibition [2] Figure Role of voltage-gated calcium channels in the primary afferent pain pathway Harmful stimuli (such as pressure, heat and cold) are detected by nerve endings embedded in the skin or organs, leading to the generation of action potentials that travel along the afferent fiber to synaptic terminals in the spinal dorsal horn, where neurotransmitter release activates postsynaptic neurons that project to the brain Ca V3.2 calcium channels regulate afferent fiber excitability and contribute to calcium influx in synaptic nerve terminals CaV2.2 channels are located pre-synaptically where their opening allows calcium entry and leads to neurotransmitter release CNS, central nervous system (Zamponi, G.W Nat Rev Drug Discov.2015, 15, 19-34) [1] Page Figure Diagram showing the various mechanisms involved in neuropathic pain at different sites in the nociceptive pathway AMPA=α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid; ASIC=acid sensing ion channel; B1/B2=bradykinin receptor 1/2; BDNF=brain derived neurotrophic factor; CCL=chemokine (C-C motif ) ligand; CC-R2=CC-chemokine receptor; DAMPs=danger associated molecular patterns; EPR=prostaglandin E2 sensitive receptor; GABA: γ-aminobutyric acid; Glu=glutamate; H1R=histamine receptor; 5-HT=5-hydroxytryptamine; IL=interleukin; KCC=potassium-chloride cotransporter; m-Glu=metabatropic glutamate; NGF=nerve growth factor; NK=neurokinin; NMDA=N-methyl-D-aspartate; PAMPs: pathogen associated molecular patterns; PG=prostaglandin; P2X=purinergic receptor channel; -R=receptor; SP=substance P; TLR=toll-like receptor; TNF=tumor necrosis factor; Trk=tyrosine kinase; TTxR=tetrodotoxin resistant sodium channel; TTxS=tetrodotoxin sensitive sodium channel; VR=vanilloid receptor (transient receptor potential cation channel subfamily V member TRPV-1) (Cohen, S.P and Mao, J BMJ 2014, 348: f7656) [2] Page Table 1: Evidence for pharmacotherapy based on mechanisms of neuropathic pain [2] (partial modification) Mechanism Symtoms Target Treatment Evidence Phosphorylation of Hyperalgesia, TRPV-1 TRPV1 receptor Strong evidence for TRPV-1 by PKC burning, and antagonists peripheral NP other SP (capsazepine) Release of proinflaSP, hyperalgesia, Cytokines: TNF-α, Cytokine inhibitors Strong evidence for mmatory cytokines inflammation IL-1β, IL-6, and (infliximab) conflicting results in from immune cells other interleukins human studies for NP Release of nerve Hyperalgesia, Nerve growth Nerve growth factor Moderate evidence for growth factor and burning and other factor and its inhibitors NP in preclinical studies other neurotrophins SP, inflammation receptors (tanezumab) from mast cells (trkA/p75) Release of substance Hyperalgesia NK1 receptor NK1 receptor Evidence in preclinical P in the dorsal horn antagonists but not clinical studies (aprepitant) Proliferation of and SP, Tinel’s sign TTx sensitive and Sodium channel Moderate to strong redistribution of resistant sodium blockers evidence for peripheral sodium channels channels (carbamazepine) NP Increased expression of Hyperalgesia CB1 and CB2 CB receptor Strong preclinical and CB receptors in the receptor agonists clinical evidence for a peripheral and central (dronabinol) modest effect for central NS, and in glial cells and peripheral NP Activation of spinal Hyperalgesia, NMDA receptor NMDA receptor Strong preclinical and NMDA receptors opioid tolerance antagonists clinical evidence for peri(ketamine) pheral and central NP Increased expression Hyperalgesia, SP N-type, L-type, and Calcium channel Strong evidence for of VGCCs at DRG and T-type calcium antagonists peripheral and central presynaptic terminals channels (gabapentin) NP Increased release of Hyperalgesia, SP, CGRP receptors CGRP receptor Evidence in preclinical CGRP from primary inflammation antagonists studies; in clinical afferents (telcagepant) studies, strong evidence only for migraine Increased expression SP, pain Sympathetic α-adrenoceptor Weak evidence for and sensitivity of αexacerbated by ganglia, antagonists short term effect for adrenoceptors, symcold and stress sympathetic NS (phentolamine) peripheral NP pathetic sprouting Reduced descending Hyperalgesia, SP, µ opioid receptors, µ opioid agonists, Strong evidence inhibition/facilitated anxiety GABA receptor, GABA agonists, for opioids and transmission Serotonin/norepine- antidepressants, antidepressants, but phrine reuptake and serotonin/norepine- weak, negative or adenosine reuptake phrine, adenosine conflicting evidence for reuptake inhibitors other drug classes in NP Diminished spinal Hyperalgesia, SP, GABA and glycine GABA A and B Negative or weak inhibition anxiety receptors receptors agonists positive evidence in (benzodiazepines) clinical studies Glial cell activation Hyperalgesia, Phosphodiesterase Phosphodiesterase Evidence in preclinical, opioid tolerance enzyme inhibitors but not clinical studies (pentoxifylline) for NP Activation of p38 Hyperalgesia, P38 mitogen Microglial Evidence in preclinical mitogen activated opioid tolerance activated protein inhibitors studies, but mostly protein kinase/ kinase (losmapimod) negative evidence in microglial activation clinical trials CB=cannabinoid; CGRP=calcitonin gene related peptide; GABA=γ-aminobutyric acid; IL=interleukin; NK=neurokinin; NMDA=Nmethyl-D-aspartate; PKC= protein kinase C; TNF-α=tumor necrosis factor α; trkA=tropomyosin related kinase A; TRPV-1=transient receptor potential cation channel subfamily V member or vanilloid receptor subtype VGCC=voltage-gated calcium channel; NP=neuropathic pain; NS=nervous system and SP=spontaneous pain Page Neuropathic pain results from injury to or dysfunction of the somatosensory nervous system, which typically outlasts the initial stage of injury and frequently leads to debilitating disorders [2,3] Neuropathic pain can be distinguished from nociceptive pain by two factors Firstly, in neuropathic pain there is no transduction: spontaneous neuropathic pain is often more common and distressing than evoked pain in clinical practice Secondly, the prognosis is worse: injury to major nerves is more likely than injury to non-nervous tissue to result in chronic pain In addition, neuropathic pain tends to be more refractory than non-neuropathic pain to conventional analgesics, such as non-steroidal anti-inflammatory drugs and opioids [2] After nerve injury, dorsal root ganglia (DRG) (see Fig 2) exhibit decreased expression of µ opioid receptors and secondary spinal neurons become less responsive to opioids By contrast, inflammation may result in an increase in the number and affinity of opioid receptors, thereby enhancing the efficacy of opioids This may explain why patients with chronic neuropathic pain require higher doses of opioids than those with acute and chronic nociceptive pain [2,4] According to an Institute of Medicine report released in 2011, one in three Americans experiences chronic pain, which is more than the total number affected by heart