Effect of group housing and exercise on brown fat gene expression and fatty acid profiles

Trang 1

WILLIAMS COLLEGE LIBRARIES

COPYRIGHT ASSIGNMENT AND INSTRUCTIONS FOR A STUDENT THESIS

Your unpublished thesis, submitted for a degree at Williams College and administered by the Williams College Libraries, will be made available for research use You may, through this form, provide instructions regarding copyright, access, dissemination and reproduction of your thesis The College has the right in all cases to maintain and preserve theses both in hardcopy and electronic format, and to make such copies as the Libraries require for their research and archival functions

_ The faculty advisor/s to the student writing the thesis claims joint authorship in this work,

_ I/we have included in this thesis copyrighted material for which I/we have not received permission from the copyright holder/s

If you do not secure copyright permissions by the time your thesis is submitted, you will still be allowed to submit However, if the necessary copyright permissions are not received, e-posting of

your thesis may be affected Copyrighted material may include images (tables, drawings,

photographs, figures, maps, graphs, etc.), sound files, video material, data sets, and large portions of text

I COPYRIGHT

‘An author by law owns the copyright to his/her work, whether or not a copyright symbol and date are placed on the piece Please choose one of the options below with respect to the copyright in your thesis

Mee choose not to retain the copyright to the thesis, and hereby assign the copyright to Williams College

Selecting this option will assign copyright to the College If the author/s wishes later to publish the work, he/she/they will need to obtain permission to do so from the Libraries, which will be granted except in unusual circumstances The Libraries will be free in this case to also grant permission to another researcher to publish some or all of the thesis If you have chosen this option, you do not need to complete the next section and can proceed to the signature line _ I/we choose to retain the copyright to the thesis for a period of years, or until my/our death/s, whichever is the earlier, at which time the copyright shall be assigned to Williams College without need of further action by me/us or by my/our heirs, successors, or representatives of my/our estate/s

Trang 2

II ACCESS AND COPYING

If you have chosen in section I, above, to retain the copyright in your thesis for some period of time, please choose one of the following options with respect to access to, and copying of, the thesis

I/we grant permission to Williams College to provide access to (and therefore copying of) the thesis in electronic format via the Internet or other means of electronic transmission, in addition to permitting access to and copying of the thesis in hardcopy format

Selecting this option allows the Libraries to transmit the thesis in electronic format via the Internet This option will therefore permit worldwide access to the thesis and, because the Libraries cannot control the uses of an electronic version once it has been transmitted, this option also permits copying of the electronic version

I/we grant permission to Williams College to maintain and provide access to the thesis in hardcopy format In addition, I/we grant permission to Williams College to provide access to (and therefore copying of) the thesis in electronic format via the Internet or other means of electronic transmission after a period of years

Selecting this option allows the Libraries to transmit the thesis in electronic format via the Internet after a period of years Once the restriction period has ended, this option permits worldwide access to the thesis, and copying of the electronic and hardcopy versions

I/we grant permission to Williams College to maintain, provide access to, and provide copies of the thesis in hardcopy format only, for as long as I/we retain copyright

Selecting this option allows access to your work only from the hardcopy you submit for as long as you retain copyright in the work Such access pertains to the entirety of your work, including any media that it incorporates Selecting this option allows the Libraries to provide copies of the thesis to researchers in hardcopy form only, not in electronic format

I/we grant permission to Williams College to maintain and to provide access to the thesis in hardcopy format only, for as long as I/we retain copyright

Selecting this option allows access to your work only from the hardcopy you submit for as long as you retain copyright in the work Such access pertains to the entirety of your work, including any media that it incorporates This option does NOT permit the Libraries to provide copies of the thesis to researchers

: r6

Signed (student author) _

Siunsổ ffbnilly-slyÏsaD) Signatures redacted

Signed (2d advisor, if applicable) _ 7

Trang 3

Effect of Group Housing and Exercise on Brown Fat Gene Expression and Fatty Acid Profiles

By

Shayna M Barbash

Dr Daniel V Lynch and Dr Steven J Swoap, Advisors

A thesis submitted in partial fulfillment of the requirements for the Degree of Bachelor of Arts with Honors

in Biology

Williams College Williamstown, Massachusetts

Trang 5

TABLE OF CONTENTS

Abstract

Introduction

Thermoregulation in mammals

Group Housing and Behavioral Thermoregulation Exercise and Thermoregulation

Homeothermic Thermogenesis Shivering Thermogenesis

Brown Adipose and Non-shivering Thermogenesis White vs Brown Fat

The Molecular Underpinning of BAT induced Thermogenesis Fatty Acid Synthesis

Triglyceride Function in the Cold Fatty Acid Utilization and Triglycerides

Sympathetic Nervous System and BAT Activation Coordinated Tissue Reponse to Cold Stress Cold-induced BAT Gene Expression VLCFAs and the ELOVL Gene Family The ELOVL3 Gene

Time course of ELOVL3 Cold-induced Expression The ELOVL3 Knock-Out (KO) Model

Elovl3-ablation and Lipid Recruitment in Cold Stress

ELOVL3 Function in Lipogenesis in Liver and Adipose Tissue Hypotheses Materials and Methods Animals Cage Parameters and Diet Running Wheels Tissue Collection

Trang 6

Results

Experiment 1: Effect of Temperature on Brown Fat Gene Expression

Experiment 2: Effect of Group Housing and Exercise on BAT Elovl3 Expression Experiment 3: Effect of Temperature and Housing on BAT Fatty Acid Profiles

Discussion

Gene Expression Changes of Cold Stressed Mice Group Housing and Elovl3 Expression

Running and Elovl3 Expression

Trang 8

ABSTRACT

In recent years, studying the activity of brown adipose tissue (BAT) has become a topic of great interest, as it serves as a potential therapeutic treatment for obesity and related metabolic disorders The Elovl3 gene is induced 200-fold in the brown fat of cold- stressed mice and encodes a condensing enzyme that elongates saturated and

Trang 9

INTRODUCTION

Thermoregulation in mammals

In studying the genetic regulation of metabolic activity in mammals, it is important to account for thermal regulatory characteristics Both humans and mice are classified as homeotherms, regulating their core body temperature over a wide range of ambient temperatures (Gonder and Laber, 2007) Experiments involving the regulatory mechanisms of energy balance must take into account the physiological impact of environmental temperatures For homoeothermic physiological studies, knowing the animal’s thermoneutral environment is important for interpreting both behavioral and biochemical responses (Virtue et al., 2012)

Trang 10

(Gonder and Laber, 2007) Physiological means of heat production include

mitochondrial oxidation in brown adipose tissue (BAT), increases in heart rate and shivering in skeletal muscle tissue (Morrison et al., 2008)

Group Housing and Behavioral Thermoregulation

While physiological thermogenesis is an important method of generating heat during prolonged cold exposure, group housing provides an additional mechanism for mice to adapt to cold stress By huddling, mice reduce their effective surface area to volume ratio and thus mitigate heat loss to the external environment (Gonder and Laber, 2007) In group-housed rat pups, as the ambient temperature decreases below 30°C, there is a steady decrease in huddle size, with closer aggregation of the pups in response to the decreasing ambient temperature (Harshaw and Alberts, 2012) Through huddling, mice can employ a means of adaptive thermoregulation in response to the environmental cold stress; this mechanism provides a means of body temperature regulation and energy

conservation (Schank and Alberts, 1997) Moreover, coupling of behavioral and

Trang 11

indicating greater efficiency of BAT activation The body temperatures of group-housed mice were better protected during the coldest ambient temperatures as compared to individual mice (David et al., 2013; Harshaw and Alberts, 2012) Though physiological thermogenesis is an important mechanism for homeotherms to maintain a stable internal body temperature, behavioral regulation through huddling plays an important role in temperature regulation

Exercise and Thermoregulation

Physical exercise is known to confer beneficial effects on blood pressure, immune function and risks of cardiovascular disease in humans (Richter et al., 2014) Voluntary physical exercise is studied in mice by introducing running wheels into mouse cages Mice will run in the night during their active phase; however the daily distance these mice run is dependent on both mouse strain and gender, ranging from 3 to 12 km/day (Lightfoot et al., 2004; Richter et al., 2014)

While group huddling mitigates heat loss to the external environment, exercise stimulates an increase in heart rate and blood flow that leads to a rise in core body temperature (Sugimoto et al., 1998) When placed on a running wheel, exercise-trained rats exhibit elevated core body temperatures compared to their sedentary counterparts (Sugimoto et al., 1998) Exercise training with a running wheel results in higher

threshold temperatures for heat loss and heat production Rats that exhibit nightly running have a higher resting core body temperature and preference for higher ambient

temperatures following exercise; when placed in a thermal gradient system, exercise trained rats select a higher ambient temperature compared to the control period before exercise training (Sugimoto et al., 1998; Tanaka et al., 2003) The sustained increase in

Trang 12

body temperature and the preference for higher ambient temperatures following exercise suggests that voluntary wheel running results in a thermoregulated body temperature change With a rise in body temperature, voluntary cage wheel exercise in small animals alters their core temperature relative to non-running animals (Sugimoto et al., 1998)

Homeothermic Thermogenesis

Although homeotherms can employ behavioral mechanisms of thermoregulation in cold stress, they use metabolic heat production when the ambient temperature

decreases below their TNZ (Gonder and Laber, 2007) Thermogenesis occurs in most tissues in an organism; central nervous system (CNS) thermoregulatory networks are important for inducing thermogenesis primarily in brown adipose tissue (BAT), skeletal muscle and the heart Heat is generated as a byproduct of the inefficiency of ATP production and ATP utilization (Morrison, 2001; Morrison et al., 2012) Shivering thermogenesis in skeletal muscle, non-shivering thermogenesis in brown adipose tissue and heat-loss regulation are all important to the central circuitry mechanisms

Trang 13

~- đ `»

SEs ra

AT 2)

Brown Fat Activity -

Figure 1: Coordinated physiological and behavioral adaptations to the cold Shivering thermogenesis, non-shivering thermogenesis and huddling are common homeothermic responses to cold stress The role of huddling and running in mice brown fat activity is not fully known

Shivering Thermogenesis

In shivering thermogenesis, the repeated muscle contractions of shivering leads to the production of heat through the conversion of chemical energy of ATP into kinetic energy While the production of heat from brown adipose tissue is an important survival tool in prolonged cold exposure, shivering is a major response to compensate for

increased heat loss following acute cold exposure (Cannon and Nedergaard, 2004; Griggio, 1982) Repeated skeletal muscle contractions of shivering thermogenesis and increases in heart rate are sympathetically mediated through a neural network that parallels the activation of BAT thermogenesis Brown-fat derived non-shivering

thermogenesis does not necessarily participate in the production of body heat during cold exposure if shivering thermogenesis leads to sufficient heat production to compensate for heat loss (Cannon and Nedergaard, 2004) However, in chronic cold exposure, shivering thermogenesis is overtaken by brown fat dependent non-shivering thermogenesis

Trang 14

Brown Adipose and Non-shivering Thermogenesis

The unique function of BAT as a heat-producing unit and its presence in humans makes it a topic of great interest for current research It is primarily found in infants and small rodents and was considered to be without physiological relevance in adults In larger mammals, the higher ratio between heat production from basal metabolism and body surface area was thought to provide greater protection from the cold and thus less need for a functional capacity of BAT However, through measuring uptake of glucose as an indication of high metabolic activity, functionally active brown adipose tissue was found in adult humans, with the greatest abundance in the anterior neck and thoracic region (Cannon and Nedergaard, 2004; Cypess et al., 2009)

In recent years, scientific interest in thermogenesis and the regulation of BAT has focused on the tissue’s potential role in the treatment of obesity and related metabolic disorders Interpreting the effect of ambient temperature on whole body metabolism is not only important for mitigating the stress on laboratory mice; a better understanding of the molecular controls governing brown adipose tissue recruitment could serve as a target for the treatment of human metabolic disorders BAT can clear lipids and glucose from the circulation and thus potentially protect animals from high-fat diet induced obesity; understanding the regulation of BAT activity could play an important role in future cardiovascular, diabetes and obesity research (Virtue and Vidal-Puig, 2013)

White vs Brown Fat

While brown adipose tissue is a site of increased metabolic activity and

Trang 15

Conversely, brown fat is critical for basal and inducible energy expenditure for all mammals (Cypess et al., 2009) While WAT hydrolyzes lipids and releases FFAs into blood, BAT mobilizes stored fat for generating heat The distinct functions of these two tissues is reflected in their morphology; white adipocytes usually contain a single giant lipid droplet occupying most of the cytoplasm, while brown adipocytes, rich in

mitochondria, are filled with a number of smaller lipid droplets (Barneda et al., 2013) BAT is characterized by its darker color due to the high density of mitochondria, which is the critical site of the tissue’s thermogenic function

The Molecular Underpinning of BAT induced Thermogenesis

Brown adipose tissue activation is characterized by the expression of uncoupling protein 1 (UCP-1), a mitochondrial proton channel that enables proton influx to the mitochondrial lumen When opened, the activity of the channel dissipates the inner mitochondrial membrane potential, which normally acts to limit the electron transport chain (Rezai-Zadeh and Munzberg, 2013; Virtue and Vidal-Puig, 2013) UCP-1 uncouples the proton motive force of the respiratory chain from ATP production and instead releases energy surplus as heat The activity of UCP-1 is regulated through sympathetic activation via Beta-adrenergic receptors (B;-AR and j¿-AR), fatty acids and thyroid hormones (Bartelt et al., 2011; Bronnikov et al., 1999; Rezai-Zadeh and

Munzberg, 2013) The B3-AR is the principal adrenergic receptor responsible for

activation of BAT; it governs mitochondrial uncoupling in BAT by inducing Ucp-/ gene expression, UCP-1 activity and 8 -oxidation The activation of B;-AR on mature brown adipocytes leads to a rise in cAMP, thereby increasing lipolysis in BAT (Rehnmark et al.,

Trang 16

mediates noradrenergic stimulation of brown adipocyte differentiation (Bronnikov et al., 1992) Elevated lipolysis that results from a rise in cAMP leads to an increase in

intracellular free fatty acids (FFA) that serve as the substrate for thermogenesis and activate UCP-1 (Cannon and Nedergaard, 2004; Virtue and Vidal-Puig, 2013) The activation of lipolysis and increase in fatty acids triggers the intiation of thermogenesis in brown adipocytes (Cannon and Nedergaard, 2011) Mitochondria utilize UCP-1 to

stimulate the oxidation of carbohydrates and fatty acids for chemical heat production

(Bartelt et al., 2011) Thus, the adrenergic control of brown fat stimulation and mobilization of stored fat is an important aspect of regulating whole-body energy homeostasis

Fatty Acid Synthesis

Within the thermoregulatory pathway, fatty acids (FAs) are an important subsrate for endogenous heat production When metabolized, such as in BAT thermogenesis, fatty acids produce large quantities of heat energy Fatty acids both constitute storage lipids and serve as important signaling molecules in relation to the metabolic status of cells (Jakobsson et al., 2005) The synthesis of fatty acids from acetyl-CoA and malonyl Co-A occurs in a series of enzymatic steps mediated by acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) Fatty acids of up to 16 carbons are synthesized by the fatty acid synthase complex (Kobayashi and Fujimori, 2012) The synthesis is initiated by the elongation of an acetyl primer with two-carbon units donated from malonyl-Co and

Trang 17

polyunsaturated FAs (PUFAS) This classification depends on the number of double bonds in the fatty acid chain, with SFAs having no double bonds, MUFAs having one double bond and PUFAs having two or more double bonds PUFAs are further divided based on the position of their double bonds, with -6 and @-3 series denoting the

placement of the double bond in relation to the terminal methyl position of the fatty acid carbon chain (Kihara, 2012) A number of the fatty acids produced by the FAS complex are then futher enlongated into very long chain fatty acids (VLCFA) Arachindonic acid

(20:46) is one such fatty acid, produced by the elongation of linoleic acid (18:2) (Westerberg et al., 2004)

Triglyceride Function in the Cold

Trang 18

Fatty Acid Utilization and Triglycerides

The potential for BAT to oxidize nutrients is chielfy limited by nutrient supply of fatty acids Fatty acids deposited as TGs in adipose tissue constitute the main energy store in animals In periods of increased energy demand, such as fasting and cold

exposure, stored fat is mobilized by lipolytic enzymes, which hydrolyze adipose TGs and release nonesterified fatty acids (NEFA) into the circulation (Caimari et al., 2012) During fasting, the hormone glucagon signals the breakdown of triglycerides and the subsequent release of fatty acids by the sequential action of three lipases Within the brown fat cells, fatty acids are utilized in metabolism and as signaling molecules for gene expression changes: fatty acids bind to cytoplasmic fatty acid-binding proteins that then direct fatty acids for metabolism and control of gene expression (McArthur et al., 1999; Shore et al., 2013; Stahl et al., 2001) Thus, altered gene expression profiles of BAT and the dysregulation of TG-lipolysis is linked to changes in concentrations of circulating free fatty acids (Zimmermann et al., 2004)

Sympathetic Nervous System and BAT Activation

The sympathetic nervous system (SNS) plays a key role in the coordinated

Trang 19

thermoregulatory pathways to defend the core body temperature (Cannon and Nedergaard, 2004; Virtue and Vidal-Puig, 2013) The SNS is the most important regulator of BAT function, coordinating both acute and prolonged BAT function under thermal stress The metabolic activity of BAT involves the response of the sympathetic nervous system, the uncoupling protein-1 (UCP-1) and available fatty acid substrates (Cannon and Nedergaard, 2004; Morrison et al., 2012)

Mitochondria

Figure 2: In non-shivering thermogenesis, brown fat cells are stimulated by the release of norepinephrine from the sympathetic nervous system The NE binds to the brown fat cellular membrane, leading to the degradation of triglycerides (TG) and subsequent release of free fatty acids (FFAs) These fatty acids induce UCP-1, leading to the mitochondrial production of heat energy

Trang 20

Coordinated Tissue Reponse to Cold Stress

In response to cold exposure, the provision of substrate fuels for thermogenic metabolic activity requires a coordinated regulation of gene expression in BAT Cold exposure increases the plasma concentrations of glucagon for increased TG uptake and leads to the activation of the sympathetic nervous system as previously noted When mice are maintained at 22°C and then exposed to a 24 hour 8°C cold stress, striking similarites are seen between BAT and liver gene expression profiles In both BAT and liver, there is a reduction in many of the genes associated with lipid metabolic processes and endoplasmic reticulum function (Shore et al., 2013) While 22°C is already below thermoneutrality for mice, there are significant changes in gene expression with

temperature shifts from 22°C to 8°C (Cannon and Nedergaard, 2011) While cold induces an expected increase in oxidative metabolism, liver genes such as apolipoprotein AI and fatty acid desaturase 1 are down regulated in response to cold Expression of the

peroxisome proliferator activated receptor alpha (PPARa) and associated genes regulating cholesterol and fatty acid transport are also decreased in the BAT of cold-

stressed mice Although PPARa is known to stimulate fatty acid oxidation, a reduction in the expression of this metabolic gene allows cellular processes to shift thermogenic function and energy expenditure towards non-shivering thermogenesis (Harshaw and Alberts, 2012) In the liver, genes associated with mitochondrial oxidative function, such as ATP synthase, cytochrome c and UCP-3 are all increased after 24 hours of cold

Trang 21

Cold-induced BAT Gene Expression

Some of the most cold-sensitive genes in BAT include Ucp-1, Deiodinase 2 (Dio2), and Peroxisome Proliferator-activated receptor Gamma Coactivtor-la (PGC-1a) (Madsen et al., 2010; Nedergaard and Cannon, 2013; Shore et al., 2013; Virtue and Vidal- Puig, 2013; Watanabe et al., 2008; Yu et al., 2002) PGC-1a is a transcriptional

coactivator that regulates genes involved in energy metabolism; PGC-1a activates BAT mitochondrial biogenesis in response to cold exposure The Dio2 gene coordinates the conversion of thyroxine (T4) to the active 3,5,3'-triiodothyronin (T3) form in BAT to

allow for increased thermogenesis; isolated brown adipocytes lacking Dio2 exhibit reduced lipolysis and oxidative metabolism (Tanaka et al., 2003; Virtue and Vidal-Puig, 2013) Inthe BAT of mice kept at 8°C for 24 hours, there is an increase in expression of Ucp-1, PGC1a and Dio2 (Shore et al., 2013) The increased expression of these genes increases BAT thermogenic capacity and brown adipocyte differentiation The SNS induction of Dio2 normally increases T3 concentration in BAT three to four fold after only a few hours of cold exposure, leading to an increase in Ucp-7 mRNA, lipolysis and oxygen consumption (Bakker et al., 2014; Tanaka et al., 2003) Despite normal basal

UCP-1 levels, Dio2 mice exhibit diminished cAMP generation and impaired adative thermogenesis in BAT In response to prolonged cold stress, the increased expression of genes involved in both fatty acid metabolism of endogenous lipid stores and de novo synthesis of lipids is an important marker of BAT adaptations to the cold In BAT, the most inducible gene in cold acclimation is Elongation of Very Long Chain Fatty Acids- like 3 (Elovl3), a gene responsible for the elongation of fatty acids in the C20-C24 range In mice housed for 3 days at 4°C, Elovl3 mRNA is induced 200-fold; in a 3 week cold

Trang 22

exposure the levels of Elov/3 mRNA remain 100-fold above basal 28°C levels (Jorgensen et al., 2007; Tvrdik et al., 1997) With its highly inducible nature in the cold, Elovi3 serves as a potential marker for measuring the prolonged cold stress in mice

VLCFAs and the ELOVL Gene Family

Fatty acids are elongated into VLCFAs on membrane embedded proteins on the endoplasmic reticulum (ER) through the addition of two carbons to the carboxylic-acid end (Nugteren, 1965) The process involves a four-step reaction of condensation, reduction, dehydration and reduction through the addition of two carbons to the carobxylic end of the fatty acid chain VLCFAs are fatty acids greater than 20 carbon

atoms and can be divided into saturated, monounsaturated and polyunsaturated VLCFAs (Leonard et al., 2004) They have important functions in organisms that cannot be substituted for by the long chain fatty acids (LCFAs), such as skin barrier formation, inflammatory responses, retinal function and membrane lipid formation There are seven Elovl genes in the mouse and human genome, each with a distinct substrate-specific fatty acid elongation activity for varying chain lengths and degrees of saturation Each

ELOVL protein exhibits a characteristic tissue distribution pattern; tissue-specific FA compositions are in part due to the distinct expression of ELOVLs Saturated VLCFAs are thought to be important for the packaging of membrane lipids, functioning as

Trang 23

The ELOVL3 Gene

The Elovi3 gene encodes for the ELOVL3 30 k-Da glycoprotein assumed to regulate the elongation of saturated and monounsatured fatty acids in the C16 to C20

range; the enzyme has the highest activity towards C18:0 Co-As (Jorgensen et al., 2007) Ectopic expression of murine ELOVL3 fused to green fluorescent protein in mammalian cells indicates the protein localizes the ER, where it catalyzes the rate limiting

condensation step of VLCFA synthesis (Jakobsson et al., 2006) The Elovl3 gene was first identified as Cig-30 and was found to be highly induced in BAT following cold stress (Tvrdik et al., 1997) While Elovl3 mRNA is detected in the liver, skin, kidney, white adipose tissue and heart, the cold-induced expression is only seen in BAT (Sugimoto et al., 1998) Under conditions of BAT recruitment, fatty acids serve as a substrate for non-shivering thermogenesis Long hydrophobic fatty acids such as

VLCFA’s are important in the formation of fat droplets, which could then be utilized for BAT thermogenesis; ELOVL3 has a potential function in BAT for synthesizing saturated and monounsaturated VLCFAs for replenishing TG stores in cold stress (Morrison et al.,

2008)

Time course of ELOVL3 Cold-induced Expression

The cold-induced expression of Elov/3 mRNA reaches a maximal level three days after the intial cold exposure; this time course of expression is delayed compared with genes directly involved in thermogenesis, such as Ucp-1, which exhibits a peak in mRNA levels in the first hours of cold exposure (Lightfoot et al., 2004; Richter et al., 2014; Virtanen, 2014) While Elovl3 mRNA remains highly induced after one month of cold exposure, Ucp-] mRNA is only 50% above basal levesls after one month at 4°C

Trang 24

(Nedergaard and Cannon, 2013) The time delay of Elov!3 induction indicates a potential role related to hyperplastic changes and adipogenesis in the tissue during cold

acclimation, rather than direct involvement in activating BAT (Nakamura, 2011; Speakman and Keijer, 2012; Tvrdik et al., 1997) In mice housed at 30°C, continuous administration of NE, the endogenous sympathetic activator of BAT, qualitatively mimicked the Elovl3 cold-induced expression (Tvrdik et al., 1997) Thus, Elovl3

expression can be induced by either direct activation of the SNS or through manipulating the environmental temperature

The ELOVL3 Knock-Out (KO) Model

While previous studies have looked at the phenotypic consequnces of Elovl3 ablation, the function of Elovl3 in BAT and lipid homeostasis is complicated by the impaired skin barrier in this KO model Elovi3-ablated mice exhibit a sparse hair coat and pertubed hair lipid content; the compromised insulation in this model effects the animal’s thermogenic response to cold and results in compensatory thermoregulatory mechanisms (Westerberg et al., 2004) However, with the important role fatty acids play in oxidative metabolism, it is of interest to look at the differential expression of Elov/3 in varying degrees of cold stress Within the hair lipid content of Elovi3-ablated mice housed at 22°C, TG content exhibits diminished levels of fatty acids longer than 20 carbon atoms In comparing wild-type and Elov/3-ablated mice hair lipids, there is a significant increase in eicosenoic acid (20:1 (n-9)) and a 40% decrease in C16:0, C18:0 and C18:1 (n-9) fatty acids in the KO model (Westerberg et al., 2004) It is apparent that Elovi3-ablated mice exhibit a deficiency in the elongation of fatty acids for triglyceride formation, demonstrating the importance of ELOVL3 in regulating VLCFA activity The

Trang 25

increased expression of eicosenoic acid is most likely a compensatory result of deficient elongation activity (Westerberg et al., 2004) While there has been extensive analysis of hair lipid fatty acid profiles in the KO model, there has been little study of the effect of housing conditions on Elovl3 expression and BAT fatty acid composition in wildtype mice

Elovi3-ablation and Lipid Recruitment in Cold Stress

Although the lack of Elovi3 leads to an impaired skin barrier, there is no

significant impairment of thermoregulation in the cold Elov/3-ablated mice are unable to hyperrecruit their BAT, as seen with normal Ucp-/ expression and protein levels after cold stimulation Nevertheless, Elovl3-ablated mice endure a 4°C cold stress for several months and generate extra heat through muscle shiveirng (Westerberg et al., 2004) In BAT, lack of Elovi3 mRNA results in a diminished capacity to elongate saturated fatty acyl-CoAs into very long chain fatty acids ,as seen with reduced levels of arachidic acid (C20:0) and behenic acid (C22:0) However, the VLCFA elongation activity of saturated C16-C22 substrates is only diminished in an initial 4°C cold stress; the KO model

exhibits similar elongation activity as control mice under prolonged cold acclimation to 4°C, suggesting the presence of other elongases A reduced amount of fat seen in Elovl3- ablated mice at thermoneutral conditions of 30°C and reduced metabolic capacity when stimulated by NE demonstrates a noradrenergic control of Elovl3 and lipid mobilization in brown adipocytes This demonstrates that while compensatory mechanisms exist, altered levels of Elovi3 expression may have a significant impact on tissue lipid

Trang 26

ELOVL3 Function in Lipogenesis in Liver and Adipose Tissue

While the cold-inducible characteristic of Elovl3 mRNA is only seen in BAT, there remains a basal low-level of expression in the liver The liver is a highly metabolic organ responsible for uptake, storage, and release of lipids into the circulation to meet an organism's energy demands In Elovl3-ablated mice, there is reduced hepatic lipogenic gene expression and triglyceride content; the impaired synthesis of C20-C22 VLCFA attenuates the lipid accumulation in the liver Furthermore, in the Elovl3 KO model, expression of PPARy, which negatively regulates lipolysis and promotes TG

accumulation, is down-regulated in the liver The Elovl3-derived FAs appear to be needed for proper lipid expansion during adipogenesis, serving as endogenous ligands for activating PPARy activity (Kobayashi and Fujimori, 2012; Wang et al., 2008; Zadravec et al., 2010) The ablation of Elov/3 and subsequent impaired elongation activity is

Trang 27

Hypotheses

Fatty acids serve as critical regulatory molecules within the cell, involved in both basic energy utilization and more complex thermoregulatory signaling schemes The physiological consequences of differentially perceived cold stresses could impact BAT gene expression and fatty acid composition In this experiment, the goal is to use Elovi3 expression as an indicator of cold stress and potential changes in lipid profiles following prolonged cold exposure Mice will be placed in varying housing conditions to quantify the gene expression and FA changes associated with different cold environments The study will house mice at 20°C or 30°C and singly housed, group housed or with a running wheel The study’s focus is two fold, looking at both the changes in gene expression and the alterations in fatty acid profiles The current hypothesis is that those mice housed in a group or with a running wheel will exhibit diminished non-shivering thermogenesis Thus the expression of genes associated with BAT recruitment, such as Elovl3, PGC1-a, Ucp-1 and Dio2 will be attenuated in BAT of running and group housed mice compared to the singly housed mice In terms of fatty acid changes, the hypothesis is that after 3 weeks of housing in these conditions, the attenuated Elov/3 expression due to huddling and exercise will be associated with reduced levels of fatty acids in the C20- 22 range in BAT While previous studies have looked at the effect of KO models on fatty acid synthesis, this experiment targets changes in the perceived cold stress to reveal potential alterations in BAT non-shivering thermogenesis

Trang 28

MATERIALS AND METHODS

Animals

The animals used in this experiment were CSbI/6J 8-week old female mice, bred in the Animal Care Facility at Williams College

Cage Parameters and Diet

The mice were housed in individual cages at 22°C for one week prior to the start of the experiment The mice were then moved into either the cold room (20°C) or the warm room (30°C) for a two-day acclimation period At the start of the experiment, mice were housed in one of three conditions in each room In the 20°C room, six mice were singly housed without nesting (CS1-CS6), six mice were singly housed with a running wheel (CRW1-CRW6) and five mice were group housed without nesting (CG1-CGS) In the 30°C room, the parameters were replicated with six singly housed mice (WS1-WS6), six mice singly housed with a running wheel (WRW1-WRW6) and five mice group housed (WG1-WGS) Additionally, in the 20°C room, three mice were singly housed at

10°C in insulated boxes with heating/cooling coils to maintain a constant ambient temperature of 10°C All mice were housed on a 12-hour dark/light phase in plastic

cages (7.25” x 11.5” x 5”) with metal wire tops All mice received the same standard lab chow with ad libitum access to food and water Body and food weights were measured daily, along with distances ran for the mice housed in cages with running wheels The duration of the experiment was 21 days

Trang 29

Running Wheels

The mice housed with running wheels were placed in the same standard mouse cage as those singly and group housed Sigma Sport 5.12 bike computers were

connected to a magnet sensor placed on the top of each cage These computers tracked the speed, distance and total time ran; the computer recorded wheel revolutions as a magnet attached to the outside surface of the wheel passed by the magnet sensor Daily distances run were collected at time of food and body weight measurements and the computers were reset to zero after each measurement The distances were calculated as kilometers per day based The wheels were checked each day to ensure the magnetic sensor was detecting the wheel revolutions

Tissue Collection

Following the 21 days of specific housing conditions, all 20°C and 10°C mice were euthanized on day 22 All 30°C mice were sacrificed two days later Mice were euthanized with carbon dioxide for tissue collection Two pads each of brown and white fat were collected, followed by one sample each of liver and skeletal muscle White fat samples were collected from fat lining the uterus Blood was collected from the heart and spun immediately for one minute in an epindorf 5415C centrifuge at 14,000 rpm

Following centrifugation, the plasma supernatant was extracted into 1.5ml micro- centrifuge tubes All tissue samples were stored in foil and both tissue and plasma samples were immediately frozen in liquid nitrogen The samples were then stored in a -80°C freezer until further quantification

Trang 30

Brown Fat mRNA Extraction:

mRNA was extracted from one of the two brown fat pads RNA isolation followed the standard ‘single-step’ method, whereby the RNA is separated from DNA following extraction with guanidinium thiocyanate, sodium acetate, phenol and chloroform The samples were homogenized in an acidic solution containing ml guanidinium thiocyanate, 1001 2M sodium acetate and 7,11 B-mercaptoethanol Homogenization was performed with a polytron and after each subsequent tissue homogenization the polytron was washed with distilled water followed by DEPC

(diethylpyrocaronate) water Following homogenization, the samples were centrifuged in 2ml micro-centrifuge tubes 700 of the supernatant, containing the RNA, was then transferred to a 2ml micro-centrifuge tube containing 700u1 of 70% ethanol in DEPC water, and mixed with pipetting 700ul of the supernatant/ethanol mix was then transferred onto a Qiagen RNeasy Mini Kit spin column placed into a 2ml collection tube After centrifugation, another 700pI of the supernatant/ethanol mix was transferred onto the spin column to increase the total potential RNA yield from the samples The mRNA was then isolated from each sample following the Qiagen RNeasy purification protocol After the final elution with SO of RNase-free water, all mRNA samples were stored in 2ml micro-centrifuge tubes in a -80°C freezer

cDNA synthesis and qRT-PCR:

Following the mRNA extraction, first strand cDNA synthesis was performed for subsequent quantitative reverse transcriptase PCR (qRT-PCR) The cDNA synthesis was carried out using the One-Jag RT-PCR kit with a random hexamer primer The reverse transcriptase reaction was run in a thermal cycler; the samples were incubated at 42°C for

Trang 31

one hour and then incubated at 80°C for 4 minutes to inactivate the reverse transcriptase enzyme 100ng of cDNA (in a 50 pl volume) was synthesized from each mRNA sample and held at -20°C for PCR For each cDNA reaction (+RT), a paired control reaction lacking the reverse transcriptase (-RT) was run to examine the DNA contamination in the original MRNA samples The subsequent qRT-PCR reactions were performed with SYBR® Green Real-Time PCR Master Mixes, using a 13 pl reaction volume For each reaction, either 111 of cDNA product (+RT), 1 pl of -RT product (NRT) or 1 wl of nuclease free water, for the no template control, (NTC) was used The PCR amplification of Elovl3 mRNA was carried out using a forward primer (GTCGTCTATCTGTTGCTCATCG) and reverse primer

(ACTTCCACATCCTCAGAGTACC) The ELOVL3 primers were ordered from Life Technologies and the stock solution for these was 100uM in water All reactions included 6p of SYBR® Green dye, 5 ul of each the forward (259406H0S) and reverse (259406H06) Elovi3 primers and 5] of nuclease free water The genes Dio2

(PPM26160B), Ucp-¡ (PPM05164B) and PGC-Ja (PPM03307C) were also analyzed using qRT-PCR These primer assays were ordered from Qiagen, a provider of sample and assay technologies The primer assay is a mix of 2 primers (10,1M each) that enables gene expression analysis with SYBR® Green-based qRT-PCR For these three genes, the reactions included 611 of SYBR® