In previous investigation, we reported that stably knocking down cyclin-dependent kinase 4(CDK4) induced expression of let-7c, which further suppressed cell cycle transition and cell growth by modulating cell cycle signaling in nasopharyngeal carcinoma (NPC).
Liu et al BMC Cancer (2016) 16:238 DOI 10.1186/s12885-016-2277-2 RESEARCH ARTICLE Open Access CDK4 and miR-15a comprise an abnormal automodulatory feedback loop stimulating the pathogenesis and inducing chemotherapy resistance in nasopharyngeal carcinoma Zhen Liu1,4†, Chao Cheng2,5†, Xiaojun Luo2,3†, Qiong Xia2†, Yejie Zhang4, Xiaobing Long2,6*, Qingping Jiang1* and Weiyi Fang2,3* Abstract Background: In previous investigation, we reported that stably knocking down cyclin-dependent kinase 4(CDK4) induced expression of let-7c, which further suppressed cell cycle transition and cell growth by modulating cell cycle signaling in nasopharyngeal carcinoma (NPC) In this study, we further explored the molecular function and mechanism of CDK4 modulating miRNAs to stimulate cell cycle transition, cell growth, and Cisplatin (DDP) -resistance on in NPC Methods: We identified changes in miRNAs by miRNA array and real-time PCR and the effect on DDP after knocking down CDK4 in NPC cells Further, we investigated the molecular mechanisms by which CDK4 modulated miR-15a in NPC Moreover, we also explored the role of miR-15a and the effect on DDP in NPC Finally, we analyzed the correlation of miR-15a and CDK4 expression in NPC tissues Results: In addition to let-7 family members, we observed that upregulated expression of miR-15a was significantly induced in CDK4-suppressed NPC cells Further, we found that knocking down CDK4 suppressed c-Myc expression, and the latter directly suppressed the expression of miR-15a in NPC Furthermore, miR-15a as a tumor suppressor antagonized CDK4 repressing cell cycle progression and cell growth in vitro and in vivo and induced the sensitivity of cells to DDP by regulating the c-Myc/CCND1/CDK4/E2F1 pathway in NPC Finally, miR-15a was negatively weak correlated with the expression of CDK4 in NPC Conclusions: Our studies demonstrate that CDK4 and miR-15a comprise an abnormal automodulatory feedback loop stimulating the pathogenesis and inducing chemotherapy resistance in NPC Keyword: NPC, CDK4, miR-15a, Tumor suppressor * Correspondence: longfengxb@126.com; 413430005@qq.com; fangweiyi1975@163.com † Equal contributors Cancer Research Institute, Southern Medical University, Guangzhou 510515, China Third Affiliated Hospital of Guangzhou Medical University, Guangzhou 510150, PR China Full list of author information is available at the end of the article © 2016 Liu et al Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated Liu et al BMC Cancer (2016) 16:238 Background Cell cycle progression is controlled in part by a family of cyclin proteins and cyclin dependent kinases (Cdks) CDK4 is a member of cyclin-dependent kinase family, and in complex with D-type cyclins, is thought to regulate cell growth during cell cycle transition from G1 to S phase In previous studies, CDK4 was reported to play a significant role in promoting the pathogenesis of tumors including oral squamous cell carcinoma [1], pancreatic endocrine tumors [2], lung cancer [3, 4], nasopharyngeal carcinoma [5–7], and other tumors [8–10] MicroRNAs (miRNAs) are ~22-nucleotide (nt) small RNAs that have emerged as important factors regulating deadenylation, translation, and decay of their target mRNAs In recent years, many miRNAs were observed to be deregulated and participate in the carcinogenesis by modulating important tumor-associated genes [11– 15] miR-93, derived from miR-106b-25 cluster, is elevated in various types of cancers and plays oncogenic roles by suppressing significant tumor suppressors including PTEN, LATS2, and TGFBR2 et al [16] miR-18b is a potential oncogene suppressed by CTGF through PI3K/AKT/c-Jun/c-Myc to induce cell growth [17] miR184 induced by PDCD4 directly suppressed c-Myc and Bcl-2, which inhibited cell growth and stimulated cell apoptosis in nasopharyngeal carcinoma [18] NPC is one of the most common carcinomas with a malignant phenotype in Southern China and Southeast Asian countries Synergetic contributions of viral infections, genetic alterations, and environmental factors drive the aberrant activity of a variety of genes, which stimulate the initiation and development of NPC In previous investigation, we have reported that overexpressed CDK4 was considered an unfavorable factor associated with NPC progression and poor prognosis Knocking down CDK4 induced the upregulation of let-7c and the latter further reduced cell cycle progression and cell growth by modulating p16/CDK4/E2F1 signaling in NPC This demonstrated the significance of miRNA regulation of CDK4 in NPC pathogenesis [6] In this study, we further study the molecular basis of CDK4 modulating miRNAs in inducing cell cycle transition, cell proliferation, and the effect on DDP in NPC Methods Page of 12 normal nasopharyngeal tissues) were obtained from an otorhinolaryngologist using nasal endoscope Subsequently, all samples were immediately stored in liquid nitrogen Clinical processes were approved by the Ethics Committees of People’s Hospital of Zhongshan City and patients gave informed written consent miRNA array for shCDK4 In-house two-channel oligo-arrays (CCDTM-miRNA850V4px) from NIH including 713 human, mammalian, and viral mature antisense miRs plus two internal controls with seven serial dilutions were endowed by Professor Wang E and Marincola FM Six to seven microgram total RNA samples isolated respectively from shCDK4 and its control 5-8F cells were labeled by Cy5-dCTP and Cy3dCTP, respectively, in a reverse transcription reaction The balanced mixture of Cy5- and Cy3-labeled targets was co-hybridized against miRNAs chip The experiments were repeated four times and scanned images were converted to digital data by GenePixpro V6.0 (Molecular Devices Corporation, Sunnyvale, CA, USA) Finally, the data were analyzed using BRB ArrayToolsV3.7.2 software (National Cancer Institute, Bethesda, MD, USA) RNA isolation and qRT-PCR RNA was extracted from NPC cell lines, NPC tissues and normal nasopharynx tissues using Trizol (Takara, Shiga, Japan) For miR-15a qRT-PCR expression analysis, mature miRNAs were reverse-transcribed, and real-time PCR was performed using All-in-One™ miRNA qRTPCR Detection Kit following the manufacturer’s protocol (GeneCopoeia™, Cat.No: AOMD-Q020) All data were normalized to U6 expression For CDK4 qRT-PCR, RNA was transcribed into cDNA and amplified with specific sense/antisense primer [7] The assays were performed in accordance with manufacturer’s instructions (Takara, Shiga, Japan) The PCR reaction for each gene was repeated three times miRNA and mRNA expression was normalized to U6 and ARF5, respectively using the 2ΔΔCt method as previously described [6] Expression values (2-ΔΔCt) of CDK4 or miR-15a in NPC tissues greater than or equal to the mean expression value of NP tissues were considered high expression Conversely, expression values of CDK4 or miR-15a in NPC tissues less than NP tissues were regarded as low expression Sample collection and cell culture Two NPC cell lines 5–8 F and HONE1 as well as shCDK4-2 and shCDK4-3 [6] were obtained from Cancer Research Institute of Southern Medical University and maintained in RPMI 1640 medium supplemented with 10 % newborn calf serum (NBCS) (PAA Laboratories, Inc, Pasching, Austria) in a humidified chamber with % CO2 at 37 °C All 63 fresh NPC and 15 NP samples (13 cases for chronic nasopharyngitis tissuses and cases for Western blot analysis Western blot was carried out according to previous descriptions [17, 18] with rabbit polyclonal CDK4, GAPDH, E2F1 antibody (1:400; Santa Cruz Biotechnology, Santa Cruz, USA); C-Myc antibody (Cell signaling technology, Danvers, USA), and CCND1 antibody (1:500; Epitomics, Burlingame, USA) An HRP-conjugated antirabbit IgG antibody was used as the secondary antibody Liu et al BMC Cancer (2016) 16:238 (Zhongshan, Beijing, China) Signals were detected using enhanced chemiluminescence reagents (Pierce, Rockford, IL) and Bio-RAD ChemiDox XRS Chromatin immunoprecipitation assay Chromatin immunoprecipitation assay was carried out according to previous descriptions [12, 13] DNA–protein complexes were immunoprecipitated from 5-8F and HONE1 cells with the transfection of c-Myc cDNA by using the Chromatin Immunoprecipitation Kit (Millipore, Billerica, MA, USA), according to the manufacturer’s protocol with mg polyclonal c-Myc antibody or mg normal mouse IgG (Millipore) Precipitated DNA was subjected to PCR analysis using specific primers (Forward:5′ AAATGCCTGTGGGCTGGTAGCT3′; Reverse: 5′GCCG CGGAGGTGAAGTGAACT3′) to amplify across the DLEU2/miR-15a promoter region [19] Finally, DNA was analyzed by % agarose gel electrophoresis Luciferase activity assay The plasmids including pGL3-control and pGL3-promoter used for luciferase reporter gene expression analysis were bought from Promega Ltd pGL3-Wild DLEU2 1A promote vector(pGL3-W) containing c-Myc binding site (CACGTG) was constructed by RT-PCR using specific primers(Forward:5′AAGAGCTC(Sac I)AAGCCGGCAGG GCGGTTTT3′;Reverse: 5′AACTCGAG(XhoI)TACCGAC TGCGCCAGCCTTG3′) Meanwhile, pGL3-Mutant vector with a mutated c-Myc binding site (CGCATT) in the DLEU2 regulatory region was also constructed 5-8F cells with exogenous c-Myc expression were plated in 24-well plates at a density of × 104 cells/well After 24 h, pGL3-C pGL3-W or pGL3-M were respectively transfected with pcDNA3.1/c-Myc or its control vector were introduced into 5-8F cells using Lipofectamine 2000 After 48 h, firefly luciferase activity was measured using the dual luciferase reporter assay system according to the manufacturer’s protocol Transient transfection with miR-15a mimics and its inhibitor miR-15a mimic and its inhibitor were designed and synthesized by Guangzhou RiboBio (RiboBio Inc, China) Twenty-four hours prior to transfection, NPC cells were plated onto a 6-well plate or a 96-well plate (Nest, Biotech, China) at 30–50 % confluence They were then transfected into cells using TurboFectTM siRNA Transfection Reagent (Fermentas, Vilnius, Lithuania) according to the manufacturer’s protocol Cells were collected after 48–72 h for further experiments miRNA target validation CCND1 were predicted to be directly regulated targets of miR-15a miRwalk softwares (University of Heidelberg, Page of 12 Mannheim, Germany) A 289 fragment of CCND1 3′ UTR amplified by PCR primers (Sense:5′-AACTCG AGCCATTTTCTTATTGCGCTGC-3′; Antisense:5′-AA GCGGCCGCGGCTAAGTGAAGCATGAGGT-3′) was cloned into psiCHECK-2 vectors (named wt) with XhoI and NotI restriction enzyme sites Site-directed mutagenesis of the miR-15a binding site in CCND1 3′UTR was performed using GeneTailor Site-Directed Mutagenesis System (Invitrogen; named mt) For reporter assays, wt or mt vector and the control vector psiCHECK-2 vector were cotransfected into SUNE1 cells with miR-15a mimics or inhibitor Luciferase activity was measured at 48 h after transfection using the Dual-Luciferase Reporter Assay System (Promega Corporation, Madison, WI, USA) Cell proliferation analysis Cell proliferation was analyzed using MTT assay as described previously [17, 18] For miR-15a inhibitor and mimics, the cells were incubated for 1, 2, or days Cell cycle assay To evaluate cell cycle distribution, cells were fixed in 70 % ice-cold ethanol for 48 h at °C, and stained by incubating cells with PBS containing 10 μg/mL propidium iodide and 0.5 mg/mL RNase A for 15 at 37 °C, and analyzed for the DNA content of labeled cells by FACS Caliber Cytometry (BD Bioscience, USA) Each experiment was done in triplicate Establishment of NPC cell line with stable expression of miR-15a Lentivirus (GV209) particles carrying hsa-pri-miR-15a precursor and its control were prepared Lentiviral transduction of 5–8 F and HONE1 cells was carried out according to the manufactures’ protocol(Genechem Company, Shanghai, China) The resulting cells were seeded onto 96-well plates and cultured for weeks to produce a stable miR-15a-overexpressing 5-8F and HONE1 cells and their respectively control cells High expression of miR-15a was validated by qRT-PCR In vivo tumorigenesis in nude mice A total of × 106 logarithmically growing miR-15aoverexpressing 5-8F and HONE1 cells and their control cells in 0.1 ml RPMI 1640 medium were respectively subcutaneously injected into the left or right flank of 4– 6-week-old male BALB/c nu/nu mice (N = 5) Mice were maintained in a barrier facility on HEPA-filtered racks and fed with an autoclaved laboratory rodent diet All animal studies were conducted in accordance with the principles and procedures outlined in Southern Medical University Guide for the Care and Use of Animals After Liu et al BMC Cancer (2016) 16:238 25 days the mice were killed, and tumor tissues were excised and weighted MTT cytotoxicity assay NPC Cells (5-8F and HONE1) with miR-15a overexpression or their control cells were respectively seeded in 96-well plates in 100 μl DMEM medium supplemented with 10 % FBS at × 103 cells/well Once the cells attached, they were respectively treated with DDP in 2.5, 5, 10, 20, 30, 40 or 50 μM (0.5 mg/ml) and incubated at 37 °C in % CO2 for 48 h Subsequently, 10 μl of MTT (5 mg/ml) (Sigma, StLouis, MO, USA) was added to each well, and the plates were incubated at 37 °C for h Further, the supernatants were removed and 100 μl of DMSO (Sigma) was added to each well The absorbance value (OD) of each well was measured at 490 nm and half maximal inhibitory concentration (IC50) was calculated Experiments were performed three times Statistical analysis All data were analyzed for statistical significance using SPSS 19.0 software The Student’s test was applied to examine the differences of mRNA expressions of CDK4 and miR-15a between normal epithelium and cancer tissues of nasopharynx The relationship between CDK4 and miR-15a expression levels was analyzed using pearson test Two-tailed Student’s t-test was used for comparisons of two independent groups One-way ANOVA was used to determine the differences between groups for all in vitro analyses A P value of less than 0.05 was considered statistically significant Results Stably downregulated CDK4 expression induced the expression of miR-15a in vitro in NPC In a previous study, we demonstrated that suppressing CDK4 expression using lentiviral-mediated shRNA inhibited NPC cell proliferation and G1 to S cell cycle Page of 12 transition by inducing let-7c To further investigate the effect of CDK4 on miRNAs in NPC, we used miRNA chip to compare the differential miRNA expression between shCDK4-2 and shCDK4-3 and mock cells [6] We observed that knocking down CDK4 significantly stimulated the expression of miR-15a and let-7 family members including let-7c (Fig 1a) Further, we validated the upregulated expression of miR-15a in CDK4-suppressed 5-8F NPC cells by real-time qPCR (Fig 1b) Transiently knocking down CDK4 also elevated the expression of miR-15a To confirm that CDK4 knockdown elevated miR-15a expression in NPC, we used siRNA-CDK4 to transfect NPC 5-8F and HONE1 cells We observed that siCDK42 provided the greatest suppression of CDK4 mRNA (Fig 2a) among three siCDK4 fragments tested in NPC 5-8F and HONE1 cells Further, we validated that siCDK4-2 significantly downregulated CDK4 protein levels in NPC 5-8F and HONE1 cells (Fig 2b) Finally, we found that transiently knocking down CDK4 by siRNA also stimulated the expression of miR-15a (Fig 2c) Inhibition of CDK4 induced miR-15a expression by suppressing c-Myc expression In a previous report, we found that inhibition of CDK4 decreased the expression of CCND1,CDK6, and E2F1 [6] Here, we observed that stably knocking down CDK4 reduced the expression of c-Myc in NPC 5-8F cells (Fig 3a) Further, we observed that suppressing expression of c-Myc (Fig 3b) markedly increased the expression of miR-15a in NPC 5-8F and HONE1 cells (Fig 3c) c-Myc directly binds to the promoter of miR-15a (DLEU2) Atrributing to the fact that the miR-15a promoter contains a binding site for c-Myc, we speculated that c-Myc Fig Stable suppression of CDK4 elevated the expression of miR-15a in NPC a The expression of miR-15a and let-7 family members was induced after stable knockdown of CDK4 NPC cells based on a micro-RNA array assay b miR-15a expression was significantly increased in NPC cells with stably knocking down CDK4 expression by qPCR assay (*P < 0.05) Liu et al BMC Cancer (2016) 16:238 Page of 12 Fig Transiently inhibited CDK4 by siRNA stimulated the expression of miR-15a a The interference efficiency of siCDK4s in mRNA level was examined by qPCR in NPC cells b Western blot was used to validate the interference efficiency of siCDK4-2 on protein levels in NPC cells c Transiently inhibited CDK4 stimulated the expression of miR-15a by qPCR (*P < 0.05) Fig Knocking down CDK4 induced miR-15a expression by suppressing c-Myc expression a Stable suppression of CDK4 reduced the expression of c-Myc in NPC cells b si-Myc inhibited the expression of c-Myc in NPC cells c Transiently inhibited c-Myc by siRNA stimulated the expression of miR-15a (*P < 0.05) Liu et al BMC Cancer (2016) 16:238 negatively modulate miR-15a expression To test this, cMyc was transfected into NPC 5-8F and HONE1 cells The results indicated that c-Myc was highly expressed in NPC cells compared to mock cells (Fig 4a) Further, overexpressed c-Myc significantly reduced the expression of miR-15a in NPC 5-8F and HONE1 cells Finally, chromatin immunoprecipitation combined with PCR analysis (Fig 4c) and luciferase reporter assay (Fig 4d) were used to confirm that c-Myc could directly bind its promoter in NPC Page of 12 miR-15a suppresses cell proliferation and cell cycle progression in vitro and in vivo in NPC To investigate the effect of miR-15a on NPC, we introduced miR-15a mimics into NPC 5–8 F and HONE1 cells Compared to negative controls, we found that miR-15a mimics inhibited cell growth and cell cycle progression from G1 to S and G2 in vitro in NPC cells by MTT (Fig 5a, b) and cytometry assays (Fig 5c, d) Further, we established stable overexpression of miR-15a in NPC 5-8F and HONE1 cells using lentiviral infection Fig c-Myc binds to the promoter of miR-15a in NPC cells a c-Myc cDNA was transfected to 5–8 F and HONE1 NPC cells and its protein expression was examined by western blot b Overexpressed c-Myc reduced the expression of miR-15a in NPC cells c Crosslinked chromatin preparation from mock and pcDNA3.1-C-Myc transfected 5-8F and HONE1 cells was immunoprecipitated with anti-C-Myc The c-Myc binding sites on the immunoprecipitated DNA was determined by PCR Amplification of input chromatin (input) before immunoprecipitation was served as positive controls for chromatin extraction and PCR amplification Chromatin immunoprecipitation using normal human IgG served as a negative control The result indicated that overexpressed c-Myc could bind more miR-15a promoter region than that in control group in NPC cells d Luciferase reporter assay indicated that c-Myc could directly bind miR-15a promoter in NPC (*P < 0.05) Liu et al BMC Cancer (2016) 16:238 Page of 12 Fig miR-15a suppressed cell cycle progression and cell growth in NPC a and b miR-15a mimics inhibited cell proliferation in NPC 5-8F and HONE1 cells by MTT assay c and d miR-15a mimics blocked cell cycle progression from G1 to S phase in NPC 5-8F and HONE1 cells e Lentivirus-mediated expression of miR-15a suppressed tumorigenesis of NPC 5-8F and HONE1 cells in vivo in nude mice f and g miR-15a inhibitor partially restored cell proliferation in CDK4-suppressed NPC cells (*P < 0.05) Liu et al BMC Cancer (2016) 16:238 (Additional file 1: Figure S1) An in vivo tumorigenesis study inoculating these cells into nude mice showed that the average tumor weight was significantly decreased in miR-15a-overexpressing xenografts compared with their respectively controls (Fig 5e) miR-15a antagonizes the action of CDK4 in NPC To investigate the effect of miR-15a on CDK4 in NPC, we introduced miR-15a inhibitor into CDK4-suppressed NPC cells (shCDK4-2 and 3) We observed that suppression of miR-15a using inhibitor (Additional file 2: Figure S2) partially restored the cell proliferative ability (Fig 5f, g) Our results demonstrated that miR-15a is a potential tumor suppressor in NPC Page of 12 miR-15a suppresses c-Myc/CCND1/CDK4/E2F1 pathway in NPC In a previous investigation, miR-15a was reported to directly target CCND1, thereby suppressing tumor cell growth [20, 21] In this study, we found that miR-15a mimics not only reduced CCND1 expression, but also suppressed the expression of c-Myc, CDK4 and E2F1 in NPC 5-8F and HONE1 cells (Fig 6a) Our results suggest a feedback loop between CDK4 and miR-15a miR-15a directly targeting CCND1 To further study the mechanism of miR-15a suppressing cell proliferation, we explored its directly target gene in NPC Interestingly, CCND1 was predicted as the directly target gene by bioinformatics assay We observed that Fig miR-15a modulated cell cycle signaling in NPC a miR-15a mimics decreased the expression of key cell cycle transition factors including c-Myc, CCND1,CDK4, and E2F1 b Luciferase reporter assay was used to determine miR-15a directly targeting the 3′UTR of CCND1 (*P < 0.05) Liu et al BMC Cancer (2016) 16:238 Wild-type (wt) or mutant (mt) 3′UTR vector of CCND1 and miR-15a mimics or inhibitor NPC cells were cotransfected with NPC SUNE1 cells The results showed a significant decrease of luciferase activity in wt vector transfected with miR-15a mimics (Fig 6b, lanes 1; P < 0.001) or an obvious increase of luciferase activity by using miR-15a inhibitor (Fig 6b, lanes 3; P < 0.001) when compared with miR control, whereas the activity of mt vector was unaffected (Fig 6b, lanes and 6) by using miR-15a mimics or inhibitor Taken together, these results strongly supported that CCND1 was the direct targets of miR-15a in NPC cells Silencing of CDK4 and ovexpressed miR-15a respectively enhance DDP chemosensitivity to NPC cells in vitro and in vivo The NPC cell line stably downregulating CDK4 exhibited significantly increased sensitivity to DDP The results indicated that the IC50 of DDP was 28.43 μM in the parental NPC 5–8 F cells, whereas reduced to 16.12 μM in CDK4 silencing NPC 5–8 F cells (Fig 7a) Further, we evaluated the effectiveness of DDP in miR15a-overexpressed NPC 5–8 F cells The results showed that IC50 value was significantly reduced in miR-15aoverexpressed NPC cells (14.40 μM) compared with the control cells treated with DDP (31.43 μM) CDK4 mRNA expression is negatively weak correlated with expression of miR-15a Due to the existence of feedback regulation loop between CDK4 and miR-15a, we speculated that CDK4 expression is negatively correlated with expression of miR-15a To confirm this hypothesis, we examined the expression of CDK4 mRNA and miR-15a in NPC and NP tissues There was an increased tendency of CDK4 mRNA in NPC tissues compared to NP tissues (P = 0.0920) (Fig 8a) On the contrary, miR-15a was downregulated expression in NPC tissues compared to NP tissues (p = 0.0323) (Fig 8b) Further, a significantly inverse weak correlation was observed between CDK4 mRNA and miR-15a expression in NPC tissues (Fig 8c) Page of 12 Discussion CDK4 is a member of the cyclin-dependent kinase family and a key factor for cell cycle signaling during transition from G1 to S phase CDK4overexpression has been observed in many tumor types, including NPC In previous report, we had observed that knocking down CDK4 induced let-7c through cell cycle signaling, and let-7c in turn suppressed cell proliferation and cell cycle progression by modulating p15/p16/CDK4/E2F1 [6] This study suggested that CDK4 promoted NPC pathogenesis by modulating miRNAs However, CDK4-mediated miRNAomics linking to the initiation and development of NPC had not been investigated In this study, we used miRNA array to observe the differential expression of miRNA in CDK4-suppressed NPC cells Interestingly, let-7 family members including let-7c reported by us [6] were shown to be elevated expression after knocking down CDK4 NPC cells Tumor suppressor miR-15a was also observed to be upregulated in CDK4-suppressed NPC cells Further, we confirmed the increased expression of miR-15a after stably or transiently knocking down CDK4 NPC cells by qPCR, which demonstrated that CDK4 negatively modulates the miR15a expression in NPC In previous study, we demonstrated that CDK4 induced the expression of transcription factor E2F1 by modulating CCND1, CDK6, p21, and pRB in NPC cells [6] Because E2F1 directly binds to the promoter of cMyc and stimulates the expression of c-Myc [22], we speculated that CDK4 positively regulates c-Myc expression in NPC Consistent with this expectation, we observed downregulated expression of c-Myc after knockdown of CDK4 in NPC cells c-Myc is an key oncogenic transcription factor promoting cellular proliferation and cancer stemness in NPC [23, 24] Furthermore, our recent studies indicated that c-Myc directly modulated the expression of miR184 and miR-18b participating in the pathogenesis of NPC [17, 18] In previous study, c-Myc had been reported to directly bind to the promoter of DLEU2 gene Fig Knocking down CDK4 or increased miR-15a induced the sensitivity of NPC cells to DDP a Knocking down CDK4 elevated the sensitivity of NPC cells to DDP b Overexpressed miR-15a stimulated the increased sensitivity of NPC cells to DDP Liu et al BMC Cancer (2016) 16:238 Page 10 of 12 Fig The increased expression of CDK4 mRNA was negatively weak correlated with the reduced miR-15a expression in NPC a CDK4 mRNA was upregulated in NPC tissues compare to NP tissues b miR-15a expression was upregulated in NPC tissue compare to NP tissues c CDK4 mRNA was negatively weak correlated with the expression of miR-15a in NPC which encompasses the tumor suppressor miR-15a This binding in turn decreases expression of both DLEU2 and miR-15a [25] We speculated that upregulation of miR-15a mediated by CDK4 suppression was at least in part modulated by c-Myc in NPC We used siRNA to knock down c-Myc and observed that the expression of miR-15a was significantly increased in NPC cells Further, we utilized chromatin immunoprecipitation combined with qPCR assays and found that c-Myc directly bind to the miR-15a promoter in NPC Furthermore, we observed the significant reduction of luciferase activity in c-Myc-binded miR-15a promoter Our investigation demonstrated that c-Myc directly suppressed the expression of miR-15a in NPC cells miR-15a has been identified as a tumor suppressor in some tumor types [20, 21, 26–32] However, its role in NPC has not been yet reported In this study, we found that miR-15a inhibited cell cycle progression from G1 to S phase and cell growth in vitro and in vivo in NPC cells We also observed that miR-15a inhibitor partially restored cell growth in CDK4-suppressed NPC cells These results demonstrated that miR-15 functions as a tumor suppressor and could overcome the action of CDK4 in NPC In previous reports, miR-15a had been reported to directly suppress the expression of Sox5, which induced the blockage of cell growth, migration, and invasion in pituitary tumors Furthermore, miR-15a directly targets Cripto, Bmi-1, CCNE1, RECK, VEGF, CCND1, and BCL-2 to suppress the malignant phenotypes in various tumors including NSCLC, pancreatic ductal adenocarcinoma, breast cancer, neuroblastoma, multiple myeloma, and osteosarcoma [20–22, 25–32] However, the molecular basis of miR-15a has never been reported in NPC In this study, miR-15a was observed to block cell cycle transition at G1/S, which was a key factor inducing cell growth arrest in NPC We suspected that miR-15a mediated the suppression of NPC cell growth based on its modulation of cell cycle factors We observed that miR-15a not only directly inhibited the expression of CCND1, one its known direct targets, but also downregulated the expression of CDK4, c-Myc, and E2F1 These results demonstrated that miR-15a suppressed cell growth through c-Myc/CCND1/CDK4/E2F1 signaling in NPC More interestingly, a positive feedback loop of CDK4-c-Myc-miR-15a was observed, which was similar to our previous report for CTGF-C-Jun/C-Myc-miR-18b and CDK4-E2F1-let-7c which promotes NPC pathogenesis [6, 17] Cell cycle arrest is a key factor that usually induced the elevation of chemotherapy sensitivity in tumor [33– 35] In this study, we observed that knocking down CDK4 and overexpressed miR-15a significantly induced the chemotherapy sensitivity of DDP by inhibiting cell cycle progression, which hinted the negatively abnormal feedback loop between CDK4 and miR-15a as an important signal resisting chemotherapy in NPC pathogenesis We have previously reported increased expression of CDK4 in NPC [5–7] However, the correlation between Liu et al BMC Cancer (2016) 16:238 CDK4 expression and miR-15a has not been documented In this study, we observed elevated CDK4 mRNA and decreased expression of miR-15a in NPC tissues compared to nasopharynx tissues Further, we found that CDK4 mRNA expression was negatively weak correlated with the expression of miR-15a in NPC tissues Conclusions In summary, our study demonstrated that knocking down CDK4 induced the activation of miR-15a by modulating the CDK4/E2F1/c-Myc pathway This in turn suppressed cell proliferation and inducing chemotherapy sensitivity by controlling c-Myc/CCND1/CDK4/ E2F1 signaling, and suggested an abnormal automodulatory feedback loop of CDK4-c-Myc-miR-15a which promoted NPC pathogenesis and acquired DDP resistance Additional files Additional file 1: Figure S1 Lentivirus-mediated miR-15a expression in NPC 5–8 F and HONE1 cells (TIFF 342 kb) Additional file 2: Figure S2 Specific inhibitor of miR-15a was used to inhibit the expression of miR-15a in shCDK4-2 and shCDK4-3 NPC 5–8 F cells (TIFF 383 kb) Abbreviations NPC: nasopharyngeal carcinoma; DDP: cisplatin; CDK4: cyclin-dependent kinase 4; miRNAs: microRNAs; qRT-PCR: quantitative reverse transcription-PCR; IC50: half maximal inhibitory concentration; DNA: deoxyribonucleic acid; MTT: 3-(4,5)-dimethylthiahiazo (−z-y1)-3,5-di- phenytetrazoliumromide; DMSO: dimethyl sulfoxide; ANOVA: analysis of variance Competing interests The authors declare that they have no competing interests Authors’ contributions ZL, CC, XJL,QX, YJZ, and QPJ performed the study and coordination and assisted in editing of manuscript ZL,QPJ, and CC collected tissue samples WYF and XBL designed this study and wrote this paper All authors have given final approval of the version to be published and agree to be accountable for all aspects of the work Acknowledgments This study was supported by the Outstanding Young Teacher Training Project of Colleges and Universities in Guangdong Province (No Yq2013136), Nature science key fund of Guangdong Province (No.2015A030311005), Nature science fund of Guangdong Province (2015A030313453) and Yangcheng Scholar Research Projects from Universities of Guangzhou (No.12A011D) Author details Third Affiliated Hospital of Guangzhou Medical University, Guangzhou 510150, PR China 2Cancer Research Institute, Southern Medical University, Guangzhou 510515, China 3Cancer Center, Traditional Chinese Medicine-Integrated Hospital, Southern Medical University, Guangzhou, Guangdong 510315, China 4Department of Pathology, Basic School of Guangzhou Medical University, Guangzhou 510182, China 5Pediatric Center of Zhujiang Hospital, Southern Medical University, Guangzhou 510282, PR China 6Otorhinolaryngology of Zhujiang Hospital, Southern Medical University, Guangzhou 510282, PR China Received: 27 April 2015 Accepted: 13 March 2016 Page 11 of 12 References Poomsawat S, Buajeeb W, Khovidhunkit SO, Punyasingh J Alteration in the expression of cdk4 and cdk6 proteins in oral cancer and premalignant lesions J Oral Pathol Med 2010;39(10):793–9 Lindberg D, Hessman O, Akerström G, Westin G Cyclin-dependent kinase (CDK4) expression in pancreatic endocrine tumors Neuroendocrinology 2007;86(2):112–8 Wikman H, Nymark P, Väyrynen A, Jarmalaite S, Kallioniemi A, Salmenkivi K, et al CDK4 is a probable target gene in a novel amplicon at 12q13.3-q14.1 in lung cancer Genes Chromosomes Cancer 2005;42(2):193–9 Dobashi Y, Goto A, Fukayama M, Abe A, Ooi A Overexpression of cdk4/ cyclin D1, a possible mediator of apoptosis and an indicator of prognosis in human primary lung carcinoma Int J Cancer 2004;110(4):532–41 Fang W, Li X, Jiang Q, Liu Z, Yang H, Wang S, et al Transcriptional patterns, biomarkers and pathways characterizing nasopharyngeal carcinoma of Southern China J Transl Med 2008;6:32 Liu Z, Long X, Chao C, Yan C, Wu Q, Hua S, et al Knocking down CDK4 mediates the elevation of let-7c suppressing cell growth in nasopharyngeal carcinoma BMC Cancer 2014;14:274 Jiang Q, Mai C, Yang H, Wu Q, Hua S, Yan C, et al Nuclear expression of CDK4 correlates with disease progression and poor prognosis in human nasopharyngeal carcinoma Histopathology 2014;64(5):722–30 The I, Ruijtenberg S, Bouchet BP, Cristobal A, Prinsen MB, van Mourik T, et al Rb and FZR1/Cdh1 determine CDK4/6-cyclin D requirement in C elegans and human cancer cells Nat Commun 2015;6:5906 Gillam MP, Nimbalkar D, Sun L, Christov K, Ray D, Kaldis P, et al MEN1 tumorigenesis in the pituitary and pancreatic islet requires Cdk4 but not Cdk2 Oncogene 2015;34(7):932–8 10 Sasaki T, Ogose A, Kawashima H, Hotta T, Hatano H, Ariizumi T, Umezu H, Ohashi R, Tohyama T, Tanabe N, Endo N Real-time polymerase chain reaction analysis of MDM2 and CDK4 expression using total RNA from coreneedle biopsies is useful for diagnosing adipocytic tumors BMC Cancer 2014;14:468 11 Mihailovich M, Bremang M, Spadotto V, Musiani D, Vitale E, Varano G, et al miR-17-92 fine-tunes MYC expression and function to ensure optimal B cell lymphoma growth Nat Commun 2015;6:8725 12 Bu P, Wang L, Chen KY, Rakhilin N, Sun J, Closa A, et al miR-1269 promotes metastasis and forms a positive feedback loop with TGF-β Nat Commun 2015;6:6879 13 Cai L, Ye Y, Jiang Q, Chen Y, Lyu X, Li J, et al Epstein-Barr virus-encoded microRNA BART1 induces tumour metastasis by regulating PTEN-dependent pathways in nasopharyngeal carcinoma Nat Commun 2015;6:7353 14 Que T, Song Y, Liu Z, Zheng S, Long H, Li Z, et al Decreased miRNA637 is an unfavorable prognosis marker and promotes glioma cell growth, migration and invasion via direct targeting Akt1 Oncogene 2015;34(38):4952–63 15 Cai LM, Lyu XM, Luo WR, Cui XF, Ye YF, Yuan CC, et al EBV-miR-BART73p promotes the EMT and metastasis of nasopharyngeal carcinoma cells by suppressing the tumor suppressor PTEN Oncogene 2015; 34(17):2156–66 16 Lyu X, Fang W, Cai L, Zheng H, Ye Y, Zhang L, et al TGFβR2 is a major target of miR-93 in nasopharyngeal carcinoma aggressiveness Mol Cancer 2014;13:51 17 Yu X, Zhen Y, Yang H, Wang H, Zhou Y, Wang E, et al Loss of connective tissue growth factor as an unfavorable prognosis factor activates miR-18b by PI3K/AKT/C-Jun and C-Myc and promotes cell growth in nasopharyngeal carcinoma Cell Death Dis 2013;4:e634 18 Zhen Y, Liu Z, Yang H, Yu X, Wu Q, Hua S, et al Tumor suppressor PDCD4 modulates miR-184-mediated direct suppression of C-MYC and BCL2 blocking cell growth and survival in nasopharyngeal carcinoma Cell Death Dis 2013;4:e872 19 Zhang X, Chen X, Lin J, Lwin T, Wright G, Moscinski LC, et al Myc represses miR-15a/miR-16-1 expression through recruitment of HDAC3 in mantle cell and other non-Hodgkin B-cell lymphomas Oncogene 2012;31(24):3002–8 20 Cai CK, Zhao GY, Tian LY, Liu L, Yan K, Ma YL, et al miR-15a and miR-16-1 downregulate CCND1 and induce apoptosis and cell cycle arrest in osteosarcoma Oncol Rep 2012;28(5):1764–70 21 Bonci D, Coppola V, Musumeci M, Addario A, Giuffrida R, Memeo L, et al The miR-15a-miR-16-1 cluster controls prostate cancer by targeting multiple oncogenic activities Nat Med 2008;14(11):1271–7 Liu et al BMC Cancer (2016) 16:238 Page 12 of 12 22 O’Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT c-Myc-regulated microRNAs modulate E2F1 expression Nature 2005;435(7043):839–43 23 Zhou W, Feng X, Ren C, Jiang X, Liu W, Huang W, et al Over-expression of BCAT1, a c-Myc target gene, induces cell proliferation, migration and invasion in nasopharyngeal carcinoma Mol Cancer 2013;12:53 24 Zhang JP, Zhang H, Wang HB, Li YX, Liu GH, Xing S, et al Down-regulation of Sp1 suppresses cell proliferation, clonogenicity and the expressions of stem cell markers in nasopharyngeal carcinoma J Transl Med 2014;12:222 25 Lerner M, Harada M, Lovén J, Castro J, Davis Z, Oscier D, et al DLEU2, frequently deleted in malignancy, functions as a critical host gene of the cell cycle inhibitory microRNAs miR-15a and miR-16-1 Exp Cell Res 2009; 315(17):2941–52 26 Renjie W, Haiqian L MiR-132, miR-15a and miR-16 synergistically inhibit pituitary tumor cell proliferation, invasion and migration by targeting Sox5 Cancer Lett 2015;356(2 Pt B):568–78 27 Chen F, Hou SK, Fan HJ, Liu YF MiR-15a-16 represses Cripto and inhibits NSCLC cell progression Mol Cell Biochem 2014;391(1–2):11–9 28 Guo S, Xu X, Tang Y, Zhang C, Li J, Ouyang Y, Ju J, Bie P Wang H.miR-15a inhibits cell proliferation and epithelial to mesenchymal transition in pancreatic ductal adenocarcinoma by down-regulating Bmi-1 expression Cancer Lett 2014;344(1):40–6 29 Luo Q, Li X, Li J, Kong X, Zhang J, Chen L, Huang Y, Fang L MiR-15a is underexpressed and inhibits the cell cycle by targeting CCNE1 in breast cancer Int J Oncol 2013;43(4):1212–8 30 Xin C, Buhe B, Hongting L, Chuanmin Y, Xiwei H, Hong Z, et al MicroRNA15a promotes neuroblastoma migration by targeting reversion-inducing cysteine-rich protein with Kazal motifs (RECK) and regulating matrix metalloproteinase-9 expression FEBS J 2013;280(3):855–66 31 Sun CY, She XM, Qin Y, Chu ZB, Chen L, Ai LS, et al miR-15a and miR-16 affect the angiogenesis of multiple myeloma by targeting VEGF Carcinogenesis 2013;34(2):426–35 32 Cittelly DM, Das PM, Salvo VA, Fonseca JP, Burow ME, Jones FE Oncogenic HER2{Delta}16 suppresses miR-15a/16 and deregulates BCL-2 to promote endocrine resistance of breast tumors Carcinogenesis 2010;31(12):2049–57 33 Bar J, Gorn-Hondermann I, Moretto P, Perkins TJ, Niknejad N, Stewart DJ, et al miR Profiling Identifies Cyclin-Dependent Kinase Downregulation as a Potential Mechanism of Acquired Cisplatin Resistance in Non-Small-Cell Lung Carcinoma Clin Lung Cancer 2015;16(6):e121–9 34 Cheng W, Liu T, Wan X, Gao Y, Wang H MicroRNA-199a targets CD44 to suppress the tumorigenicity and multidrug resistance of ovarian cancerinitiating cells FEBS J 2012;279(11):2047–59 35 Zhang LH, Yin AA, Cheng JX, Huang HY, Li XM, Zhang YQ, et al TRIM24 promotes glioma progression and enhances chemoresistance through activation of the PI3K/Akt signaling pathway Oncogene 2015;34(5):600–10 Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries • Our selector tool helps you to find the most relevant journal • We provide round the clock customer support • Convenient online submission • Thorough peer review • Inclusion in PubMed and all major indexing services • Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit ... proliferation and inducing chemotherapy sensitivity by controlling c-Myc/CCND1 /CDK4/ E2F1 signaling, and suggested an abnormal automodulatory feedback loop of CDK4- c-Myc -miR-15a which promoted NPC pathogenesis. .. according to the manufacturer’s protocol Transient transfection with miR-15a mimics and its inhibitor miR-15a mimic and its inhibitor were designed and synthesized by Guangzhou RiboBio (RiboBio Inc,... (Fig 5e) miR-15a antagonizes the action of CDK4 in NPC To investigate the effect of miR-15a on CDK4 in NPC, we introduced miR-15a inhibitor into CDK4- suppressed NPC cells (shCDK4-2 and 3) We