disease, cancer, and diabetes combined In Europe, the prevalence of chronic pain is 2530% About a fifth of people who report chronic pain are thought to have predominantly neuropathic pain [2] At present, over 26 million patients worldwide suffer from the symptoms of neuropathic pain [5] However, available pain therapies remain insufficient for neuropathic pain, which only provides 30-50% relief of pain in only around 50% patients [5]; and often have side effects such as dizziness, constipation, blurred vision, etc [3] The mechanism of neuropathic pain, including peripheral, spinal, supraspinal mechanism and disinhibition, were discussed in detail in the review of Cohen et al [2] Thereby, Cohen et al confirmed that the adjuvants used to treat neuropathic pain tend to have only a modest effect and in a minority of patients, although the development of such drugs was based on the mechanisms of neuropathic pain (see Table 1) Therefore, discovery of safer and more effective drug for neuropathic pain is a great medical challenge To overcome this challenge, many previous studies have focused on voltage-gated calcium (VGC) channels due to their function in nociception The functions of peripheral and central pain pathways were modulated by VGC channels which influence fast synaptic transmission and neuronal excitability [1,3] Based on their voltage-dependent activation, the VGC channels were classified into either high voltage-activated (HVA) channels or low voltage-activated (LVA) channels The LVA channels require smaller membrane depolarization to open, which allows the LVA channels to function at near-resting membrane potentials, about −70 mV (that is, low threshold of voltage activation); while the HVA channels require more positive membrane potentials to open (that is, high threshold of voltage activation) Moreover, the opening of the LVA channels is transient due to their rapidly inactivating, in comparison to that of the HVA channels, so the LVA channels were called transient calcium channels or T-type calcium channels (T-channels) while the HVA channels were called sustained current calcium channels, especially L-subtype well-known as long-lasting calcium channels The mammalian nervous system expresses nine of the ten VGC channel isoforms, except for the skeletal-muscle-specific CaV1.1 channels that belong to the L-subtype (L-type) calcium channels [1,6] In the past, drug discovery attention focused on the modulation of different subtypes of the HVA calcium channels, including L-, N-, P-/Q- and R-type calcium Page channels Among them, CaV1.2 and CaV1.3 channels belonging to the L-type calcium channels were regarded in early because they are expressed in most types of neurons and often localized on cell bodies and at dendritic regions of neurons [7] Next, CaV2.2 channels (Ntype) are almost exclusively expressed at pre-synapses of primary afferent nerve terminals in the spinal dorsal horn, so their opening allows calcium entry and leads to neurotransmitter release [1] (see Fig 1) Z160, CaV2.2 channel inhibitor, mediates potent analgesia in several animal models of pain [8] Unfortunately, this compound failed two different Phase II clinical trials for lack of efficacy TROX-1 and CNV2197944, other CaV2.2 channel blockers, have completed Phase I clinical trials and is now in Phase II trials for postherpetic neuralgia and painful diabetic neuropathy [1] Finally, there is emerging evidence that CaV2.3 channels (Rtype) may be involved in pain signaling because of the expression of these channels in DRG neurons and in the spinal dorsal horn [9] Intrathecal delivery of the CaV2.3 inhibitor SNX482 (a peptide derived from the venom of a Tarantula species) alleviates formalin-induced pain and neuropathic pain in rodents [10,11] Despite decades of drug discovery efforts, only a few calcium channel therapeutics other than dihydropyridines have entered the clinic This result emphasizes that it is so difficult to find out the compounds that have high affinity, high target selectivity and appropriate physicochemical properties; effectively cross the blood-brain barrier (BBB); are not rapidly metabolized; and are non-toxic In almost last decade, T-channels consisting of three subtypes: CaV3.1, CaV3.2 and CaV3.3 channels have been considered as novel targets to develop safer and more effective drugs for neuropathic pain [3] By virtue of their hyperpolarized voltage-activation range and window current, T-type calcium channels are ideally suited to regulate neuronal excitability [12] Their potential range of activation is even lower than the well-known NaV1.7 sodium channels which largely studied in the context of pain pathophysiology owning its gain or loss of function in congenital pain diseases Among T-channels, the CaV3.2 channels are highly expressed in small and medium-sized DRG (see Fig 1) and the expression is increased after nerve injury [2,12] Hence, CaV3.2 T-channels are important regulators of afferent fiber excitability in neuropathic pain state [1,3,12] Moreover, CaV3.2 channels and CaV2.2 channels are expressed in the pre-synaptic terminals of primary afferent fibers and contribute to neurotransmission at dorsal horn synapses [12,13] Both calcium channel subtypes are upregulated under chronic pain conditions [14,15]; conversely, inhibiting activity of CaV3.2 and/or CaV2.2 channels in rodents has been shown to mediate analgesia [13] The CaV3.2 channels are also present at the post-synaptic terminals of second order neurons [12] (see Fig 1) At supraspinal level, the pain signals from the dorsal horn of the spinal cord traverse through the thalamus, the main sensory relay station in the CNS, before reaching higher CNS structures Previous studies have shown that both CaV3.1 T-channels and L-type calcium channels in thalamic neurons, respectively, regulate burst and tonic firing mode of these cells, in PKC-dependent pathways [16] Some studies report that bursting could increase pain in hyperalgesic conditions while others suggest the contrary Thus, several researches, showing that nociceptive pain responses were positively correlated with tonic firing of thalamic neurons [17,18] might be right In contrast, recent evidence supported pro-nociceptive roles of CaV3.2 channels in the thalamus during the development of acid-induced chronic muscle pain [3] The intracerebro ventricular injections of TTA-A2, a CaV3.x antagonist, also result in an Page analgesic effect that depends on CaV3.2 expression [12] Thereby, the blockade of supraspinal CaV3.2 is identified as a key step of the mechanism underlying the analgesic effect of paracetamol, the most widely used remedy to treat mild pain [12] Therefore, CaV3.2 channel blockers are more likely to alleviate neuropathic pain due to the dysfunction of peripheral nociceptive and central nervous system However, there is relatively high sequence conservation among different members of the VGC channel family [1,6] Thus, it is so difficult to identify compounds with high affinity and high selectivity for T-channels This is a really challenge in designing and developing small organic T-channel blockers Indeed, dihydropyridines are often thought of as a class of compounds being selective for L-type channels, but several dihydropyridines have been shown to block other calcium channel subtypes such as T-type and N-type channels, in some cases even preferentially over L-type channels [19,20] Moreover, T-channel blockers also have potential side effects such as sedation, motor weakness and cardiovascular dysfunction [3] Figure Examples of T-type calcium channel blockers from different chemical classes that have been shown to inhibit T-type calcium channels and to mediate analgesia in preclinical studies (Snutch, T.P.; Zamponi, G.W Br J Pharmacol 2018, 175, 2375-2383) [21] Currently, several T-type calcium channel blockers, from different chemical classes, have been shown to mediate analgesia in preclinical studies [21] (Fig 3) Among them, ABT639, MK8998, Z944 and ethosuximide have entered the clinic However, two novel T-type channel blockers (ABT-639 and MK-8998) have failed in human clinical trials, and it is Page 6-(2-Cyclopentylidenethyl)-5,7-dihydroxy-2-(4-hydroxyphenyl)chroman-4-one (11d) Yield: 98%; H NMR (400 MHz Acetone-d6) δ: 1.55 (2H, quin, J = 7.2 Hz), 1.65 (2H, quin, J = 7.2 Hz), 2.15 (2H, t, J = 7.2 Hz), 2.39 (2H, t, J = 7.2 Hz), 2.70 (1H, dd, J = 17.2, 2.8 Hz), 3.15 (1H, dd, J = 17.2, 12.8 Hz), 3.22 (2H, d, J = 7.2 Hz), 5.32 (1H, tt, J = 7.2, 2.0 Hz), 5.40 (1H, dd, J = 12.8, 2.8 Hz), 6.02 (1H, s), 6.88 (2H, d, J = 8.4 Hz), 7.37 (2H, d, J = 8.4 Hz), 9.03 (2H, br), 12.47 (1H, s); 13C NMR (100 MHz Acetone-d6) δ: 23.02, 26.94, 27.04, 29.04, 34.08, 43.55, 79.81, 95.25, 103.06, 108.95, 116.10, 118.85, 128.96, 130.88, 143.13, 158.58, 161.92, 162.22, 164.70, 197.28; IR (KBr): 2969, 1653, 1646, 1635, 1616, 1586, 1559, 1521, 1517, 1507, 1497, 1490, 1472, 1457, 1448, 1437, 1339, 1310, 1296, 1245, 1220, 1160, 1085, 830 cm−1; mp: 217–219 °C; MS (EI): m/z 366 (M+); HRMS (EI) Calcd for C22H22O5 366.1467 (M+); Found 366.1472 General procedure for the synthesis of 6-PNG derivatives 12a–c To a stirred solution of 11a, b or 11d (0.05 mmol) in EtOAc (3 mL) was added 10% Pd/C (5 mg), and the resulting mixture was hydrogenated at atm for 20 h The catalyst was removed through a Celite pad and washed with EtOAc (3 mL x 3) The filtrate and washings were combined and evaporated to give the corresponding product 12a–c 5,7-Dihydroxy-2-(4-hydroxyphenyl)-6-(3-methylbutyl)-chroman-4-one (12a) Yield: 100%; 1H NMR (400 MHz DMSO-d6) δ: 0.88 (6H, d, J = 6.4 Hz), 1.28 (2H, q, J = 7.6 Hz), 1.42–1.54 (1H, m), 2.41 (1H, d, J = 7.6 Hz), 2.43 (1H, d, J = 7.6 Hz), 2.63 (1H, dd, J = 17.2, 2.8 Hz), 3.22 (1H, dd, J = 17.2, 12.8 Hz), 5.38 (1H, dd, J = 12.8, 2.8 Hz), 5.93 (1H, s), 6.77 (2H, d, J = 8.4 Hz), 7.29 (2H, d, J = 8.4 Hz), 9.62 (1H, br), 12.41 (1H, s); 13C NMR (100 MHz DMSO-d6)δ: 19.47, 22.57, 27.59, 37.75, 42.12, 78.30, 94.41, 101.35, 108.59, 115.15, 128.31, 129.08, 157.70, 160.43, 160.74, 162.57, 196.28; IR (KBr): 2951, 1632, 1587, 1519, 1489, 1453, 1382, 1337, 1310, 1296, 1248, 1210, 1185, 1158, 1129, 1085, 1055, 830 cm−1; mp: 217–219 °C; MS (EI): m/z 342 (M+); HRMS (EI) Calcd for C20H22O5 342.1467 (M+); Found 342.1475 6-(3-Ethylpentyl)-5,7-dihydroxy-2-(4-hydroxyphenyl)-chroman-4-one Page 86 (12b) Yield: 100%; 1H NMR (400 MHz Acetone-d6) δ: 0.87 (6H, t, J = 7.2 Hz), 1.20–1.27 (1H, m), 1.31– 1.41 (4H, m), 1.43–1.49 (2H, m), 2.52 (1H, d, J = 8.0 Hz), 2.54 (1H, d, J = 8.0 Hz), 2.70 (1H, dd, J = 17.2, 2.8 Hz), 3.16 (1H, dd, J = 17.2, 12.8 Hz), 5.41 (1H, dd, J = 12.8, 2.8 Hz), 6.01 (1H, s), 6.88 (2H, d, J = 8.4 Hz), 7.38 (2H, d, J = 8.4 Hz), 8.52 (1H, br), 9.55 (1H, br), 12.46 (1H, s); 13C NMR (100 MHz Acetone-d6) δ: 11.16, 19.64, 26.06, 32.31, 41.33, 43.61, 79.84, 95.20, 103.01, 110.20, 116.10, 128.70, 130.90, 158.62, 161.83, 162.38, 164.89, 197.31; IR (KBr): 2960, 1635, 1587, 1518, 1489, 1458, 1338, 1308, 1296, 1261, 1244, 1186, 1161, 1105, 1084, 829 cm−1; mp: 206–208 °C; MS (EI): m/z 370 (M+); HRMS (EI) Calcd for C22H26O5 370.1780 (M+); Found 370.1765 6-(2-Cyclopentylethyl)-5,7-dihydroxy-2-(4-hydroxy-phenyl)chroman-4-one (12c) Yield: 100%; 1H NMR (400 MHz Acetone-d6) δ: 1.09–1.21 (2H, m), 1.44–1.54 (4H, m), 1.54–1.63 (2H, m), 1.76–1.85 (3H, m), 2.56 (1H, d, J = 8.0 Hz), 2.58 (1H, d, J = 8.0 Hz), 2.70 (1H, dd, J = 17.2, 2.8 Hz), 3.16 (1H, dd, J = 17.2, 12.8 Hz), 5.41 (1H, dd, J = 12.8, 2.8 Hz), 6.01 (1H, s), 6.88 (2H, d, J = 8.4 Hz), 7.38 (2H, d, J = 8.4 Hz), 8.51 (1H, s), 9.48 (1H, s), 12.45 (1H, s); 13C NMR (100 MHz Acetone-d6) δ: 21.69, 25.83, 33.28, 36.19, 40.90, 43.61, 79.84, 95.19, 103.01, 110.04, 116.10, 128.98, 130.90, 158.61, 161.84, 162.43, 164.88, 197.31; IR (KBr): 2951, 1635, 1589, 1518, 1491, 1452, 1338, 1310, 1296, 1261, 1159, 1142, 1105, 1084, 829 cm−1; mp: 224–226 °C; MS (EI): m/z 368 (M+); HRMS (EI) Calcd for C22H24O5 368.1624 (M+); Found 368.1637 Biology Assessment of T-currents by a patch-clamp technique in CaV3.2- expressing HEK293 cells Measurements of T-type calcium channel-dependent membrane currents were performed in HEK293 cells that stably express human CaV3.2, using a whole cell patchclamp technique, as described previously [22] The cell membrane voltage was held at −90 mV, and whole- cell Ba2+ currents were elicited by a test pulse at 30 mV Animals, von Frey test and creation of a surgically induced neuropathic pain model in mice Male ddY mice weighing 18–25 g (Kiwa Laboratory Animals Co Ltd., Wakayama, Japan) were used with approval by the Committee for the Care and Use of Laboratory Animals at Kindai University, and all procedures employed were in accordance with the NIH guidelines (Guide for the Care and Use of Laboratory Animals, NIH Publication 86–23) Nociceptive threshold in the hindpaw was determined by von Frey test, employing the updown method [23] To create a surgically induced neuropathic pain model, the right sciatic nerve of the mouse was partially ligated under isoflurane anesthesia, according to the previously described method [102], and used to detect anti-allodynic activity of test Page 87 compounds one week after the surgery Drug administration to mice All chemicals were suspended in 0.5% carboxymethyl cellulose sodium salt (CMC-Na) solution, and administered intraperitoneally (i.p.) to mice Data analysis Data are shown as the mean ± S.E.M Statistical significance was evaluated by nonparametric procedures; i.e the data were analyzed by the Kruskal-Wallis H test followed by a least significant difference-type test Significance was set at a P < 0.05 level Page 88 Experiment of chapter.3 Animals Male ddY mice (4–8 weeks) were purchased from Kiwa Laboratory Animals Co., Ltd (Wakayama, Japan) The mice were housed in a room kept at 22–24 °C under a 12-h day/ night cycle, and had free access to food and water Grouping animals was randomized, and blinding was not possible All experimental protocols were approved by Kindai University's Committee for the Care and Use of Laboratory Animals, and all procedures employed in the present study were in accordance with the guidelines of The Japanese Pharmacological Society, the Committee for Research and Ethical Issues of IASP [www.iasp-pain.org/Education/ Content.aspx?ItemNumber =1217] and also NIH (Guide for the Care and Use of Labora-tory Animals, NIH Publication 86-23) Major chemicals Bortezomib (BTZ), TTA-A2 and MG-132 were obtained from LC Laboratories (Woburn, MA, USA), Almone Labs (Jerusalem, Israel) and Merck-Millipore (Darmstadt, Germany), respectively (2R/S)-6-Prenylnaringenin (PNG) and KTt-45 (6-(3-ethylpent-2-enyl)5,7-dihy-droxy-2-(2-hydroxyphenyl)chroman-4-one) were synthesized in-house, as reported previously [29,30] BTZ and MG-132 were dissolved in DMSO for in vitro experiments, and diluted with saline for i.p administration TTA-A2 was dissolved in a solution containing 1.3% DMSO, 9.9% Tween 80 and 0.5% methylcellurose (2R/S)-6-PNG and KTt-45 were suspended in 0.5% carbo-xymethylcellulose sodium solution Creation of a bortezomib-induced peripheral neuropathy model in mice and assessment of mechanical nociceptive threshold A mouse model for BTZ-induced peripheral neuropathy (BIPN) was prepared by the method modi fied from the previous report [95] Mice received repeated i.p administration of BTZ at 0.4 mg/kg on days 0, 2, 5, 7, and 12, i.e times in total for weeks For measurement of nociceptive threshold, each mouse was placed on a risen wire-mesh floor and covered with a plastic box (10 × 10 × 10 cm), and acclimated to the environment at least for h Then, the mid-planter surface of the right hindpaw was stimulated with distinct von Frey filaments (0.008, 0.02, 0.04, 0.07, 0.16, 0.4, 0.6 and g), and 50% paw withdrawal threshold was determined according to the up-down method [100] Knockdown of Ca v 3.2 by intrathecal administration of antisense oligodeoxynucleotides in mice Silencing of CaV3.2 in the sensory nerves was achieved by intrathecal (i.t.) administration of a mixture of distinct antisense (AS) oligodeoxynucleotides (ODN) against Ca v 3.2 The AS-ODN and scram-bled control (SC) ODN were obtained from Sigma-Aldrich Japan (Tokyo, Japan) Those sequences were as follows: AS-ODN against CaV3.2, TGAAGTGGT AATGGTGGTGATGGTGGT (No.1) and GAGTGATGATGGACAGGAACGAGACCG (No.2), and SC-ODN, TTAGTGGTGGTATGAGGGTGTTTGGGA (No.1) and GGGAAA Page 89 GACCACGGGTAATGGTAGGAC (No.2) AS-ODN or SC-ODN solution (2 μg/μl each) in a volume of μl was administered i.t once a day on days 13, 14 and 15 after the onset of BTZ administration Successful knockdown of CaV3.2 was firmed by Western blot analysis of the excised dorsal root ganglion (DRG) at L4-L6 levels, as described below Exposure of DRG-derived ND7/23 cells to bortezomib Mouse neuroblastoma × rat DRG neuron hybrid ND7/23 cells were cultured in a low glucose-containing Dulbecco's modi fied Eagle's medium (Wako Pure Chem., Osaka, Japan) supplemented with 10% fetal calf serum (FCS, Nichirei Biosci Inc., Tokyo, Japan), 100 U/ml penicillin and 100 μg/ml streptomycin (Gibco, Carlsbad, CA) [107] In the medium containing 1% FCS, ND7/23 cells were seeded at × 106 cells in a culture dish (100 mm in diameter) and incubated for h, and then stimulated with bortezomib or MG-132 (MerckMillipore), proteasome inhibitors, for 24 h Determination of protein levels in mouse DRG and ND7/23 cells DRG samples at L4-L6 levels were excised from mice under anesthesia (i.p urethane at 1.5 g/kg) on days 1, 3, 14 and 21 after the onset of BTZ administration, and frozen in liquid nitrogen The DRG tissues were homogenized and sonicated in a RIPA buffer [PBS, 1% Igepal CA-630, 0.1% sodium dodecyl sulfate (SDS), 0.5% sodium deoxycholate] containing 0.15 U/ml aprotinin, 0.1 mg/ml phenylmethylsulfonyl fluoride and mM sodium orthovanadate, and the supernatant of the homogenate was mixed with the same volume of an electrophoresis sample buffer containing 5.7% SDS, 19% glycerol and 240 mM Tris−HCl (pH 6.7) On the other hand, ND7/23 cells were lysed in 2% SDS buffer containing 10% glycerol and 62.5 mM Tris–HCl (pH 6.8) After addition of 2-mercaptoethanol and bromo phenol blue, the tissue samples and cell lysate were denatured at 95–100 °C for The proteins were separated by electrophoresis on 5–20% gradient SDS-polyacrylamide gels (Wako Pure Chem.) and transferred to a polyvinylidene difluoride membrane (Immobilon-P, Merck-Millipore) The primary antibodies used (dilution) were: anti-mouse CaV3.2 rabbit polyclonal antibody (1:1000, prepared by Sigma-Aldrich Japan) [108], anti-human USP5 rabbit polyclonal antibody (1:5000, 15158-1-AP, Proteintech, Rosemont, IL) and anti-GAPDH rabbit polyclonal antibody (1:5000, sc-25778, Santa Cruz Bio-technology Inc., Santa Cruz, CA) A horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (1:5000, Chemicon International, Billerica, MA, USA) was used as a secondary antibody Immunopositive bands were deve-loped by ChemiLumi One Super (Nacalai Tesque, Kyoto, Japan), and quantified using a densitometric software (ImageJ 1.44p, http:imagej.nih.gov/ij) Determination of mRNA levels of Ca v 3.2 in ND7/23 cells Total RNA was extracted from ND7/23 cells in TRIzol reagent (Invitrogen, Carlsbad, CA, USA) Messenger RNA levels for CaV3.2 were determined by quantitative real-time PCR by using ABI PRISM 7000 Sequence Detector and Power SYBR Green Master Mix (Applied Biosystems, Caelsbad, CA, USA) [92] PCR primers employed were: 5′-ATGTA CTCACTGGCTGTGACC-3′ and 5′-GAGTCCAAAAGAGTGTGGGC-3′ for CaV3.2; 5′- Page 90 AGGTCGGTGTGAACGGATTTG-3′ and 5′-TGTAGACCATGTAGTTGAGGTCA-3′ for GAPDH PCR product sizes were 146 and 123 bp for CaV3.2 and GAPDH, respectively Whole-cell patch-clamp recordings in ND7/23 cells Whole-cell patch-clamp recordings were performed as described previously [41] ND7/23 cells were seeded at a density of × 104 cells in a culture dish (35 mm in diameter) coated with poly-L-ornithine, filled with the 1% FCS-containing medium, and then stimulated with BTZ at 0.1 nM or vehicle (DMSO 0.1%) for 24 h To measure of T-channel-dependent currents (T-currents), Ba2+ currents were recorded from randomly chosen cells The composition of the extracellular solution was (mM): 97 N-methyl- D-glucamine, 10 BaCl2, 10 HEPES, 40 teraethylammonium-Cl and 5.6 glucose (pH 7.4) The pipettes filled with the intracellular solution containing (mM): 140 CsCl, MgCl 2, EGTA and 10 HEPES (pH 7.2) The resistance of patch electrodes ranged from to MΩ Series-resistance was compensated by 80%, and current recordings were low-pass filtered less than kHz Ba2+ currents were recorded from randomly chosen cells at room temperature using a whole-cell patch-clamp amplifier The cell membrane voltage was held at − 80 mV, and Ba2+ currents were elicited by a single pulse at −20 mV for 200 ms (Fig 19E) T-currents were mea-sured as the difference between currents at the peak and detected 150 ms after the beginning of a test pulse Data were acquired and digitized through Digidata (1332 A, Axon Instruments, Foster City, CA, USA) and analyzed by a personal computer using pCLAMP8 software (Axon Instruments) [23] Statistics Data are shown as the mean ± S.E.M Statistical significance for parametric data was analyzed by Student's t-test for two-group data and an analysis of variance followed by Tukey's-test for multiple comparisons For non-parametric analyses, the Kruskal-Wallis Htest followed by a least significant difference-type test was employed Significance was set at a level of P < 0.05 Page 91 Reference [1] Zamponi, G.W Targeting voltage-gated calcium channels in neurological and psychiatric diseases Nat Rev Drug Discov 2015, 15, 19-34 [2] Cohen, S.P.; Mao, J Neuropathic pain: mechanisms and their clinical implications BMJ 2014, 348, f7656 [3] Todorovic, S.M.; Jevtovic-Todorovic, V T-type voltage-gated calcium channels as targets for the development of novel pain therapies Br J Clin Pharmacol 2011, 163, 484-495 [4] Benedetti, F.; Vighetti, S.; Amanzio, M.; Casadio, C.; Oliaro, A.; Bergamasco, B Maggi, G Dose-response relationship of opioids in nociceptive and neuropathic postoperative pain Pain 1998, 74, 205-211 [5] Kim, J.H.; Keum, G.; Chung, H.; Nam, G Synthesis and T-type calcium channel-blocking effects of aryl(1,5-disubstituted-pyrazol-3-yl)methyl sulfonamides for neuropathic pain treatment Eur J Med Chem 2016, 123, 665-672 [6] Catterall, W.A.; Perez-Reyes, E.; Snutch, T.P.; Striessnig, J International union of pharmacology XLVIII Nomenclature and structure-function relationships of voltagegated calcium channels Pharmacol Rev 2005, 57, 411-425 [7] Hell, J.W.; Westenbroek R.E.; Warner C.; Ahlijanian M.K.; Prystay, W.; Gilbert, M M.; Snutch, T.P; Catterall, W.A Identification and differential subcellular localization of the neuronal class C and class D L-type calcium channel α1 subunits J Cell Biol 1993, 123, 949-962 [8] Zamponi, G.W; Feng, Z.P.; Zhang, L.; Pajouhesh, H.; Ding, Y.; Belardetti, F.; Pajouhesh, H.; Dolphin, D.; Mitscher, A.L.; Snutch T.P Scaffold-based design and synthesis of potent N-type calcium channel blockers Bioorg Med Chem Lett 2009, 19, 64676472 [9] Murakami, M.; Nakagawasai, O.; Suzuki, T.; Mobarakeh, II.; Sakurada, Y.; Murata, A.; Yamadera, F.; Miyoshi, I.; Yanai, K.; Tan-No, K.; Sasano, H.; Tadano, T.; Iijima, T Antinociceptive effect of different types of calcium channel inhibitors and the distribution of various calcium channel α1 subunits in the dorsal horn of spinal cord in mice Brain Res 2004, 1024, 122-129 [10] Terashima, T.; Xu, Q.; Yamaguchi, S.; Yaksh, T L Intrathecal P/Q-and R-type calcium channel blockade of spinal substance P release and c-Fos expression Neuropharmacology 2013, 75, 1-8 [11] Matthews, E.A.; Bee, L.A.; Stephens, G.J.; Dickenson, A.H The CaV2.3 calcium channel antagonist SNX-482 reduces dorsal horn neuronal responses in a rat model of chronic neuropathic pain Eur J Neurosci 2007, 25, 3561-3569 [12] Bourinet, E.; Francoise, A.; Laffray, S T-type calcium channel s in neuropathic pain Pain 2016, 157, 15-20 [13] Waxman, S.G.; Zamponi, G.W Regulating excitability of peripheral afferents: emerging ion channel targets Nat Neurosci 2014, 17, 153-163 [14] Cizkova, D.; Marsala, J.; Lukacova N.; Marsala, M.; Jergova, S.; Orendacova, J.; Yaksh L Localization of N-type Ca2+ channels in the rat spinal cord following chronic constrictive nerve injury Exp Brain Res 2002, 147, 456-463 Page 92 [15] Jagodic, M.M.; Pathirathna, S.; Joksovic, P.M.; Lee, W.; Nelson, M.T.; Naik, A.K.; Su, P.; Jevtovic-Todorovic, V.; Todorovic, S.M Upregulation of the T-type calcium current in small rat sensory neurons after chronic constrictive injury of the sciatic nerve J Neurophysiol 2008, 99, 3151-3156 [16] Cheong, E.; Lee, S.;, Choi, B.J.; Sun, M.; Lee, C.J.; Shin, H.S Tuning thalamic firing modes via simultaneous modulation of T- and L-type Ca2+ channels controls pain sensory gating in the thalamus J Neurosci 2008, 28, 13331-13340 [17] Huh, Y.; Bhatt, R.; Jung, D.; Shin, H-s.; Cho, J Interactive responses of a thalamic neuron to formalin induced lasting pain in behaving mice PLoS One 2012, 7(1), 30699 [18] Huh, Y.; Cho, J Changes in Activity of the Same Thalamic Neurons to Repeated Nociception in Behaving Mice PLoS One 2015, 10(6), 0129395 [19] Bladen, C.; Gunduz, M.G.; Simsek, R.; Safak, C.; Zamponi, G.W Synthesis and evaluation of 1,4-dihydropyridine derivatives with calcium channel blocking activity Pflügers Arch 2014, 466, 1355-1363 [20] Kumar, P.P.; Stotz, S.C.; Paramashivappa, R.; Beedle, A.M.; Zamponi, G.W.; Rao, A.S Synthesis and evaluation of a new class of nifedipine analogs with T-type calcium channel blocking activity Mol Pharmacol 2002, 61, 649-658 [21] Snutch, T.P.; Zamponi, G.W Recent advances in the development of T-type calcium channel blockers for pain intervention Br J Pharmacol 2018, 175, 2375-2383 [22] Sekiguchi, F.; Fujita, T.; Deguchi, T.; Yamaoka, S Tomochika, K.; Tsubota, M; Ono, S.; Horaguchi, Y.; Ichii, M.; Ichikawa, M.; Ueno, Y.; Koike, N.; Tanino T.; Nguyen, H.D.; Okada, T.; Nishikawa, H.; Yoshida, S.; Ohkubo T.; Toyooka, N.; Murata, K.; Matsuda, H.; Kawabata, A Blockade of T-type calcium channels by 6-prenyl-naringenin, a hop component, alleviates neuropathic and visceral pain in mice Neuropharmacology 2018, 138, 232-244 [23] Sekiguchi, F.; Kawara, Y.; Tsubota, M.; Kawakami, E.; Ozaki, T.; Kawaishi, Y.; Tomita, S.; Kanaoka, D.; Yoshida, S.; Ohkubo, T.; Kawabata, A Therapeutic potential of RQ-00311651, a novel T-type Ca2+ channel blocker, in distinct rodent models for neuropathic and visceral pain Pain 2016, 157, 1655-1665 [24] Matsunami, M.; Miki, T.; Nishiura, K.; Hayashi, Y.; Okawa, Y.; Nishikawa, H.; Sekiguchi, F.; Kubo, L.; Ozaki, T.; Tsujiuchi, T.; Kawabata, A Involvement ofthe endogenous hydrogen sulfide/Cav3.2 T-type Ca2+ channel pathway incystitis-related bladder pain in mice Br J Pharmacol 2012, 167, 917-928 [25] Okubo, K.; Takahashi, T.; Sekiguchi, F.; Kanaoka, D.; Matsunami, M.; Ohkubo, T.; Yamazaki, J.; Fukushima, N.; Yoshida, S.; Kawabata, A Inhibition of T-type calcium channels and hydrogen sulfide-forming enzyme reverses paclitaxel-evoked neuropathic hyperalgesia in rats Neuroscience 2011, 188, 148-156 [26] Yang, X.; Jiang, Y.; Yang, J.; He, J.; Sun, J.; Chen, F.; Zhang, M.; Yang B Prenylated flavonoids, promising nutraceuticals with impressive biological activities Trends Food Sci Technol 2015, 44, 93-104 [27] Botta, B.; Vitali, A.; Menendez, P.; Misiti, D.; Monache, G.D Prenylated Flavonoids: pharmacology and biotechnology Curr Med Chem 2005, 12, 713-739 [28] Tischer, S.; Metz, P Selective C-6 prenylation of flavonoids via europium(III)-catalyzed claisen rearrangement and cross-metathesis Adv Chem Catal 2007, 349, 147-151 Page 93 [29] Gester, S.; Metz, P.; Zieraub, O.; Vollmer, G An efficient synthesis of the potent phytoestrogens 8-prenylnaringenin and 6-(1,1-dimethylallyl)naringenin by europium(III)-catalyzed claisen rearrangement Tetrahedron 2001, 57, 1015-1018 [30] Nguyen, H.D.; Okada, T.; Kitamura, S; Yamaoka, S Horaguchi, Y.; Kasanami, Y.; Sekiguchi, F.; Tsubota, M.; Yoshida, S.; Nishikawa, H.; Kawabata, A.; Toyooka, N Design and synthesis of novel anti-hyperalgesic agents based on 6-prenylnaringenin as the T-type calcium channel blockers Bioorg Med Chem 2018, 26,4410–4427 [31] Aromolaran, K.A.; Goldstein, P.A Ion channels and neuronal hyperexcitability in chemotherapy-induced peripheral neuropathy: Cause and effect? Mol Pain 2017, 13, 1744806917714693 [32] Argyriou, A.A.; Cavaletti, G.; Bruna, J.; Kyritsis, A.P.; Kalofonos, H.P.; Bortezomibinduced peripheral neurotoxicity: an update Arch Toxicol 2014 88, 1669-1679 [33] Park, J.E.; Miller, Z.; Jun, Y.; Lee, W.; Kim, K.B Next-generation proteasome inhibitors for cancer therapy Transl Res 2018, 198, 1-16 [34] Korde, N.; Roschewski, M.; Zingone, A.; Kwok, M.; Manasanch, E.E.; Bhutani, M Treatment with Carfilzomib-Lenalidomide-Dexamethasone with Lenalidomide Extension in Patients with Smoldering or Newly Diagnosed Multiple Myeloma JAMA Oncol 2015, 1(6),746-754 [35] Gupta, N.; Hanley, M.J.; Venkatakrishnan, K.; Perez, R.; Norris, R.E.; Nemunaitis, J.; Yang, H.; Qian, M.G.; Falchook, G.; Labotka, R.; Fu, S Pharmacokinetics of ixazomib, an oral proteasome inhibitor, in solid tumour patients with moderate or severe hepatic impairment Br J Clin Pharmacol 2016, 82, 728-738 [36] Tomita, S.; Sekiguchi, F.; Deguchi, T.; Miyazaki, T.; Tsubota, M.; Yoshida, S.; Nguyen, H.D.; Okada, T.; Toyooka, N.; Kawabata, A Critical role of Ca V3.2 T-type calcium channels in the peripheral neuropathy induced by bortezomib, a proteasome-inhibiting chemotherapeutic agent, in mice Toxicology 2019, 413, 33-39 [37] Bartmańska, A.; Tronina, T.; Pawłowski, J.; Milczarek, M.; Filip-Psurska, B.; Wietrzyk, J Highly Cancer Selective Antiproliferative Activity of Natural Prenylated Flavonoids Molecules 2018, 23, 2922 [38] Busch, C.; Noor, S.; Leischner, C.; Burkard, M.; Lauer, U.M.; Venturelli, S Anti-proliferative activity of hop-derived prenylflavonoids against human cancer cell lines Wien Med Wochenschr 2015 165, 258-261 [39] Venturelli, S.; Niessner, H.; Sinnberg, T.; Berger, A.; Burkard, M.; Urmann, C.; Donaubauer, K.; Böckere, A.; Leischner, C.; Riepl, H.; Frank, J.; Lauer, U.M.; Garbe, C.; Busch, C 6- and 8-Prenylnaringenin, Novel Natural Histone Deacetylase Inhibitors Found in Hops, Exert Antitumor Activity on Melanoma Cells Cell Physiol Biochem 2018, 51,543-556 [40] Dziegielewska, B.; Gray, L.S.; Dziegielewski, J T-type calcium channels blockers as new tools in cancer therapies Pflug Arch Eur J Physiol 2014, 466, 801-810 [41] Kawabata, A.; Ishiki, T.; Nagasawa, K.; Yoshida, S.; Maeda, Y.; Takahashi, T.; Sekiguchi, F.; Wada, T.; Ichida, S.; Nishikawa, H Hydrogen sulfide as a novel nociceptive messenger Pain 2007, 132, 74-81 Page 94 [42] Maeda, Y.; Aoki, Y.; Sekiguchi, F.; Matsunami, M.; Takahashi, T.; Nishikawa, H.; Kawabata, A Hyperalgesia induced by spinal and peripheral hydrogen sulfide: evidence for in-volvement of Cav3.2 T-type calcium channels Pain 2009, 142, 127-132 [43] Marger, F.; Gelot, A.; Alloui, A.; Matricon, J.; Ferrer, J.F.; Barrere, C.; Pizzoccaro, A.; Muller, E.; Nargeot, J.; Snutch, T.P.; Eschalier, A.; Bourinet, E.; Ardid, D T- type calcium channels contribute to colonic hypersensitivity in a rat model of irritable bowel syndrome Proc Natl Acad Sci U.S.A 2011, 108, 11268-11273 [44] Matsunami, M., Tarui, T.; Mitani, K.; Nagasawa, K.; Fukushima, O.; Okubo, K.; Yoshida, S.; Takemura, M.; Kawabata, A Luminal hydrogen sulfide plays a pronociceptive role in mouse colon Gut 2009, 58, 751-761 [45] Nishimura, S.; Fukushima, O.; Ishikura, H.; Takahashi, T.; Matsunami, M.; Tsujiuchi, T.; Sekiguchi, F.; Naruse, M.; Kamanaka, Y.; Kawabata, A Hydrogen sulfide as a novel mediator for pancreatic pain in rodents Gut 2009, 58, 762-770 [46] Orestes, P.; Osuru, H.P.; McIntire, W.E.; Jacus, M.O.; Salajegheh, R.; Jagodic, M.M.; Choe, W.; Lee, J.; Lee, S.S.; Rose, K.E.; Poiro, N.; Digruccio, M.R.; Krishnan, K.; Covey, D.F.; Lee, J.H.; Barrett, P.Q.; Jevtovic-Todorovic, V.; Todorovic, S.M Reversal of neuropathic pain in diabetes by targeting glycosylation of Cav3.2 T- type calcium channels Diabetes 2013, 62, 3828-3838 [47] Sekiguchi, F.; Aoki, Y.; Nakagawa, M.; Kanaoka, D.; Nishimoto, Y.; Tsubota- Matsunami, M.; Yamanaka, R.; Yoshida, S.; Kawabata, A AKAP-dependent sensitization of Cav3.2 channels via the EP4 receptor/cAMP pathway mediates PGE2-induced mechanical hyperalgesia Br J Pharmacol 2013, 168, 734-745 [48] Takahashi, T.; Aoki, Y.; Okubo, K.; Maeda, Y.; Sekiguchi, F.; Mitani, K.; Nishikawa, H.; Kawabata, A Upregulation of CaV3.2 T-type calcium channels targeted by endogenous hydrogen sulfide contributes to maintenance of neuropathic pain Pain 2010, 150, 183-191 [49] Tsubota-Matsunami, M.; Noguchi, Y.; Okawa, Y.; Sekiguchi, F.; Kawabata, A Colonic hydrogen sulfide-induced visceral pain and referred hyperalgesia involve activation of both Cav3.2 and TRPA1 channels in mice J Pharmacol Sci 2012, 119, 293-296 [50] Zamponi, G.W.; Striessnig, J.; Koschak, A.; Dolphin, A.C The physiology, pathology, and pharmacology of voltage-gated calcium channels and their future therapeutic potential Pharmacol Rev 2015, 67, 821-870 [51] Garcia-Caballero, A.; Gadotti, V.M.; Stemkowski, P.; Weiss, N.; Souza, I.A.; Hodgkinson, V.; Bladen, C.; Chen, L.; Hamid, J.; Pizzoccaro, A.; Deage, M.; Francois, A.; Bourinet, E.; Zamponi, G.W The deubiquitinating enzyme USP5 modulates neuropathic and inflammatory pain by enhancing Cav3.2 channel activity Neuron 2014, 83, 1144-1158 [52] Latham, J.R.; Pathirathna, S.; Jagodic, M.M.; Choe, W.J.; Levin, M.E.; Nelson, M.T.; Lee, W.Y.; Krishnan, K.; Covey, D.F.; Todorovic, S.M.; Jevtovic-Todorovic, V Selective T-type calcium channel blockade alleviates hyperalgesia in ob/ob mice Diabetes 2009, 58, 2656-2665 [53] Messinger, R.B.; Naik, A.K.; Jagodic, M.M.; Nelson, M.T.; Lee, W.Y.; Choe, W.J.; Orestes, P.; Latham, J.R.; Todorovic, S.M.; Jevtovic-Todorovic, V In vivo silencing of the CaV3.2 T-type calcium channels in sensory neurons alleviates hyperalgesia in rats with streptozocin-induced diabetic neuropathy Pain 2009, 145, 184-195 Page 95 [54] Ozaki, T.; Matsuoka, J.; Tsubota, M.; Tomita, S.; Sekiguchi, F.; Minami, T.; Kawabata, A Zinc deficiency promotes cystitis-related bladder pain by enhancing function and expression of Cav3.2 in mice Toxicology 2018, 393, 102-112 [55] Todorovic, S.M.; Jevtovic-Todorovic, V Neuropathic pain: role for presynaptic T-type channels in nociceptive signaling Pflügers Arch 2013, 465, 921-927 [56] Weiss, N.; Zamponi, G.W Control of low-threshold exocytosis by T-type calcium channels Biochim Biophys Acta 2013, 1828, 1579-1586 [57] Serra, J.; Duan, W.R.; Locke, C.; Sola, R.; Liu, W.; Nothaft, W Effects of a T-type calcium channel blocker, ABT-639, on spontaneous activity in C-nociceptors in patients with painful diabetic neuropathy: a randomized controlled trial Pain 2015, 156, 21752183 [58] Ziegler, D.; Duan, W.R.; An, G.; Thomas, J.W.; Nothaft, W A randomized doubleblind, placebo-, and active-controlled study of T-type calcium channel blocker ABT-639 in patients with diabetic peripheral neuropathic pain Pain 2015, 156, 2013-2020 [59] Lee, M Z944: a first in class T-type calcium channel modulator for the treatment of pain J Peripher Nerv Syst 2014, 19 (Suppl 2), S11-S12 [60] Tringham, E.; Powell, K.L.; Cain, S.M.; Kuplast, K.; Mezeyova, J.; Weerapura, M.; Eduljee, C.; Jiang, X.; Smith, P.; Morrison, J.L.; Jones, N.C.; Braine, E.; Rind, G.; FeeMaki, M.; Parker, D.; Pajouhesh, H.; Parmar, M.; O'Brien, T.J.; Snutch, T.P T-type calcium channel blockers that attenuate thalamic burst firing and suppress absence seizures Sci Transl Med 2012, 4, 121-129 [61] Todorovic, S.M.; Jevtovic-Todorovic, V T-type voltage-gated calcium channels as targets for the development of novel pain therapies Br J Pharmacol 2011, 163, 484-495 [62] Kraus, R.L.; Li, Y.; Gregan, Y.; Gotter, A.L.; Uebele, V.N.; Fox, S.V.; Doran, S.M.; Barrow, J.C.; Yang, Z.Q.; Reger, T.S.; Koblan, K.S.; Renger, J.J In vitro characterization of T-type calcium channel antagonist TTA-A2 and in vivo effects on arousal in mice J Pharmacol Exp.Therapeut 2010, 335, 409-417 [63] Miwa, H.; Koh, J.; Kajimoto, Y.; Kondo, T Effects of T-type calcium channel blockers on a parkinsonian tremor model in rats Pharmacol Biochem Behav 2011, 97, 656-659 [64] Sekiguchi, F.; Miyamoto, Y.; Kanaoka, D.; Ide, H.; Yoshida, S.; Ohkubo, T.; Kawabata, A Endogenous and exogenous hydrogen sulfide facilitates T- type calcium channel currents in Cav3.2-expressing HEK293 cells Biochem Biophys Res Commun 2014, 445, 225-229 [65] Gangarossa, G.; Laffray, S.; Bourinet, E.; Valjent, E T-type calcium channel CaV3.2 deficient mice show elevated anxiety, impaired memory and reduced sensitivity to psychostimulants Front Behav Neurosci 2014, 8, 92 [66] Chemin, J.; Nargeot, J.; Lory, P Neuronal T-type alpha 1H calcium channels induce neuritogenesis and expression of high-voltage-activated calcium channels in the NG108-15 cell line J Neurosci 2002, 22, 6856-6862 [67] Nagasawa, K.; Tarui, T.; Yoshida, S.; Sekiguchi, F.; Matsunami, M.; Ohi, A.; Fukami, K.; Ichida, S.; Nishikawa, H.; Kawabata, A Hydrogen sulfide evokes neurite outgrowth and expression of high-voltage-activated Ca2+ currents in NG108-15 cells: involvement of T-type Ca2+ channels J Neurochem 2009, 108, 676-684 Page 96 [68] Keiler, A.M.; Zierau, O.; Kretzschmar, G Hop extracts and hop substances in treatment of menopausal complaints Planta Med 2013, 79, 576-579 [69] Kawaguchi, A.; Asano, H.; Matsushima, K.; Wada, T.; Yoshida, S.; Ichida, S Enhancement of sodium current in NG108-15 cells during neural differentiation is mainly due to an increase in NaV1.7 expression Neurochem Res 2007, 32, 1469-1475 [70] Okubo, K.; Matsumura, M.; Kawaishi, Y.; Aoki, Y.; Matsunami, M.; Okawa, Y.; Sekiguchi, F.; Kawabata, A Hydrogen sulfide-induced mechanical hyperalgesia and allodynia require activation of both Cav3.2 and TRPA1 channels in mice Br J Pharmacol 2012, 166, 1738-1743 [71] Matsunami, M.; Kirishi, S.; Okui, T.; Kawabata, A Chelating luminal zinc mimics hydrogen sulfide-evoked colonic pain in mice: possible involvement of T-type calcium channels Neuroscience 2011, 181, 257-264 [72] Gadotti, V.M.; Bladen, C.; Zhang, F.X.; Chen, L.; Gunduz, M.G.; Simsek, R.; Safak, C.; Zamponi, G.W Analgesic effect of a broad-spectrum dihydropyridine inhibitor of voltage-gated calcium channels Pflügers Arch 2015, 467, 2485-2493 [73] Roelens, F.; Heldring, N.; Dhooge, W.; Bengtsson, M.; Comhaire, F.; Gustafsson, J.A.; Treuter, E.; De Keukeleire, D Subtle side-chain modifications of the hop phytoestrogen 8-prenylnaringenin result in distinct agonist/antagonist activity profiles for estrogen receptors alpha and beta J Med Chem 2006, 49, 7357-7365 [74] Overk, C.R.; Yao, P.; Chadwick, L.R.; Nikolic, D.; Sun, Y.; Cuendet, M.A.; Deng, Y.; Hedayat, A.S.; Pauli, G.F.; Farnsworth, N.R.; van Breemen, R.B.; Bolton, J.L Comparison of the in vitro estrogenic activities of compounds from hops (Humulus lupulus) and red clover (Trifolium pratense) J Agric Food Chem 2005, 53, 6246-6253 [75] Bouhassira, D.; Attal, N Translational neuropathic pain research: a clinical perspective Neuroscience 2016, 338, 27-35 [76] Cardoso, F.C., Lewis, R.J Sodium channels and pain: from toxins to therapies Br J Pharmacol 2018,175, 2138-2157 [77] Okubo, K.; Nakanishi, H.; Matsunami, M.; Shibayama, H.; Kawabata, A Topical application of disodium isostearyl 2-O-L-ascorbyl phosphate, an amphiphilic ascorbic acid derivative, reduces neuropathic hyperalgesia in rats Br J Pharmacol 2012, 166, 1058-1068 [78] Okubo, K.; Takahashi, T.; Sekiguchi, F.; Kanaoka, D.; Matsunami, M.; Ohkubo, T.; Yamazaki, J.; Fukushima, N.; Yoshida, S.; Kawabata, A Inhibition of T-type calcium channels and hydrogen sulfide-forming enzyme reverses paclitaxel-evoked neuropathic hyperalgesia in rats Neuroscience 2011, 188, 148-156 [79] Francois, A.; Kerckhove, N.; Meleine, M.; Alloui, A.; Barrere, C.; Gelot, A.; Uebele, V.N.; Renger, J.J.; Eschalier, A.; Ardid, D.; Bourinet, E State-dependent properties of a new T-type calcium channel blocker enhance CaV3.2 selectivity and support analgesic effects Pain 2013, 154, 283-293 [80] Qi, C.; Xiong,Y.; Eschenbrenner-Lux, V.; Cong, H.; Porco, Jr.J.A Asymmetric Syntheses of the Flavonoid Diels-Alder Natural Products Sanggenons C and O J Am Chem Soc 2016, 138,798-801 Page 97 [81] Flatters, S.J.L.; Dougherty, P.M.; Colvin, L.A Clinical and preclinical perspectives on Chemotherapy-Induced Peripheral Neuropathy (CIPN): a narrative review Br J Anaesth 2017, 119, 737-749 [82] Duggett, N.A.; Griffi ths, L.A.; Flatters, S.J.L Paclitaxel-induced painful neuropathy is associated with changes in mitochondrial bioenergetics, glycolysis, and an energy deficit in dorsal root ganglia neurons Pain 2017, 158, 1499-1508 [83] Fidanboylu, M.; Grifiths, L.A.; Flatters, S.J Global inhibition of reactive oxygen species (ROS) inhibits paclitaxel-induced painful peripheral neuropathy PLoS One 2011, 6, e25212 [84] Nishida, T.; Tsubota, M.; Kawaishi, Y.; Yamanishi, H.; Kamitani, N.; Sekiguchi, F.; Ishikura, H., Liu, K., Nishibori, M., Kawabata, A Involvement of high mobility group box in the development and maintenance of chemotherapy-induced peripheral neuropathy in rats Toxicology 2016, 365, 48-58 [85] Zhang, H.; Li, Y.; de Carvalho-Barbosa, M.; Kavelaars, A.; Heijnen, C.J.; Albrecht, P J.; Dougherty, P.M.; Dorsal root ganglion in filtration by macrophages contributes to paclitaxel chemotherapy-induced peripheral neuropathy J Pain 2016, 17, 775-786 [86] Li, Y.; North, R.Y.; Rhines, L.D.; Tatsui, C.E.; Rao, G.; Edwards, D.D.; Cassidy, R.M.; Harrison, D.S.; Johansson, C.A.; Zhang, H.; Dougherty, P.M DRG voltage-gated sodium channel 1.7 is upregulated in paclitaxel-induced neuropathy in rats and in humans with neuropathic pain J Neurosci 2018, 38, 1124-1136 [87] Li, Y.; Tatsui, C.E.; Rhines, L.D.; North, R.Y.; Harrison, D.S.; Cassidy, R.M.; Johansson, C.A.; Kosturakis, A.K.; Edwards, D.D.; Zhang, H.; Dougherty, P.M.; Dorsal root ganglion neurons become hyperexcitable and increase expression of voltage-gated Ttype calcium channels (CaV3.2) in paclitaxel-induced peripheral neuropathy Pain 2017, 158, 417-429 [88] Duggett, N.A.; Flatters, S.J.L Characterization of a rat model of bortezomib-induced painful neuropathy Br J Pharmacol 2017, 174, 4812-4825 [89] Meregalli, C.; Chiorazzi, A.; Carozzi, V.A.; Canta, A.; Sala, B.; Colombo, M.; Oggioni, N.; Ceresa, C.; Foudah, D.; La Russa, F.; Miloso, M.; Nicolini, G.; Marmiroli, P.; Bennett, D.L.; Cavaletti, G.; Evaluation of tubulin polymerization and chronic inhibition of proteasome as citotoxicity mechanisms in bortezomib-induced peripheral neuropathy Cell Cycle 2014, 13, 612-621 [90] Rogawski, M.A.; Loscher, W The neurobiology of antiepileptic drugs Nat Rev Neurosci 2004, 5, 553-564 [91] Sekiguchi, F.; Kawabata, A T-type calcium channels: functional regulation and implication in pain signaling J Pharmacol Sci 2013, 122, 244-250 [92] Fukami, K.; Sekiguchi, F.; Yasukawa, M.; Asano, E.; Kasamatsu, R.; Ueda, M.; Yoshida, S.; Kawabata, A Functional upregulation of the H 2S/Ca v 3.2 channel pathway accelerates secretory function in neuroendocrine-differentiated human prostate cancer cells Biochem Pharmacol 2015, 97, 300-309 [93] van Loo, K.M.; Schaub, C.; Pernhorst, K.; Yaari, Y.; Beck, H.; Schoch, S.; Becker, A.J Transcriptional regulation of T-type calcium channel CaV3.2: bi-directionality by early growth response (Egr1) and repressor element (RE-1) protein-silencing transcription factor (REST) J Biol Chem 2012, 287, 15489 -15501 Page 98 [94] Stemkowski, P.; Garcia-Caballero, A.; De Maria Gadotti, V.; M ’Dahoma, S.; Huang, S.; Gertrud Black, S.A.; Chen, L.; Souza, I.A.; Zhang, Z.; Zamponi, G.W TRPV1 nociceptor activity initiates USP5/T-type channel-mediated plasticity Cell Rep 2017, 18, 2289-2290 [95] Boehmerle, W.; Huehnchen, P.; Peruzzaro, S.; Balkaya, M.; Endres, M Electrophysiological, behavioral and histological characterization of paclitaxel, cisplatin, vincristine and bortezomib-induced neuropathy in C57Bl/6 mice Sci Rep 2014, 4, 6370 [96] Nelson, M.T.; Joksovic, P.M.; Su, P.; Kang, H.W.; Van Deusen, A.; Baumgart, J.P.; David, L.S.; Snutch, T.P.; Barrett, P.Q.; Lee, J.H.; Zorumski, C.F.; Perez-Reyes, E.; Todorovic, S.M Molecular mechanisms of subtype-speci fi c inhibition of neuronal Ttype calcium channels by ascorbate J Neurosci 2007, 27, 12577-12583 [97] Kaplan, G.S.; Torcun, C.C.; Grune, T.; Ozer, N.K.; Karademir, B Proteasome inhibitors in cancer therapy: treatment regimen and peripheral neuropathy as a side effect Free Radic Biol Med 2017, 103, 1-13 [98] Ryu, S.Y.; Lee, H.S.; Kim, Y.K.; Kim, S.H Determination of isoprenyl and lavandulyl positions of flavonoids from sophoraflavescens by NMR experiment Arch Pharm Res (Seoul) 1997, 20, 491-495 [99] Wu, L.J.; Miyase, T.; Ueno, A.; Kuroyanagi, M.; Noro, T.Fukushima, S Studies on the constituents of Sophora flavescens ait III Yakugaku Zasshi, 1985, 105, 736-741 [100] Chaplan, S.R.; Bach, F.W.; Pogrel, J.W.; Chung, J.M.; Yaksh, T.L Quantitative assessment of tactile allodynia in the rat paw J Neurosci Meth 1994, 53, 55-63 [101] Kiguchi, N.; Maeda, T.; Kobayashi, Y.; Fukazawa, Y.; Kishioka, S Macrophage inflammatory protein-1alpha mediates the development of neuropathic pain following peripheral nerve injury through interleukin-1beta up-regulation Pain 2010, 149, 305-315 [102] Seltzer, Z.; Dubner, R.; Shir, Y A novel behavioral model of neuropathic pain disorders produced in rats by partial sciatic nerve injury Pain 1990, 43, 205-218 [103] Sakurai, M.; Egashira, N.; Kawashiri, T.; Yano, T.; Ikesue, H.; Oishi, R Oxaliplatininduced neuropathy in the rat: involvement of oxalate in cold hyperalgesia but not mechanical allodynia Pain 2009, 147, 165-174 [104] Zhao, M.; Isami, K.; Nakamura, S.; Shirakawa, H.; Nakagawa, T.; Kaneko, S Acute cold hypersensitivity characteristically induced by oxaliplatin is caused by the enhanced responsiveness of TRPA1 in mice Mol Pain 2012, 8, 55 [105] Ji, R.R.; Baba, H.; Brenner, G.J.; Woolf, C.J Nociceptive-specific activation of ERK in spinal neurons contributes to pain hypersensitivity Nat Neurosci 1999, 2, 1114-1119 [106] Possemiers, S.; Heyerick, A.; Robbens, V.; De Keukeleire, D.; Verstraete, W Activation of proestrogens from hops (Humulus lupulus L.) by intestinal microbiota; conversion of isoxanthohumol into 8-prenylnaringenin J Agric Food Chem 2005, 53, 62816288 [107] Mitani, K.; Sekiguchi, F.; Maeda, T.; Tanaka, Y.; Yoshida, S.; Kawabata, A The prostaglandin E 2/EP4 receptor/cyclic AMP/T-type Ca2+ channel pathway mediates neuritogenesis in sensory neuron-like ND7/23 cells J Pharmacol Sci 2016, 130, 177-180 [108] Shao, Y.; Alicknavitch, M.; Farach-Carson, M.C Expression of voltage sensitive calcium channel (VSCC) L-type CaV1.2 (alpha1C) and T-type CaV3.2 (alpha1H) subunits during mouse bone development Dev Dyn 2005, 234, 54-62 Page 99 List of related articles Sekiguchi, F.; Fujita, T.; Deguchi, T.; Yamaoka, S Tomochika, K.; Tsubota, M; Ono, S.; Horaguchi, Y.; Ichii, M.; Ichikawa, M.; Ueno, Y.; Koike, N.; Tanino T.; Nguyen, H.D.; Okada, T.; Nishikawa, H.; Yoshida, S.; Ohkubo T.; Toyooka, N.; Murata, K.; Matsuda, H.; Kawabata, A Blockade of T-type calcium channels by 6-prenyl-naringenin, a hop component, alleviates neuropathic and visceral pain in mice Neuropharmacology 2018, 138, 232-244 Nguyen, H.D.; Okada, T.; Kitamura, S; Yamaoka, S Horaguchi, Y.; Kasanami, Y.; Sekiguchi, F.; Tsubota, M.; Yoshida, S.; Nishikawa, H.; Kawabata, A.; Toyooka, N Design and synthesis of novel anti-hyperalgesic agents based on 6-prenylnaringenin as the T-type calcium channel blockers Bioorg Med Chem 2018, 26, 4410-4427 Tomita, S.; Sekiguchi, F.; Deguchi, T.; Miyazaki, T.; Tsubota, M.; Yoshida, S.; Nguyen, H.D.; Okada, T.; Toyooka, N.; Kawabata, A Critical role of CaV3.2 T-type calcium channels in the peripheral neuropathy induced by bortezomib, a proteasomeinhibiting chemotherapeutic agent, in mice Toxicology 2019, 413, 33-39 Page 100 ... 目指した新規有機小分子の創製 Discovery of Novel Small Molecule for Treatment of Neuropathic Pain A dissertation submitted to the Graduate School of Innovative Life Science, University of Toyama Toyama, Japan for the... Introduction Pain is often a result of the activation of neurons to sense harmful stimuli of acute events that are able to injure peripheral tissue such as the skin and internal organs This form of pain, ... treat neuropathic pain tend to have only a modest effect and in a minority of patients, although the development of such drugs was based on the mechanisms of neuropathic pain (see Table 1) Therefore,