Characterization of a potential probiotic bacterium lactobacillus plantarum PH04 with cholesterol lowering effect

Thesis for the Degree of Master of Science Characterization of a Potential Probiotic Bacterium Lactobacillus plantarum PH04 with Cholesterol-Lowering Effect by Thuy Duong Thi Nguyen Department of Microbiology Graduate School Pukyong National University August 2005 iv Characterization of a Potential Probiotic Bacterium Lactobacillus plantarum PH04 with Cholesterol-Lowering Effect Advisor: Prof Myung Suk Lee by Thuy Duong Thi Nguyen A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science In the Department of Microbiology, Graduate School Pukyong National University August 2005 v vi Acknowledgements First of all, I deeply appreciate the guidance, support and encouragement of my adviser, Professor Myung Suk Lee Throughout my studying in Microbiology Department, she has provided the best condition for my practice, as well as has broaden my knowledge by valuable discussions I thank Professor Young Tae Kim for useful comments on my thesis I extend my sincere gratitude to Dr Ji Hee Kang, who is willing not only to give continuous suggestions but also to support in solving technical problems of my experiment I also acknowledge helpful topics of Professors Won Jae Lee, Tae Jin Choi and Young Hwan Song Special thanks are due to Professor Sang Bong Kim in Mechatronics Department for his motivation and encouragement For the same reason, I send my thanks to Dr Tan Tien Nguyen in Ho Chi Minh City University of Technology I am indebted to my friends in Laboratory of General Microbiology, who enthusiastically assist me in preparation of this work, especially Young Ju Kim, Ji Sun Lee, Mi Ju Park, Kyung Taek Kim, Eun Mi Lee, Su Yeon Chang, Hae Suk Cho and So Yeon Han In addition, I would like to thank Mrs Young Sil Jeong in Central Laboratory for analysis assistance Thanks are also due to my Vietnamese friends for their contribution in various ways, especially Dr Thien Phuc Tran, Hoang Son Ngoc Tran, Nguyen Man Le, My Le Du and Le Duyen Thi Huynh Finally, I am extremely grateful to my dear family: my parents, husbands’ parents, younger sisters Lan Anh Thi Nguyen and Hoang Anh Dang Phan, younger brothers Ngoc Huy Phung and Thanh Hai Le, and especially to my husband Chi My Phan and daughter Phuc An Nguyen Phan for their tremendous support and love Thuy Duong Thi Nguyen August, 2005 vii Contents Acknowledgements .vii List of tables x List of figures xi Abstract xii Introduction Materials and methods .7 Isolation of lactic acid bacteria with bile salt hydrolase activity 1.1 Sample 1.2 Isolation of lactic acid bacteria with bile salt hydrolase activity Identification of isolated strain 2.1 Physiological and biochemical characterization 2.2 Scanning electron microscopy .8 2.3 SDS-PAGE of whole cell protein 2.4 Sequencing of 16S rRNA .9 Characterization of isolated strain 10 3.1 Bile/ acid tolerance 10 3.2 Bile salt hydrolase activity 10 3.3 Growth phase regulation 11 3.4 Induction of bile salt hydrolase activity by bile salts 11 3.5 Effect of growth condition on bile salt hydrolase activity 12 3.6 Production of toxic substances 12 3.7 Antibiotics susceptibility .13 viii In vivo trial with mice for cholesterol-lowering effect 13 4.1 Preparation of bacterial suspension 13 4.2 Mice and diet 14 4.3 Monitoring mice 14 4.4 Serum total cholesterol and triglycerides 14 4.5 Bacterial translocation 15 4.6 Statistical analysis 15 Results 16 Isolation and identification of lactic acid bacteria with bile salt hydrolase activity 16 1.1 Isolation of lactic acid bacteria with bile salt hydrolase activity 16 1.2 Identification of isolated strain 16 Characterization of Lactobacillus plantarum PH04 .24 2.1 Bile/acid tolerance 24 2.2 Growth phase regulation 24 2.3 Induction of bile salt hydrolase