Journal of Science: Advanced Materials and Devices (2018) 129e138 Contents lists available at ScienceDirect Journal of Science: Advanced Materials and Devices journal homepage: www.elsevier.com/locate/jsamd Original Article Detection analysis limit of nonlinear characteristics of DNA sensors with the surface modified by polypyrrole nanowires and gold nanoparticles Pham Van Hao a, *, Chu Thi Xuan b, Pham Duc Thanh b, Nguyen-Tran Thuat c, Nguyen Hoang Hai c, Mai Anh Tuan b a b c Institute of Scientific Research and Applications, Hanoi Pedagogical University 2, 32 Nguyen Van Linh, Phuc Yen, Vinh Phuc 280000, Viet Nam International Training Institute for Materials Science, Hanoi University of Science and Technology, Dai Co Viet, Hanoi 100000, Viet Nam Nano and Energy Center, VNU University of Science, Vietnam National University, Hanoi, 334 Nguyen Trai, Thanh Xuan, Hanoi 100000, Viet Nam a r t i c l e i n f o a b s t r a c t Article history: Received 19 January 2018 Received in revised form 29 March 2018 Accepted April 2018 Available online April 2018 Surface modification of interdigitated DNA sensors by polypyrrole nanowires and gold nanoparticles has been analyzed systematically Polypyrrole nanowires with diameter of 200 nm and length of mm were electrochemically synthesized on the gold surface of interdigitated electrodes and subsequently decorated with 20 nm gold nanoparticles Electrochemical impedance spectroscopy and differential voltage measurements were conducted to detect DNA concentrations We have observed a logarithmic dependence of analytical signals on the DNA concentration A formula for estimating the limit of detection has been derived Instead of using a conventional method in which a blank measurement is performed to record the response of the sensor in a solution containing non-complementary DNA molecules, causing an errornous estimation of detection limit, we have proposed a novel approach for the calculation of the limit of detection Limits of detection of 60.0 fM for the differential voltage method and of 84.5 fM for the electrochemical impedance spectroscopy method were calculated after taking into account all possible errors These are the lowest values for the DNA sensors reported so far The presence of the gold nanoparticles increases the effective electrode area, leading to an overall improvement of the detection limit From the perspective of the detection limit, the differential voltage method is considered more advantageous as compared to the electrochemical impedance spectroscopy one © 2018 The Authors Publishing services by Elsevier B.V on behalf of Vietnam National University, Hanoi This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/) Keywords: DNA sensor Surface modification Gold nanoparticles Polypyrrole nanowires LOD Differential voltage EIS Introduction DNA sensors are promising analytical devices, which have attracted growing attention from the academic community, spin-off companies as well as biomedical manufacturers due to their diverse applications in food processing [1e3], mechanical and biomedical engineering [4e9] and healthcare [10e14] The working mechanism of a DNA sensor is based on the hybridization between the probe and the target DNA, resulting in changes in the physical properties at the interface of the sensor These changes can be detected by different techniques such as optical [13e15], mechanical [3] or * Corresponding author E-mail addresses: haopv@hpu2.edu.vn (P Van Hao), xuan@itims.edu.vn (C.T Xuan), thanh@itims.edu.vn (P.D Thanh), thuatnt@vnu.edu.vn (N.-T Thuat), nhhai@vnu.edu.vn (N.H Hai), tuan.maianh@hust.edu.vn (M.A Tuan) Peer review under responsibility of Vietnam National University, Hanoi electrochemical/electrical [2,16,17] and differential voltage [17,18] The limit of detection (LOD) is often used to evaluate the quality of this type of sensor By definition, LOD is the lowest analyte concentration that can be distinguished from the absence of the analyte with a confidence limit The electrochemical method is versatile, simple but its LOD is typically higher than analytic requirements This disadvantage can be improved by modifying the electrode surface according to the specific applications [19] Two common surface modifications are adjusting the affinity of the surface to biological entities and increasing the surface area of an electrode Metallic nanoparticles, typically gold nanoparticles (GNPs), are preferably used to adjust the surface affinity of biosensors due to the high capability for surface functionalization with thiol groups contained in many organic molecules [20] In addition, at the nanoscale, the dynamic balance between Au0 ẳ Auỵ ỵ e on the particle surface provides a source of charged entities https://doi.org/10.1016/j.jsamd.2018.04.002 2468-2179/© 2018 The Authors Publishing services by Elsevier B.V on behalf of Vietnam National University, Hanoi This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/) 130 P Van Hao et al / Journal of Science: Advanced Materials and Devices (2018) 129e138 Nanostructured conducting polymers such as polypyrrole (PPy) are commonly used to increase the surface area of electrodes In this study, we used PPy to enhance the performance of the DNA sensor Chemical or electrochemical approaches are usually used to produce polypyrrole The chemical method involves a strong oxidizing agent with a monomer solution [21e23] The electrochemical method polymerizes monomer units on the anode electrode When absorbed on the electrode surface, monomer units lose one electron to form a pyrrole radical cation These cations go together or with the neutral monomers and form dimer dications This process undergoes a double deprotonation to give a neutral molecule Chain growth occurs then by preferential coupling between the dimers and the monomers [24] Pure PPy, an insulator, becomes a good conductor when being oxidized The charge associated with the oxidized state is typically delocalized over several pyrrole units and it can create a radical cation (polaron) or a dication (bipolaron) [25] However, the conductivity of PPy is still significantly lower than that of metals In order to improve the performance of PPy-based sensors, PPy is usually prepared in the form of nanomaterials after doping metallic nanoparticles on the latter [26] The electrodes modification by conducting polymers has shown its high applicability in combination with many biomolecules, such as protein, DNA, RNA etc For instance, DNA sensors using TAE and PPy could offer a LOD of nM [27] and nM [28], respectively LOD can be further refined by combining high surface agents such as carbon nanotubes [29], graphite [30], conducting polymers [31], and metallic nanoparticles [7,31] There are several methods for measuring DNA concentrations, such as electrochemical impedance spectroscopy [15,19,32e34], optical (fluorescent) [6,35], mechanical (resonance cantilever) [36,37], colorimetric [38] and magnetic methods [39,40] The electrochemical impedance spectroscopy (EIS) method requires a fitting procedure [31,32,41e46] The drawback of the EIS method lies in its time consuming fitting procedure Another technique which can be performed on the same electrode geometrics with the EIS is the differential voltage (DV) [47,48] The DV method relies on the measurement of the potential difference of the electrodes with and without DNA hybridization The LOD is one of the most important factors to evaluate the quality of a sensor However, the way of calculation varies in different cases In the simplest way, calculation error in LOD might be as large as three times of the standard deviation [49e51] In more complicated ways, calculating LOD must be based on the standard deviation, the blank data and the calibration data [30,41,52] The blank measurement plays an important role It is normally the measurement in a solution without any analytical agent, which indeed is the target DNA This procedure is not really easily applicable for DNA sensors because there are as many Table Sequences of the probe, complementary and non-complementary target DNA Probe: Thiol-C6-50 -AGACCTCCAGTCTCCATGGTACGTC-30 Complementary Target: Non-complementary Target: 50 eGACGTACCATGGAGACTGGAGGTCTe30 50 eACGCTGAGTACGGGTGCAAGAGTCAe30 competitively detectable agents in the solution as different DNA molecules Unexpected DNA molecules can also attach to the electrode surface by many unexpected mechanisms They can thus affect the output signals In this study, we present a novel approach for calculating the LOD in the case of a logarithmic dependence, which includes a blank measurement with the addition of non-complementary target DNA molecules to the analyte We have shown a method to modify the interdigitated DNA sensor with polypyrrole nanowires and gold nanoparticles The electrochemical impedance spectroscopy and differential voltage techniques were used for the DNA detection Experimental 2.1 Fabrication and measurements A diagram illustrating the surface modification process is presented in Fig Gold electrodes on a silica/silicon substrate were used to grow the polypyrrole nanowires, followed by the decoration with gold nanoparticles After immobilizing with probe DNA, the electrodes were used for detecting the DNA concentration through the hybridization process between the probe and the target DNA Pyrrole monomers, gelatin, KCl, K2Cr2O7 99%, H2SO4 98%, N2 99.9%, LiClO4$3H2O, phosphate buffer saline (PBS), 20 nm of diameter gold nanoparticles were commercially obtained from SigmaeAldrich The probe and target DNA, each of which consisting of 25 bases, were supplied by the Invitrogen Life Technologies Company Sequences of the probe DNA, the complementary and the noncomplementary target DNA are shown in Table The schematic diagram of the interdigitated electrodes is presented in Fig Details of the preparation of the interdigitated electrodes have been reported elsewhere [53] The polymerization process was conducted in an electrochemical reaction cell using an Autolab PGSTAT302N Two polymerization experiments were performed according to the connection configurations as shown in Fig 2c: (i) arms and were connected as the working electrodes; (ii) all arms were connected as the working electrodes The PPy polymerization on the electrode surface was presented in previous articles [54,55] with the polymerization time of 200 s The bare gold electrode (denoted as BG electrode) surface was modified with Fig Side view diagram of the surface modification process of an interdigitated sensor From left to right: the BG, PPy, GNP-PPy, GNP-PPy immobilized with the probe DNA, and GNP-PPy hybridized with the target DNA P Van Hao et al / Journal of Science: Advanced Materials and Devices (2018) 129e138 131 Fig (a) Front view diagram of the interdigitated sensor consisting of arms (denoted as 1e4) (b) Diagram of the polypyrrole polymerization and the EIS measurement setup In these setups, the interdigitated sensor described in (a) plays as a working electrode (WE) The WE with the counter electrode (CE) and the reference electrode (RE) form a conventional three-electrode system (c) Three connection configurations of the four arms: (i) and (ii) are for the preparation of the polypyrrole polymerization, (iii) is for the EIS measurement polypyrrole nanowires (denoted as PPy electrode) Gold nanoparticles were decorated on the PPy electrode by dropping ml of a solution containing 25 mM GNPs in PBS After incubating at ambient conditions for one day, the surface was rinsed with deionized (DI) water five times Finally, the PPy electrode surface decorated with gold nanoparticles (denoted as GNP-PPy electrode) was dried in air for further experiments DNA immobilization was conducted by dropping ml of a solution containing mM probe DNA in PBS on the BG, PPy and GNP-PPy electrodes The electrodes were dried under ambient conditions for one day, then rinsed with DI water five times to remove unbound probe DNA molecules The DNA hybridization process was studied by conducting the EIS measurement of the interdigitated sensors with the connection configuration (iii) shown in Fig 2c The EIS analyses were performed using an Autolab PGSTAT302N (Metrohm Autolab B.V., Utrecht, The Netherlands) with a conventional three-electrode setup An alternative potential with modulus of 250 mV DC and ±10 mV AC with frequency of 0.1 Hze10 kHz was applied on the working electrode All experiments were performed in the presence of 10 mM [Fe(CN)6]3À/4À in 0.1 M KCl as the redox-active indicator The EIS results were then fitted to an equivalent circuit (in our case, it is the Randle circuit) by using the ZsimpWin 3.10 software The EIS setup was the same as that for PPy nanowires as shown in Fig 2b The morphology of the materials and the electrode surface were investigated on a Hitachi S4800 scanning electron microscope (SEM) The chemical composition of the gold nanoparticles was studied via energy dispersion xray spectroscopy (EDS) on the same SEM system The change in the electrical potential between the electrode with the probe DNA and the electrode without the probe DNA provided the DV signals Details of the DV system were presented in [17] In brief, a potential of 100 mV with the frequency of 10 kHz from an SR830 lock-in amplifier (Stanford Research system, USA) was applied to the electrodes The hybridization of the target and the probe DNA cause a change in the conductance of the system The output signals are the voltage drop across two 1-kU resistors Each measurement was repeated times xD ¼ tsy0 b (2) this definition of LOD does not take into account the standard deviation of the calibration measurements In many cases, the first order dependence of the signal on the analyte concentration is observed This requires a linear regression In our study, a logarithmic dependence was observed therefore LOD must be differently calculated than just from Eq (2) The logarithmic dependence ya is y ẳ a ỵ b ln x Rearranging the equation, we obtain x ¼ e b In order to calculate the deviation of x, all terms have to be taken into account to calculate the standard deviation of the concentration: s2x ¼ 2 2 vx 2 vx vx sy ỵ s2a ỵ s2b vy va vb with sa , sb , sx and sy as the deviation of the intercept, the slope, the concentration and the response signal, respectively Taking the derivatives and the square root, we obtain: " #1=2 yÀa yÀa 2 sx ¼ e b s2y ỵ s2a ỵ sb b b This equation can be used to estimate the limit of detection where y is placed by the blank signal y0 ; sy is changed to sy0 2.2 Limit of detection analysis The verified method for calculating the LOD value was applied For the simplest case, LOD is determined from the blank standard deviation, sy0 , using the equation: xD ¼ tsy0 where t is the coefficient for a Student's t distribution [56] This equation is primitive so it is not often used in determining LOD recently When the analytical signal is univariating and specific, LOD is evaluated from the average signal value and standard deviations of repeated measurements of a blank sample and of several samples at concentrations near the detection limit [57] In many cases, the linear regression is applied when the response is linearly proportional to the analyte concentration, y ẳ a ỵ bx Here, a is the intercept of the calibration curve with the horizontal axis; b is the slope of the calibration curve; x is the analyte concentration; and y is the response signal The limit of detection is calculated as following: (1) " #1=2 t y0 Àa y0 À a 2 b xD ẳ tsx ẳ e sb sy0 ỵ sa þ b b The confidence factor t ¼ is chosen corresponding to the probability of making type I and type II errors a ¼ b ¼ 0:05, the confidence level of 95% Here, we apply the weighted regression 132 P Van Hao et al / Journal of Science: Advanced Materials and Devices (2018) 129e138 lines for estimating all deviation because errors, which deduced from fitting to the Randle model, can contribute to LOD: " #1=2 y0 Àa y0 À a 2 xD ẳ 3sx ẳ e b sy0 ỵ sa ỵ sb b b (3) In our analysis, the analyte concentration (x) is the DNA concentration; the response signal (y) is the value of RCT The results obtained from using the value of QCPE as the response signal are almost the same as those obtained from RCT Therefore, from now on we only analyze the data of RCT Results and discussion Fig presents the SEM images of PPy grown on gold electrode surface It can be seen that PPy was formed in wires with an average size of about 200 nm and a length of about mm These nanowires were fully distributed on the gold electrode surface Some of these nanowires have branches with a size of about 80 nm In order to study the polymerization of the pyrrole molecules on the electrically charged electrodes, in one experiment setup (configuration (i) in Fig 2c) the arms and were subjected to a voltage of 0.75 V whereas the electrodes and were not Fig 3a shows the PPy nanowires grown on the fingers of arm 1, but not on those of arm So it was confirmed that the pyrrole molecules have been polymerized on the working electrode forming PPy nanowires In another polymerization setup (configuration (ii) in Fig 2c), all four arms were short-circuited to form only one single working electrode Fig 3b and c present the SEM images of PPy nanowires on the surface of these electrodes Polypyrrole nanowires appear fully and uniformly grown on the gold electrodes Many nanowires are seen to bridge the gap between the fingers On these gaps, the PPy nanowires are also seen to randomly bridge the two fingers, which is different from the situation of the complete separation of the two fingers on Fig 3a This difference can be explained by the longer distance between two fingers being on an applied voltage, namely 30 mm in Fig 3a, compared to 10 mm in Fig 3b Fig 3d presents the PPy nanowires decorated with GNPs Gold nanoparticles can be observed as the particles with a diameter of 20 nm appeared on the nanowires and on the silica surface of the gaps Fig shows the Nyquist plots of the BG, PPy and GNP-PPy electrodes before and after DNA immobilization All results show a semicircle at high frequencies and a straight line at low frequencies This feature is typical for a simple Randle's circuit (the inset of Fig 4a) Therefore, the Randle cell was applied to study the system The Randle circuit contains an electrolyte resistance, RS , in series with a parallel combination of a constant phase element, QCPE , (often called as a double layer capacitance) and an impedance of the faradaic reaction, which consists of a charge transfer resistance, RCT , in series with a Warburg element, W In a typical Randle cell configuration, the Nyquist semicircle possesses two components: (i) the resistor's impedance on the left of the real part Z0 corresponding to the high frequency range; (ii) the sum of the resistor's and the capacitor's impedance on the right of Z0 Fig SEM images of PPy nanowires covered on BG electrode (a) The SEM result corresponding to the connection configuration (i) in Fig 2c: PPy nanowires only appear on all fingers of arm (and arm 2) and not on fingers of arm (and arm 3) (b) The SEM result corresponding to the connection configuration (ii) in Fig 2c: PPy nanowires appear on all fingers of the arms and also bridging the gap between the fingers (c) Higher magnification of (b) (d) SEM images of PPy nanowires decorated with GNPs P Van Hao et al / Journal of Science: Advanced Materials and Devices (2018) 129e138 133 Fig EIS Nyquist plots of the BG (solid square), PPy (solid circle), GNP-PPy electrode (solid triangle) before (a) and after (b) DNA immobilization The inset in (a) presents the equivalent Randles circuit corresponding to the low frequency range The Warburg impedance of the Randle cell is due to the diffusion process of molecules in the electrolyte under a gradient of concentration This impedance depends on the frequency of the potential At the high frequency range, the diffusing reactants cannot respond to the fast change of the applied voltage As a consequence, the impedance is small At the low frequency range, the reactants can follow the change of the applied voltage, thus leading to a high value of impedance In Fig 4, the semi-infinite Warburg impedance is important at the low frequency range, which appears as the diagonal line If there is any change on the surface of the electrode, RCT and QCPE are highly affected Studying the change of these quantities reveals the processes occurring on the electrode surface In the literature, RCT has been used more often than QCPE [31e34,45,58] In this study, we used both RCT and QCPE as the EIS analytic signal for determining the concentration of DNA The results obtained from all approaches were almost the same Therefore, we only present the data from RCT Values of RCT deduced from the Nyquist plots in Fig 4, are shown on Table RCT was increased from 3982 U for the BG electrode to 5120 U for the PPy electrode, then reduced to 3495 U for the GNP-PPy electrode RCT presents the charge transfer kinetics in the absence of a mass transfer limitation It is inversely proportional to the exchange current between the electrode surface and the solution With the presence of the conducting PPy nanowires, the increase of electrode surface might generate an increase of exchange current The poor conductance of the PPy nanowires, in comparison with the gold paticles layer, leads to the increase of RCT The presence of the gold nanoparticles on the PPy nanowires surface causes the increase of the conductivity of the electrode surface The gold nanoparticles have a high surface area, on which a dynamic balance of Au0 ẳ Auỵ ỵ e is established The appearance of the charged particles Auỵ and the electrons contribute to the conductance, thus reducing the RCT DNA is a polymer of four types of nucleotide linking together by a backbone The phosphodiester bonds in the backbone retain one or two negative charges from the oxygen atoms, thus making the negatively charged DNA molecules Table Impedance parameters obtained from fitting to the Randles model Electrodes after immobilizing with the probe DNA are denoted as/DNA Electrode Rs ðUÞ QCPE (mF) n RCT ðUÞ W ð10À5 Þ c2 ð10À4 Þ BG electrode BG/DNA PPy electrode PPy/DNA GNP-PPy electrode GNP-PPy/DNA 37.94 51.64 80.16 90.43 110.55 124.29 3.10 1.97 6.67 0.59 2.82 2.31 0.75 0.75 0.94 0.94 0.73 0.73 3982 4397 5120 5780 3495 4232 33.16 20.77 31.88 28.23 40.83 33.54 2.33 9.21 8.46 8.66 9.47 9.04 DNA molecules are not conductive, so consequently, their immobilization on the surfaces generates a repulsion of the redox species (in this study, these are [Fe(CN)6]3À/4À), thus inhibiting the redox reaction and enhancing the charge transfer resistance In Table 2, the parameter n is a dimensionless CPE coefficient, which is directly related to the degree of inhomogeneity and roughness of the electrode surface The value of n can be between (for ideal smooth surface) and (for extremely rough surface) In this study, n varied from 0.73 to 0.94, which indicates the high inhomogeneity of the CPE (originating from the roughness of the PPy nanowires) The value of n is the typical value obtained from other researches [19] The parameter c2 presents the deviation from the Randles model and the experimental data The small value of c2 suggests that the Randles model is well appropriate to the experimental data The role of the PPy nanowires is to improve the surface area of the electrodes However, the role of GNP can be either to increase the conductivity of the electrode or to enhance the affinity of the DNA molecules with the electrode surface To elucidate the role of the PPy nanowires, the cyclic voltammetry study of the BG, PPy and GNP-PPy electrodes were undertaken Using the RandleseSevcik equation [43], which describes the effect of scan rate on the peak current, ip , we can calculate the effective electrode area, A by using the equation: ip ¼ kACn3=2 D1=2 v1=2 : where k ¼ 2:69 Â 105 is the experimental coefficient; n is the number of electrons transferred in the redox event (1); D is the diffusion coefficient for K3[Fe(CN)6] (7:6 Â 10À8 m2/s); C is the concentration of K3[Fe(CN)6] (0.03 M/l); v is the scan rate (25 mV/s) From the cyclic voltammetry shown in Fig 5, the effective area of 207 mm2 for BG electrode is reduced to 143 mm2 for the PPy electrode With the presence of the gold nanoparticles, the effective area regained to 226 mm2 The effective area was enhanced significantly with the presence of the gold nanoparticles This can be explained by the fact that the gold nanoparticles provide charged entities Auỵ and electrons The presence of the charged entities foster the charge transfer process and thus, induce an increase of the effective area Fig presents the Nyquist plots of the EIS measurements of the BG, PPy and GNP-PPy electrode after the DNA hybridization In all cases, the shape of the plot is very similar to that shown in Fig This suggests that the Randles model can be applied to study the system A logarithmic dependence of RCT deduced from the Randle model on the target DNA concentration was obtained This approach is not as usual as other studies in which a linear dependence is often observed [30,33,52] The blank data are normally defined as the data taken from the measurement in which the 134 P Van Hao et al / Journal of Science: Advanced Materials and Devices (2018) 129e138 Fig Cyclic voltammetry data of the BG (solid square), PPy (solid circle), and GNP-PPy (solid triangle) electrodes before (a) and after (b) DNA immobilization analyte does not contain the target DNA The presence of a noncomplementary target DNA may contribute to the usual blank data Therefore, we used as blank data those taken from the measurement in the presence of the non-complementary target DNA (the sequences of the DNA are shown in Table 1) Each measurement was conducted three times The blank data taken from the analyte in the presence of the non-complementary target DNA are presented in the insets of Fig There is seen a slight difference Fig Left: EIS Nyquist plots of (a) the BG, (b) PPy and (c) GNP-PPy electrodes with different DNA concentrations Right: DNA concentration dependence of RCT of the (d) BG, (e) PPy and (f) GNP-PPy electrode The insets of (d)e(f) present the blank data The straight lines in (d)e(f) are the fitting lines P Van Hao et al / Journal of Science: Advanced Materials and Devices (2018) 129e138 between these blank data and those taken from the analyte without the non-complementary target DNA This fact confirmed that the presence of the non-complementary DNA has affected the measurements through the physical attachment of the noncomplementary DNA on the electrode surface There was no significant change in the value of RCT when increasing the noncomplementary DNA concentration When the complementary target DNA was added to the analyte, RCT increased almost logarithmically with the DNA concentration In the analysis process, we used the concentration range in which RCT depended logarithmically, and this logarithmic dependence occurs indeed at high concentrations The low DNA concentrations were therefore not considered in the analysis There occurs a hybridization process between the probe DNA and the complementary target DNA Upon hybridization, an adenine-thymine based pair possessed two intermolecular hydrogen bonds; a guanine-cytosine based pair possessed three intermolecular hydrogen bonds In fact, a hydrogen bond has the electrostatic attraction nature between two polar groups that are formed when a hydrogen atom bound to a highly electronegative 135 atom such as nitrogen and oxygen This hybridization process does not create any charge, but simply induces an accumulation of DNA molecules on the electrode surface, thus enhancing the charge transfer resistance In order to study another possible method for the DNA detection of the sensor, the differential voltage measurement was used Four arms of the sensor were modified with PPy nanowires and gold nanoparticles Arm and were covered by the probe DNA molecules (playing the role of the working sensors) leaving arm and without probe DNA molecules (playing the role of the reference sensors) The hybridization process between the target and the probe DNA on the working sensor gives rise to the conductance change of the electrode surface, hence leading to the change in the output voltage Fig shows the time dependence of the differential voltage DU ¼ jUw À Ur j of the BG, PPy, and GNP-PPy electrodes Uw and Ur are the working and the reference electrode voltage, respectively The value DUm is the difference between the mean values of DU before and after immersing the sensor in the analyte The change in voltage appeared immediately when the sensors immersed in the analyte with the response time of few seconds Fig Left: Time dependence of the DV signals, DU of the (a) BG, (b) PPy and (c) GNP-PPy electrode with different target DNA concentrations Right: DNA concentration dependence of DUm of (d) the BG, (e) PPy and (f) GNP-PPy electrode The insets of (d)e(f) present the blank data The straight lines in (d)e(f) are the fitting lines 136 P Van Hao et al / Journal of Science: Advanced Materials and Devices (2018) 129e138 Table LOD values calculated from Eqs (1)e(3) for BG, PPy and GNP-PPy electrodes The blank data were obtained in two options of measurement: the analyte without a DNA and the analyte with non-complementary DNA (Non Comp.) Surface modification Detection method Blank sample BG electrode EIS No DNA 1:78 Â Non Comp DV PPy electrode EIS DV GNP-PPy electrode EIS DV LOD (Eq (1)) (M) LOD (Eq (2)) (M) LOD (Eq (3)) (M) 10À11 1:08 Â 10À9 4:11 Â 10À12 1:39 Â 10À10 1:36 Â 10À9 No DNA 3:13 Â 10À12 9:93 Â 10À11 1:36 Â 10À9 Non Comp 7:84 Â 10À12 7:27 Â 10À11 1:04 Â 10À9 No DNA 3:52 Â 10À14 3:52 Â 10À13 7:88 Â 10À12 Non Comp 4:22 Â 10À14 1:36 Â 10À12 1:44 Â 10À11 No DNA 1:12 Â 10À14 1:45 Â 10À12 1:46 Â 10À11 Non Comp 7:53 Â 10À14 1:86 Â 10À13 6:55 Â 10À12 No DNA 3:32 Â 10À17 5:62 Â 10À15 8:45 Â 10À14 Non Comp 8:22 Â 10À17 1:97 Â 10À14 8:45 Â 10À14 No DNA 1:61 Â 10À17 4:34 Â 10À15 5:89 Â 10À14 Non Comp 7:17 Â 10À17 1:33 Â 10À14 6:00 Â 10À14 The short response time is an important characteristics of the DNA sensors Similarly to the EIS data, the change in voltage increases logarithmically with the concentration of the target DNA in the same manner of that in the RCT The results of the blank measurements are shown on the insets of Fig Each measurement was conducted times The hybridization of DNA results in the accumulation of DNA molecules on the electrode surface, thus increases the resistance and voltage of the signals from the electrode The interpretation and estimation of the limit of detection are diversified in terms of calculation formula and the blank measurement Here, we applied the most used formulas to estimate LOD (Eq (1) and Eq (2)) and compared the results of calculation to that obtained from the calculation using our formula (Eq (3)) In the estimation, the value of t equal to was chosen The results are displayed in Table We have conducted the DNA hybridization measurements with all three electrode surfaces, namely, BG, PPy and GNP-PPy surfaces For each surface, the EIS and DV methods were studied When using Eq (3), among three types of surface, the GNP-PPy electrode provided the lowest LOD of the order of 10À14 M That value increased to 10À11 M and 10À9 M for the PPy and BG surface, respectively This feature can be explained by the fact that the presence of the PPy in PPy induces an increase of the electrode surface area; the gold nanoparticles on the GNP-PPy electrode provide the charged entities Both of them enforce the charge transfer process The blank measurements were performed in two 10À12 7:21 Â cases: the analyte without any DNA and the analyte with a noncomplementary DNA (Data not shown) The limit of detection deduced from the blank data of the former was lower than that of the latter by 10À1 À 10À2 M This indicates that the presence of the non-complementary DNA on the electrode surface causes changes in the charge transfer resistance and induces the difference in RCT in the blank data by 10e30% The values of LOD obtained from Eq (1) and Eq (2) were lower than that obtained from Eq (3) by 10À1 À 10À3 M All equations take into account the standard deviation of the blank response signal, sy0 Eq (3) , however, includes the standard deviation of both the intercept sa and the slope sb Therefore, the value of LOD obtained using Eq (3) is higher, but more meaningful than that from the other approach Our best results obtained from Eq (3) are for the GNP-PPy electrodes with LOD value of 8:45 Â 10À14 M and 6:00 Â 10À14 M for the EIS and DV method, respectively This might originate from the improvement of the affinity to DNA probe molecules and the conductivity of the electrode surface due to the presence of the gold nanoparticles A similar calculation of LOD was based on the taking into account the constant phase element instead of the charge transfer resistance The results of the two approaches were found almost the same, which suggested that we could choose either RCT or QCPE to analyze the data Since the DV method is simpler than the EIS method and both give the same order of magnitude of the LOD value, the differential voltage measurement can be considered as more Table Comparison of LOD values of different DNA sensors LOD Formula LOD Value (M) Transducer Detection method Reference Equation (1) 6:50 Â 10À16 Electrochemical Label-free electrochemical aptasensing [49] 0:23 Â 10À12 Electrochemical EIS [50] 1:00 Â 10À14 Electrochemical Enzyme-based [51] 8:10 Â 10À16 Fluorescence Enzyme-enhanced fluorescence [59] 2:00 Â 10À15 Electrochemical Molecular gate control [60] 8:22 Â 10À17 Electrochemical EIS This work 7:17 Â 10À17 Electrical Differential voltage This work 4:40 Â 10À10 EIS, differential voltage [41] 2:50 Â 10À9 Electrochemical, Electrical Fluorescence Fluorescence resonance energy transfer [52] 6:00 Â 10À9 Electrochemical Cyclic voltammetry, EIS [30] 1:70 Â 10À10 Electrochemical [33] 3:20 Â 10À12 Electrochemical 5:62 Â 10À15 Electrochemical Change in RCT signals or meldola's blue signal due to hybridization Cyclic voltammetry, differential pulse voltammetry EIS 4:34 Â 10À15 Electrical DV This work 8:54 Â 10À14 Electrochemical EIS This work 6:00 Â 10À14 Electrical DV This work Equation (2) Equation (3) [61] This work P Van Hao et al / Journal of Science: Advanced Materials and Devices (2018) 129e138 advantagous and favorable than the electrochemical impedance spectroscopy measurement for the DNA sensing detection Table shows a comparison of the LOD values from our approaches with those from other DNA sensing methods using Eqs (1)e(3) Here we used the blank data taken from the analyte with the presence of the non-complementary DNA Depending on the equation used, LOD varied from the order of 10À17 À 10À14 In any cases, our values of LOD are the lowest ones, much lower than those obtained from other methods The logarithmic dependence on the concentration of the signals may be the cause of the low limit of detection Other studies yielding higher LOD values, indeed, based on the linear dependence of the signal on the concentration Conclusion A DNA sensor based on the interdigitated electrode has been successfully prepared The electrochemical impedance spectroscopy and the differential voltage techniques were used to determine DNA concentrations in a solution The electrode surface modification with polypyrrole nanowires and gold nanoparticles has improved the sensor performance We have derived a formula to calculate the limit of detection based on a logarithmic dependence of the signals on the concentration The blank measurement was conducted with the presence of a non-complementary target DNA in the analyte Our approach for the estimation of the LOD is more complicated than other procedures, but has brought by quite meaningful and well explained results It can be, therefore, effectively applied in further researches The polypyrrole nanowires have been found to induce the increase of the electrode surface area and the gold nanoparticles to improve the affinity to DNA probe molecules and the conductivity of the probe surface The differential voltage method appears to be more versatile, rapid and easier than the electrochemical impedance spectroscopy one and will be a potential tool for our future DNA sensors research Acknowledgements The authors would like to thank the MOET project #B2015-01102 for supporting this work References ndez, M S [1] C.L Manzanares-Palenzuela, B Martín-Ferna anchez-Paniagua pez, B Lo pez-Ruiz, Electrochemical genosensors as innovative tools for Lo detection of genetically modified organisms, TrAC Trends Anal Chem 66 (2015) 19e31, https://doi.org/10.1016/j.trac.2014.10.006 [2] N Khemthongcharoen, W Wonglumsom, A Suppat, K Jaruwongrungsee, A Tuantranont, C Promptmas, Piezoresistive microcantilever-based DNA sensor for sensitive detection of pathogenic Vibrio cholerae O1 in food sample, Biosens Bioelectron 63 (2015) 347e353, https://doi.org/10.1016/ j.bios.2014.07.068 [3] L.A Hiatt, D.E Cliffel, Real-time recognition of Mycobacterium tuberculosis and lipoarabinomannan using the quartz crystal microbalance, Sensor Actuator B Chem 174 (2012) 245e252, https://doi.org/10.1016/j.snb.2012.06.095 [4] D.P Kalogianni, T Koraki, T.K Christopoulos, P.C Ioannou, Nanoparticle-based DNA biosensor for visual detection of genetically modified organisms, Biosens Bioelectron 21 (2006) 1069e1076, https://doi.org/10.1016/j.bios.2005.04.016 [5] R Marie, H Jensenius, J Thaysen, C.B Christensen, A Boisen, Adsorption kinetics and mechanical properties of thiol-modified DNA-oligos on gold investigated by microcantilever sensors, Ultramicroscopy 91 (2002) 29e36, https://doi.org/10.1016/S0304-3991(02)00079-7 [6] R Ravichandran, S Sundarrajan, J.R Venugopal, S Mukherjee, S Ramakrishna, Applications of conducting polymers and their issues in biomedical engineering, J R Soc Interface (Suppl 5) (2010) S559eS579, https://doi.org/ 10.1098/rsif.2010.0120.focus [7] T Premkumar, K.E Geckeler, Graphene-DNA hybrid materials: assembly, applications, and prospects, Prog Polym Sci 37 (2012) 515e529, https:// doi.org/10.1016/j.progpolymsci.2011.08.003 [8] S.R Shin, C.K Lee, T.W Eom, S.H Lee, C.H Kwon, I So, S.J Kim, DNA-coated MWNT microfibers for electrochemical actuator, Sens Actuators B Chem 162 (2012) 173e177, https://doi.org/10.1016/j.snb.2011.12.063 137 [9] N.V Berezhnoy, N Korolev, L Nordenskiold, Principles of electrostatic interactions and self-assembly in lipid/peptide/DNA systems: applications to gene delivery, Adv Colloid Interface Sci 205 (2014) 221e229, https://doi.org/ 10.1016/j.cis.2013.08.008 [10] D Zhang, M.C Huarng, E.C Alocilja, A multiplex nanoparticle-based bio-barcoded DNA sensor for the simultaneous detection of multiple pathogens, Biosens Bioelectron 26 (2010) 1736e1742, https://doi.org/10.1016/ j.bios.2010.08.012 [11] M Kalofonou, C Toumazou, Semiconductor technology for early detection of DNA methylation for cancer: from concept to practice, Sensor Actuator B Chem 178 (2013) 572e580, https://doi.org/10.1016/j.snb.2012.12.054 [12] M Sirajuddin, S Ali, A Badshah, Drug-DNA interactions and their study by UV-Visible, fluorescence spectroscopies and cyclic voltametry, J Photochem Photobiol B Biol 124 (2013) 1e19, https://doi.org/10.1016/ j.jphotobiol.2013.03.013 [13] G Yunus, S Srivastava, M Kuddus, V.D Gupta, Drug-DNA interaction: a theoretical study on the binding of thionine with DNAs of varying base composition, Curr Appl Phys 13 (2013) 322e326, https://doi.org/10.1016/ j.cap.2012.05.020 [14] Y Shin, A.P Perera, M.K Park, Label-free DNA sensor for detection of bladder cancer biomarkers in urine, Sensor Actuator B Chem 178 (2013) 200e206, https://doi.org/10.1016/j.snb.2012.12.057 [15] T.J Gnanaprakasa, O.A Oyarzabal, E.V Olsen, V.A Pedrosa, A.L Simonian, Tethered DNA scaffolds on optical sensor platforms for detection of hipO gene from Campylobacter jejuni, Sensor Actuator B Chem 156 (2011) 304e311, https://doi.org/10.1016/j.snb.2011.04.037 [16] J.I.A Rashid, N.A Yusof, J Abdullah, U Hashim, R Hajian, The utilization of SiNWs/AuNPs-modified indium tin oxide (ITO) in fabrication of electrochemical DNA sensor, Mater Sci Eng C 45 (2014) 270e276, https://doi.org/ 10.1016/j.msec.2014.09.010 [17] A.T Mai, T.P Duc, X.C Thi, M.H Nguyen, H.H Nguyen, Highly sensitive DNA sensor based on polypyrrole nanowire, Appl Surf Sci 309 (2014) 285e289, https://doi.org/10.1016/j.apsusc.2014.05.032 [18] T Quang, N Thi, H Hanh, N Thanh, P Van Chung, A novel biosensor based on serum antibody immobilization for rapid detection of viral antigens, Talanta 86 (2011) 271e277, https://doi.org/10.1016/j.talanta.2011.09.012 [19] T.L Tran, T.X Chu, D.C Huynh, D.T Pham, T.H.T Luu, A.T Mai, Effective immobilization of DNA for development of polypyrrole nanowires based biosensor, Appl Surf Sci 314 (2014) 260e265, https://doi.org/10.1016/ j.apsusc.2014.06.068 [20] L Goswami, N Sen Sarma, D Chowdhury, Determining the ionic and electronic contribution in conductivity of polypyrrole/Au nanocomposites, J Phys Chem C 115 (2011) 19668e19675, https://doi.org/10.1021/jp2075012 [21] X Zhang, J Zhang, W Song, Z Lu, Controllable synthesis of conducting polypyrrole nanostructures, J Phys Chem B 110 (2006) 1158e1165, https:// doi.org/10.1021/jp054335k [22] N Mermilliod, J Tanguy, F Petiot, A study of chemically synthesized polypyrrole as electrode material for battery applications, J Electrochem Soc 133 (1986) 1073e1079, https://doi.org/10.1149/1.2108788 [23] S Machida, S Miyata, A Techagumpuch, Chemical synthesis of highly electrically conductive polypyrrole, Synth Met 31 (1989) 311e318, https:// doi.org/10.1016/0379-6779(89)90798-4 [24] D Ateh, H Navsaria, P Vadgama, Polypyrrole-based conducting polymers and interactions with biological tissues, J R Soc Interface (2006) 741e752, https://doi.org/10.1098/rsif.2006.0141 [25] G March, T Nguyen, B Piro, Modified electrodes used for electrochemical detection of metal ions in environmental analysis, Biosensors (2015) 241e275, https://doi.org/10.3390/bios5020241 [26] I Chikouche, A Sahari, A Zouaoui, S Tingry, Enhancement of electric properties of polypyrrole by copper electrodeposition, Can J Chem Eng 93 (2015) 1076e1080, https://doi.org/10.1002/cjce.22197 [27] J Cha, J.I Han, Y Choi, D.S Yoon, K.W Oh, G Lim, DNA hybridization electrochemical sensor using conducting polymer, Biosens Bioelectron 18 (2003) 1241e1247, https://doi.org/10.1016/S0956-5663(03)00088-5 [28] P.D Tam, M.A Tuan, T.Q Huy, A.-T Le, N Van Hieu, Facile preparation of a DNA sensor for rapid herpes virus detection, Mater Sci Eng C 30 (2010) 1145e1150, https://doi.org/10.1016/j.msec.2010.06.010 [29] R Hajian, Z Mehrayin, M Mohagheghian, M Zafari, P Hosseini, N Shams, Fabrication of an electrochemical sensor based on carbon nanotubes modified with gold nanoparticles for determination of valrubicin as a chemotherapy drug: valrubicin-DNA interaction, Mater Sci Eng C 49 (2015) 769e775, https://doi.org/10.1016/j.msec.2015.01.072 [30] B Rezaei, M.K Boroujeni, A.A Ensafi, Fabrication of DNA, o-phenylenediamine, and gold nanoparticle bioimprinted polymer electrochemical sensor for the determination of dopamine, Biosens Bioelectron 66 (2015) 490e496, https://doi.org/10.1016/j.bios.2014.12.009 [31] J Wilson, S Radhakrishnan, C Sumathi, V Dharuman, Polypyrrole-polyaniline-Au (PPy-PANi-Au) nano composite films for label-free electrochemical DNA sensing, Sensor Actuator B Chem 171e172 (2012) 216e222, https:// doi.org/10.1016/j.snb.2012.03.019 [32] T.T.N Lien, Y Takamura, E Tamiya, M.C Vestergaard, Modified screen printed electrode for development of a highly sensitive label-free impedimetric immunosensor to detect amyloid beta peptides, Anal Chim Acta 892 (2015) 69e76, https://doi.org/10.1016/j.aca.2015.08.036 138 P Van Hao et al / Journal of Science: Advanced Materials and Devices (2018) 129e138 [33] M Kaplan, T Kilic, G Guler, M Jihane, A Amine, M Ozsoz, A novel method for sensitive microRNA detection: electro polymerization based doping, Biosens Bioelectron (2016), https://doi.org/10.1016/j.bios.2016.09.050 [34] L Truong, T Nguyen, A Luu, Y Ukita, Y Takamura, Sensitive labelles impedance immunosensor using gold nanoparticles-modified of screenprinted carbon ink electrode for act-prostate specific antigen detection, Rsc Org (2012) 1912e1914 [35] Z Chen, G Li, L Zhang, J Jiang, Z Li, Z Peng, L Deng, A new method for the detection of ATP using a quantum-dot-tagged aptamer, Anal Bioanal Chem 392 (2008) 1185e1188, https://doi.org/10.1007/s00216-008-2342-z San Paulo, M Calleja, Biosensors based on [36] J Tamayo, P.M Kosaka, J.J Ruz, A nanomechanical systems, Chem Soc Rev 42 (2013) 1287e1311, https:// doi.org/10.1039/C2CS35293A [37] Y Liu, L.M Schweizer, W Wang, R.L Reuben, M Schweizer, W Shu, Label-free and real-time monitoring of yeast cell growth by the bending of polymer microcantilever biosensors, Sensor Actuator B Chem 178 (2013) 621e626, https://doi.org/10.1016/j.snb.2012.12.111 [38] Y Song, W Wei, X Qu, Colorimetric biosensing using smart materials, Adv Mater 23 (2011) 4215e4236, https://doi.org/10.1002/adma 201101853 [39] S Bi, Y Cui, Y Dong, N Zhang, Target-induced self-assembly of DNA nanomachine on magnetic particle for multi-amplified biosensing of nucleic acid, protein, and cancer cell, Biosens Bioelectron 53 (2014) 207e213, https:// doi.org/10.1016/j.bios.2013.09.066 [40] F Li, J Kosel, A magnetic method to concentrate and trap biological targets, IEEE Trans Magn 48 (2012) 2854e2856, https://doi.org/10.1109/ TMAG.2012.2202644 [41] P Van Hao, P.D Thanh, C.T Xuan, N.H Hai, M.A Tuan, Development of a DNA sensor based on nanoporous Pt-Rich electrodes, J Electron Mater 46 (2017) 3491e3498, https://doi.org/10.1007/s11664-017-5326-y [42] C Ocana, M del Valle, Three different signal amplification strategies for the impedimetric sandwich detection of thrombin, Anal Chim Acta 912 (2016) 117e124, https://doi.org/10.1016/j.aca.2016.01.027 [43] A.J Bard, Faulkner, Electrochemical Methods, 2000, https://doi.org/10.1146/ annurev.matsci.30.1.117 [44] A Alsamuraee, H Jaafer, Electrochemical impedance spectroscopic evaluation of corrosion protection properties of polyurethane/polyvinyl chloride blend coatings on steel, Am J Sci Ind Res (2011) 761e768, https://doi.org/ 10.5251/ajsir.2011.2.5.761.768 , M del Valle, Impedimetric [45] A Bonanni, M.I Pividori, S Campoy, J Barbe detection of double-tagged PCR products using novel amplification procedures based on gold nanoparticles and protein G, Analyst 134 (2009) 602e608, https://doi.org/10.1039/b815502j [46] E Katz, I Willner, Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors, Electroanalysis 15 (2003) 913e947, https://doi.org/10.1002/elan.200390114 [47] G Rizzi, F.W Osterberg, A.D Henriksen, M Dufva, M.F Hansen, On-chip magnetic bead-based DNA melting curve analysis using a magnetoresistive sensor, J Magn Magn Mater 380 (2015) 215e220, https://doi.org/10.1016/ j.jmmm.2014.09.004 [48] P.D Tam, M.A Tuan, N Van Hieu, N.D Chien, Impact parameters on hybridization process in detecting influenza virus (type A) using conductimetric- [49] [50] [51] [52] [53] [54] [55] [56] [57] [58] [59] [60] [61] based DNA sensor, Phys E Low-dimens Syst Nanostruct 41 (2009) 1567e1571, https://doi.org/10.1016/j.physe.2009.04.035 G Yan, Y Wang, X He, K Wang, J Liu, Y Du, A highly sensitive label-free electrochemical aptasensor for interferon-gamma detection based on graphene controlled assembly and nuclease cleavage-assisted target recycling amplification, Biosens Bioelectron 44 (2013) 57e63, https://doi.org/10.1016/ j.bios.2013.01.010 W Zhang, T Yang, X Zhuang, Z Guo, K Jiao, An ionic liquid supported CeO2 nanoshuttles-carbon nanotubes composite as a platform for impedance DNA hybridization sensing, Biosens Bioelectron 24 (2009) 2417e2422, https:// doi.org/10.1016/j.bios.2008.12.024 G Liu, Y Wan, V Gau, J Zhang, L Wang, S Song, C Fan, An enzyme-based EDNA sensor for sequence-specific detection of femtomolar DNA targets, J Am Chem Soc 130 (2008) 6820e6825, https://doi.org/10.1021/ja800554t H Zhu, Y Ding, A Wang, X Sun, X.-C Wu, J.-J Zhu, A simple strategy based on upconversion nanoparticles for a fluorescent resonant energy transfer biosensor, J Mater Chem B (2015) 458e464, https://doi.org/10.1039/ C4TB01320D C Karuppiah, S Palanisamy, S.M Chen, S.K Ramaraj, P Periakaruppan, A novel and sensitive amperometric hydrazine sensor based on gold nanoparticles decorated graphite nanosheets modified screen printed carbon electrode, Electrochim Acta 139 (2014) 157e164, https://doi.org/10.1016/ j.electacta.2014.06.158 M Labib, P.O Shipman, S Marti c, H Kraatz, A bioorganometallic approach for rapid electrochemical analysis of human immunodeficiency virus type-1 reverse transcriptase in serum, Electrochim Acta 56 (2011) 5122e5128, https://doi.org/10.1016/j.electacta.2011.03.063 S.M Radke, E.C Alocilja, A high density microelectrode array biosensor for detection of E coli O157: H7, Biosens Bioelectron 20 (2005) 1662e1667, https://doi.org/10.1016/j.bios.2004.07.021 D Rodbard, Statistical estimation of the minimal detectable concentration (“sensitivity”) for radioligand assays, Anal Biochem 90 (1978) 1e12, https:// doi.org/10.1016/0003-2697(78)90002-7 G.L Long, J.D Winefordner, Limit of detection: a closer look at the IUPAC definition, Anal Chem 55 (1983) 712e724, https://doi.org/10.1021/ ac00258a001 T.T.N Lien, T.D Lam, V.T.H An, T.V Hoang, D.T Quang, D.Q Khieu, T Tsukahara, Y.H Lee, J.S Kim, Multi-wall carbon nanotubes (MWCNTs)doped polypyrrole DNA biosensor for label-free detection of genetically modified organisms by QCM and EIS, Talanta 80 (2010) 1164e1169, https:// doi.org/10.1016/j.talanta.2009.09.002 S Niu, Y Jiang, S Zhang, Fluorescence detection for DNA using hybridization chain reaction with enzyme-amplification, Chem Commun (Camb) 46 (2010) 3089e3091, https://doi.org/10.1039/c000166j M.M.N Nuzaihan, U Hashim, M.K Md Arshad, S.R Kasjoo, S.F.A Rahman, A.R Ruslinda, M.F.M Fathil, R Adzhri, M.M Shahimin, Electrical detection of dengue virus (DENV) DNA oligomer using silicon nanowire biosensor with novel molecular gate control, Biosens Bioelectron 83 (2016) 106e114, https://doi.org/10.1016/j.bios.2016.04.033 M.B Gholivand, L Mohammadi-Behzad, G Paimard, K Gholivand, A Gholami, Solid state electrochemical oxidation of some bisphosphoramidates in aqueous media and their applications in DNA sensing, Electroanalysis 28 (2016) 601e610, https://doi.org/10.1002/elan.201500391 ... arms of the sensor were modified with PPy nanowires and gold nanoparticles Arm and were covered by the probe DNA molecules (playing the role of the working sensors) leaving arm and without probe DNA. .. role of GNP can be either to increase the conductivity of the electrode or to enhance the affinity of the DNA molecules with the electrode surface To elucidate the role of the PPy nanowires, the. .. current The poor conductance of the PPy nanowires, in comparison with the gold paticles layer, leads to the increase of RCT The presence of the gold nanoparticles on the PPy nanowires surface