activity by bile salts 24 2.4 Effect of growth condition on bile salt hydrolase production 29 2.5 Antibiotic susceptibility and incidence of toxic substances 29 In vivo trial with mice for cholesterol-lowering effect 37 3.1 Effect of feeding L plantarum PH04 on general health and fecal lactic acid bacteria 37 3.2 Effect of feeding L plantarum PH04 on cholesterol and triglycerides 37 3.3 Effect of feeding L plantarum PH04 on visceral weight index and bacterial translocation 37 Discussion .43 Summary (in Korean) 48 References .50 ix List of tables Table Carbohydrate fermentation pattern of PH04 by API 50CHL Kit 20 Table Bile salt tolerance of L plantarum PH04 25 Table Acid tolerance of L plantarum PH04 .26 Table4 Effect of temperature on bile salt hydrolase production 30 Table Effect of initial pH on bile salt hydrolase production by L plantarum PH04 31 Table Effect of NaCl on bile salt hydrolase production by L plantarum PH04 32 Table Effect of nitrogen source on bile salt hydrolase production 33 Table Effect of carbon source on bile salt hydrolase production 34 Table Antibiotic susceptibility of L plantarum PH04 35 Table 10 Production of toxic substances by L plantarum PH04 36 Table 11 Effect of feeding L plantarum PH04 on body weight 38 Table 12 Effect of feeding L plantarum PH04 on fecal lactic acid bacteria counts .39 Table 13 Effect of feeding L plantarum PH04 on serum cholesterol and triglycerides 40 Table 14 Effect of feeding L plantarum PH04 on visceral weight index of mice 41 Table 15 Effect of feeding L plantarum PH04 on bacterial translocation to organs 42 x List of figures Fig Death in 2000 attributable to selected leading risk factor .2 Fig Biosynthesis and degradation of bile acids Fig Bile salt hydrolase plate-assay on MRS agar supplemented with TDCA 17 Fig Gram staining and morphology of PH04, colony form of PH04 on MRS plate 18 Fig Scanning electron microscope of isolated strain PH04 19 Fig Effect of pH, temperature and NaCl on growth of isolated strain PH04 .21 Fig SDS-PAGE profile of whole cell proteins of isolated strain PH04 22 Fig Partial sequence of 16S rRNA of isolated strain PH04 .23 Fig Growth phase regulation of L plantarum PH04 .27 Fig 10 Induction of bile salt hydrolase activity of L plantarum PH04 by bile salts 28 xi Characterization of a Potential Probiotic Bacterium Lactobacillus plantarum PH04 with Cholesterol-Lowering Effect Thuy Duong Thi Nguyen Department of Microbiology, Graduate School, Pukyong National University Abstract Hypercholesterol is a major risk factor in coronary heart disease, which is the main cause of death in many countries Current treatments for elevated blood cholesterol are drug therapy, however are often sub-optimal and carry a risk of side effects, therefore alternative therapies are continuously promoted to overcome the challenges Recent studies show that administration of some strains of lactic acid bacteria can reduce the serum cholesterol, partly due to the bile salt hydrolase (BSH) activity of the bacteria In this study, the isolation and characterization of lactic acid bacteria with bile salt hydrolase activity and evaluation of this strain in an in vivo trial as a potential probiotic with cholesterol-lowering effect was accomplished The criteria for a probiotic strain screening including host specificity (isolation from newborn baby feces), acid/bile tolerance, and bile salt hydrolase were applied to isolate one colony with the highest activity The isolate was identified by physiological and biochemical characteristics, total protein profile xii and 16S rRNA sequencing for confirming it belonged to Lactobacillus plantarum group, and then it was designed as Lactobacillus plantarum PH04 Characterization of strain including growth characteristics (temperature 37oC, NaCl 0.05) - 41 - Table 15 Effect of feeding L plantarum PH04 on bacterial translocation to organs Organ Blood Viscera MLN Liver Spleen Feeding PH04 0/6b 0/6 1/6 1/6 1/6 Controla 0/6 0/6 1/6 1/6 1/6 Treatment group a Not feeding L plantarum PH04 b Number of positive samples/ total of tested organ samples - 42 - Discussion Hypercholesterol in humans is generally considered to be a risk factor for coronary heart disease, therefore developing therapies are needed to lower the cholesterol for reducing the death rate due to this disease Lactic acid bacteria with bile salt hydrolase recently attracted significant attention as alternative therapy for cholesterol-lowering This study was conducted to isolate and characterize a strain of lactic acid bacteria from infant feces with bile salt hydrolase and evaluate its effect in an in vivo trial for cholesterol-lowering as well as its safety property Identification of isolated strain is a critical step in assessment of the safety of potential novel probiotic strains (Holzapfel et al., 2001) In this study, the isolate was identified based on physiological and biochemical characteristics, whole-cell total protein pattern and sequencing of 16S rRNA to confirm it belonged to Lactobacillus plantarum group, which has been afforded as Generally Recognised as Safe classification (Donohue et al., 1998) L plantarum PH04 subsequently was characterized as a potential probiotic, among the important properties are bile salt and acid tolerance (Gilliland et al., 1990) Bile tolerance is needed for bacteria to grow and survive in the upper small intestine (Lee et al., 1995), where bile salt hydrolase (BSH) activity of such - 43 - lactobacilli may play a role in enterohepatic cycle Acid tolerance helps strain survive in the stomach, where hydrochloric acid and gastric acids are secreted (Benriksson et al., 1999) Besides, acid tolerance is also important for the survival of probiotics in food (Lee et al., 1999) L plantarum PH04 had acid and bile tolerance, speculatively it might still survive passage of the gastrointestinal tract Harmful enzymes and substances produced by metabolic bacterial activities are also needed to determine in the strain using as probiotic, since these compounds might be implicated in the formation of mutagens, carcinogens and tumor promoters (Borriello et al, 2003) L plantarum PH04 did not induce any toxic substances including indole, ammonia, phenylalanine deaminase, hemolysin, gelatinase and β-glucuronidase In addition, L plantarum PH04 was resistant to most of tested antibiotics, thus suggested that this strain can effectively protect the natural balance of intestinal microflora during and after antibiotics therapy it was proved resistant For functioning in cholesterol-lowering effect, the bile salt hydrolase activity of L plantarum PH04 was characterized by examining the effect of growth phase and inducing capability by bile salts on BSH activity BSH activity of L plantarum PH04 was detected only in the stationary phase, similarly with the observation of Lactobacillus sp 100-100 (Lundeen et al., 1990) In that study they suggested that because lactobacilli produce most of BSH in the small intestine, therefore the cells passing through the small intestine might be in physiological state similar to that of the cells in the stationary phase in culture - 44 - broth BSH activity of L plantarum PH04 was induced by conjugated bile salts to increase 1.3-1.8 fold higher, in contrast with no induction effect by deconjugated bile salts Furthermore, higher BSH activity was detected when the cells were incubated with glycine conjugated bile salts than taurine conjugated bile salts Thus this might be an important property for in vivo hypercholesterolemic activity, since glycine is the major conjugated bile salts in the small intestines of humans (De Smet et al., 1998; Du Toit et al., 1998) With the characteristics of bile/acid tolerance, bile salt hydrolase, resistance to some antibiotics, and not inducing harmful substances, L plantarum PH04 was further tested in a feeding trial on mice for evaluating its in vivo effect in lowering serum cholesterol and safety criteria Throughout weeks of feeding L plantarum PH04, no noticeable behavior, activity change as well as no significant difference of the feed intake and body weight gain was observed between two groups Fecal lactic acid bacteria counts increased log CFU/g in the group of feeding L plantarum PH04, thus speculated that L plantarum PH04 might be survived after passage the gastrointestinal tract, and had some effects in the intestinal microflora Total cholesterol significantly lowered 7%, and triglyceride was 10% lower than those of the control group in group fed L plantarum PH04 without any side effects of pathogenicity and bacterial translocation Pathogenicity which is one important component in safety studies of probiotic bacteria (Marteau et al., 1997; Zhou et al., 2000) includes the splenomegaly and hepatomegaly as indirect indicators of infection No macroscopic morphology changes, as well as - 45 - no significant differences of the visceral weight indexes of the MLN, spleen or liver were observed between two groups In addition, bacterial translocation, which refers to the phenomenon in which the intestinal bacteria pass through the mucosal epithelium to the organs, and may further cause bacteriamia, septicaemia and even multiple organ failure (Borriello et al., 2003), also was similarly between two groups Further more, the decrease of triglycerides without any change in liver structure as well as the ratio of liver weight to body weight suggested that the hypolipemic effect of L plantarum PH04 may not be due to a redistribution of lipids from plasma to liver but rather to a lower intestinal absorption of lipids or a higher lipid catabolism (Taranto et al., 1998) The cholesterol-lowering effects were also observed in other trials of Lactobacillus strains on pigs (Du Toit et al., 1998), rats (Usman et al., 2000), and human (Anderson et al., 1999), however the precise mechanism of these effects has not been fully explained There were the assumption that deconjugation of bile salts may contribute to lower cholesterol levels as free bile salts may be excreted more likely from gastrointestinal tract than conjugated bile salts (Chikai et al., 1987) Fecal loss of bile salts may result in an increased requirement for cholesterol as a precursor or the synthesis of new bile salts and thus may reduce the cholesterol (De Rodas et al., 1996) In addition, the alteration of bile salt metabolism through enhanced bile salt hydrolase might directly affect the solubility and intestinal absorption of cholesterol (Reyier et al., 1981), and thus it could lead to lowering-cholesterol effect - 46 - The results of this study indicated that L plantarum PH04 with bile salt hydrolase and the other characteristics of bile salt/acid tolerance, resistance to antibiotics, having no incidence of production toxic substances had a meaningful decrease effect on cholesterol level without significant side effects, and thus L plantarum PH04 had characteristics as a potential probiotic for cholesterol-lowering effect However, further study is needed to reveal the mechanism of this effect, which includes larger number of animals with different doses for a longer trial, measurement of fecal bile salts for determining the relationship between bile salt hydrolase activity and cholesterol-lowering effect - 47 - 국문 초록 세계 사망요인의 위를 차지하고 있는 심혈관 질환의 원인인 고콜레스테롤증은 그 심각성과 연간 300 억불이라는 거대한 시장규모로 인해 제약회사들을 비롯한 생명공학 연구자들의 관심의 대상이 되고 있다 그러나 기존의 콜레스테롤 저하제들의 독성과 물리적 부작용 사례가 보고되기 시작하면서, 보다 효율적인 대체 치료제에 관한 관심이 높아지고 있다 특히 고콜레스테롤증으로 인해 발병하는 심혈관질환을 화학 약품이 아닌 음식물 섭취를 통해 예방하고 치료하고자 하는 방법이 주목을 받으면서 이러한 치료효과를 가지는 약리식품 개발이 가속화되고 있는 시점이다 따라서 본 논문에서는 기존의 화학적 콜레스테롤 저하제와는 달리 부작용이 없으면서 혈중 콜레스테롤 저하 효과를 나타내는 유산균을 분리하여 그 특성과 probiotic 균주로서의 안정성을 조사하였다 먼저 신생아의 분변으로부터 내산성과 내담즙성, 그리고 bile salt hydrolase 활성을 가지는 유산균주를 분리하였고, 이들 중 pH 3, 0.15%의 담즙농도에 견디며 bile salt hydrolase 활성을 가지는 균주를 선택하였다 - 48 - 이 균주는 생화학적 방법 및 16S rRNA sequencing 등을 통해서 Lactobacillus plantarum으로 동정되었으며, 이후 L plantarum PH04 로 명명하여 본 실험에 사용하였다 L plantarum PH04 은 37oC, pH 6-7, 0-2% NaCl 농도에서 가장 잘 증식하였고, bile salt hydrolase의 최적 생성을 위한 탄소원은 glucose 및 mannose였으며, 질소원은 polypeptone, bacto peptone, bacto yeast extract인 것으로 조사되었다 이러한 조건에서 L plantarum PH04 를 배양할 경우 0.4 mM conjugated bile salt에 의해 bile salt hydrolase의 생성이 증가되었다 마우스를 이용한 동물실험을 통해 실제 in vivo 상태에서의 효과를 관찰한 실험에서, 107 CFU/mice 농도의 L plantarum PH04 를 14 일간 매일 경구투여한 경우, 대조구에 비해 serum cholesterol과 triglyceride의 농도가 각각 7%, 10%씩 감소하는 것으로 나타났다 또한 L plantarum PH04 의 경구투여에 따른 체중감소 및 소화관 외 다른 장기로의bacterial translocation등의 부작용은 관찰되지 않았다 - 49 - References Akalin, A.S., S Gonc, and S Duzel 1997 Influence of yogurt and acidophilus yogurt on serum cholesterol levels in mice J Dairy Sci 80: 2721-25 Anderson, J.W., and S.E Gilliland 1999 Effect of fermented milk (yogurt) containing Lactobacillus acidophilus L1 on serum cholesterol in hypercholesterolemic humans Am J Col Nutr 18: 43-50 Bengmark, S., and B Jeppson 1995 Gastrointestinal surface protection and mucosa reconditioning J Parenter Enteral Nutr 19: 410-15 Berg, R.D., and A.W Garlington 1979 Translocation of certain indigenous bacteria from the gastrointestinal tract to the mesenteric lymph nodes and other organs in a gnotobiotic mouse model Infect Immun 23: 403-11 Borriello, S.P., W.P Hammes, W.H Holzapfel, P Marteau, J Schrezenmeir, M Vaara, and V Valtonen 2003 Safety of probiotics that contain Lactobacillus or Bifidobacteria Clin Infect Dis 36: 775-80 Brashears, M.M., S.E Gilliland, and L.M Buck 1998 Bile salt deconjugation and cholesterol removal from media by Lactobacillus casei J Dairy Sci 81: 2103-10 Brown, M.S., and J.L Goldstein 1983 Lipoprotein metabolism in the macrophage: implications for cholesterol deposition in atherosclerosis Annu Rev Biochem 52: 223 Buck, L.M., and S.E Gilliland 1994 Comparisons of freshly isolated strains of Lactobacillus acidophillus of human origin for ability to assimilate cholesterol during growth J Dairy Sci 77: 2925-33 Chandan, R.C 1999 Enhancing market value of milk by adding cultures J Dairy Sci 82: 2245-56 10 Corzo, G., and S.E Gilliland 1999 Bile salt hydrolase activity of three strains of Lactobacillus acidophilus J Dairy Sci 82: 472-80 - 50 - 11 Dashkevicz, M.P, and S.D Feighner 1989 Development of different medium for bile salt hydrolase-active Lactobacillus spp Appl Environ Microbiol 55: 11-16 12 De Smet, I., L.V Hoorde, N.D Saeyer, M.V Woestyne, and W Verstraete 1994 In vitro study of bile salt hydrolase activity of BSH isogenic Lactobacillus plantarum 80 strains and estimation of cholesterol lowering through enhanced BSH activity Microb Ecol Health Dis 7: 315-29 13 Derek, K.W, and S.E Gililand 1993 Relationships among bile tolerance, bile salt deconjugation, and assimilation of cholesterol by Lactobacillus acidophilus J Dairy Sci 76: 956-61 14 Donohue, D.C., S Salminen, and P Marteau 1998 Safety of probiotic bacteria In Lactic acid bacteria, Microbiology and functional aspects, 2nd Ed S Salminen, A Wright, Marcel Dekker, Inc New York 15 Du Toit, M., C.M.A.P Franz, L.M.T Dick, U Schilinger, P Haberer, B Warlies, F Ahrens, and W.H Holzapfel 1998 Characterization and selection of probiotic lactobacilli for a preliminary minipig feeding trial and their effect on serum cholesterol level, faeces pH and faeces moisture content Int J Food Microbiol 40: 93104 16 Fears R., and J.R Sabine 1986 Cholesterol 7α-Hydroxylase CRC Press 17 Fielding, C.J., and P.E Fielding 1985 Metabolism of cholesterol and lipoproteins In Biochemistry of lipids and membranes Vance, D.E., J.E Vance Benjamins Cummings p404 18 Gilliland, S.E., and D.K Walker 1990 Factors to consider when selecting a culture of Lactobacillus acidophillus as a dietary adjunct to produce a hypecholesterolemic effect in humans J Dairy Sci 73: 905-11 19 Gorbach S.L., and B.R Goldin 1989 Lactobacillus strains and methods of selection US patent 4,839,28 - 51 - 20 Haberer, P., M Du Toit, L.M.T Dicks, F Ahrens, and W.H Holzapfel 2003 Effect of potentially probiotic lactobacilli on faecal enzyme activity in minipigs on a high-fat, high-cholesterol diet – a preliminary in vivo trial Int J Food Microbiol 87: 287-91 21 Holzapfel, W.H., P Haberer, R Geisen, J Bjorkroth, and U Schillinge 1998 Taxonomy and important features of probiotic microorganisms in food and nutrition Am J Clin Nutr 73, S365-373 22 Kane, J.B., and R.J Havel 1996 Treatment of hypercholesterolemia Annu Rev Med 37: 427 23 Kasper, H 1998 Protection against gastrointestinal diseases – Present facts and future developments Int J Food Microbiol 41: 127-31 24 Kawase, M., H Hashimoto, M Hosoda, H Morita, and A Hosono 2000 Effect of administration of fermented milk containing whey protein concentrate to rats and healthy men on serum lipids and blood pressure J Dairy Sci 83: 255-63 25 Klave, F.A.M., and R.V.D Meer 1993 The assumed assimilation of cholesterol by lactobacilli and Bifidobacterium bifidum is due to their bile-salt deconjugating activity Appl Environ Microbiol 59: 1120-24 26 Lee, Y.K., and S Salminen 1995 The coming age of probiotics Trends Food Sci Technol 6: 241-5 27 Ludeen, S.G., and D.C Savage 1990 Characterization and purification of bile salt hydrolase from Lactobacillus sp strain 100-100 J Bacteriol 172: 4271-77 28 Ma, L., E Deitch, R Specian, E Steffen, and R Berg 1990 Translocation of Lactobacillus murinus from the gastrointestinal tract Curr Microbiol 20: 177-84 29 MacFaddin, J.F 2000 Biochemical tests for identification of medical bacteria 3rd Ed Lippincott Williams & Wilkins Co 30 Marteau, P., and J.C Rambaud 1993 Potential of using lactic acid bacteria for therapy and immunomodulation in man FEMS Microbiol Rev 12: 207-20 - 52 - 31 Marteau, P., M Minekus, R Havenar, and J.H.J Huis 1997 Survival of lactic acid bacteria in a dynamic model of the stomach and small intestine: validation and the effects of bile J Dairy Sci 80: 1031-37 32 Noh, D.O., S.H Kim, and S.E Gilliland 1997 Incorporation of cholesterol into the cellular membrane of Lactobacillus acidophillus ATCC 43121 J Dairy Sci 80: 310713 33 Pavan, S., P Desreumaux, and A Mercenier 2003 Use of mouse model to evaluate the persistence, safety, and immune modulation capacities of lactic acid bacteria Clin Diagnos Lab Immun 10: 696-71 34 Pereira, D.I., A.L McCartney, and G.R Gibson 2003 An in vitro study of the probiotic potential of a bile salt hydrolyzing Lactobacillus fermentum strain, and determination of its cholesterol-lowering properties Appl Environ Microbiol 69: 4743-52 35 Pereira, D.I., and G.R Gibson 2002 Cholesterol assimilation by lactic acid bacteria and Bifidobacteria isolated from the human gut Appl Environ Microbiol 68: 4689-93 36 Pot, B., P Vandamme, and K Kersters 1993 Analysis of electrophoretic of whole cell protein fingerprints In Chemical methods in prokaryotic systematics, John Wiley & Sons, New York, USA pp 493-521 37 Reyier, M.O., J.C Montet, A Gerolami, C Marteau, C Crotte, A.M Montet, and S Mathieu 1981 Comparable effects of cholic, chenodeoxycholic, and ursodeoxycholic acids on micellar solubilization and intestinal absorbtion of cholesterol J Lipid Res 22: 467-73 38 Rodas, B.Z., S.E Gilliland, and C.V Maxwell 1996 Hypocholesterolemic action of Lactobacillus acidophillus ATCC 43121 and calcium hypercholesterolemia induced by diet J Dairy Sci 79: 2121-28 - 53 - in swine with 39 Roos, M.N., and K.B Martin 2000 Effects of probiotic bacteria on diarrhea, lipid metabolism, and carcinogenesis: a review or papers published between 1988 and 1998 Am J Clin Nutr 71: 405-11 40 Saarela, M., L Lahteenmaki, R Crittenden, S Salminen, and T Sandholm 2002 Gut bacteria and health foods- the European perspectives Int J Food Microbiol 78: 99-117 41 Salminen, S., and A.V Wright 1998 Lactic acid bacteria, Microbiology and functional aspects Marcel Dekker, Inc New York 42 Steinberg, S.M 2003 Bacterial translocation: what is it and what is not Ame J Sur 186: 310-5 43 St-Onge, M.P., E.R Fanworth, and P.J.H Jones 2000 Review article: Consumption of fermented and nonfermented dairy products: effects on cholesterol concentrations and metabolism 71: 674-81 44 Tahri, K., J.P Grill, and F Schneider 1996 Bifidobacteria strain behavior toward cholesterol: coprecipitation with bile salts and assimilation Curr Microbiol 33: 18793 45 Tahri, K., J.P Grill, and F Schneider 1997 Involvement of trihydroxyconjugated bile salts in cholesterol assimilation by Bifidobacteria Curr Microbiol 34: 79-84 46 Tanaka, H., H Hashiba, J Kok, and I Mierau 2000 Bile salt hydrolase of Bifidobacterium longum – Biochemical and genetic characterization Appl Environ Microbiol 66: 2502-12 47 Tannock, G.W Probiotic properties of lactic acid bacteria: plenty of scope for fundarmetal R&D Trends Biotechnol 15:270-74 48 Taranto, M.P., F Sesma, A.P.R Holdago, and G.F Valdez 1997 Bile salts hydrolase plays a key role on cholesterol removal by Lactobacillus casei Biotechnol Lett 19: 845-47 - 54 - 49 Taranto, M.P., M Medici, G Perdigon, A.P.R Holdago, and G.F Valdez 2000 Effect of Lactobacillus reuteri on the prevention of hypercholesterolemia in mice J Dairy Sci 83:401-3 50 Taranto, M.P., M Medici, G Perdigon, A.P.R Holdago, and G.F Valdez 1998 Evidence for cholesterolemic effect of Lactobacillus reuteri in hypercholesterolemic mice J Dairy Sci 81: 2336-40 51 Usman, A.H 2000 Effect of administration of Lactobacillus gasseri on serum lipids and fecal steroids in hypercholesterolemic rats J Dairy Sci 83: 1705-11 52 Walker, D.K., and S.E Gilliland 1993 Relationship among bile tolerance, bile salt deconjugation, and assimilation of cholesterol by Lactobacillus acidophillus J Dairy Sci 76: 956-61 53 Xiao, J.Z., S Kondo, N Takahashi, K Miyaji, K Oshida, A Hiramatsu, K Iwatsuki, S Kokubo, and A Hosono 2003 Effect of milk products fermented by Bifidobacterium longum on blood lipids in rats and healthy adult male volunteers J Dairy Sci 86: 2452-61 54 Yamauchi, K.E, and J Snel 2000 Transmission electron microscopic demonstration of phagocytosis and intracellular processing of segmented filamentous bacteria by intestinal epithelial cells of the chick ileum Infect Immun 68:6496-504 55 Zhou, J.S., Q Shu, K.J Rutherfurd, J Prasad, P.K Gopal, and H.S Gill 2000 Acute oral toxicology studies on potentially probiotic strains of lactic acid bacteria Food Chem Toxicol 38: 153-61 - 55 - ... catgatttacatttgagtgagtggcgaactggtgagtaacacgtgggaaa-cctgcccag 91 147 92 148 aacgggggttn aacacctggaaacagttgctaataccgcatnaacaacttggaccgcatg aagcgggggataacacctggaaacagatgctaataccgcat-aacaacttggaccgcatg 151 206 PH04 LP3 152 207 gtccgagcttgaaagatggcttcggctatcacttttggatggtcccgcggcgtattagct... agatggtggggtaacggctcaccatggcaatgatacgtagccgacctgagagggtaatcg agatggtggggtaacggctcaccatggcaatgatacgtagccgacctgagagggtaatcg 271 326 PH04 LP3 272 327 gccacattgggactgagacacggcccaaactcctacgggaggcagcagtagggaatcttc gccacattgggactgagacacggcccaaactcctacgggaggcagcagtagggaatcttc... gccacattgggactgagacacggcccaaactcctacgggaggcagcagtagggaatcttc 331 386 PH04 LP3 332 387 cacaatggacgaaagtctgatggagcaacgccgcgtgagtgaagaagggtttcggctcgt cacaatggacgaaagtctgatggagcaacgccgcgtgagtgaagaagggtttcggctcgt 391 446 PH04 LP3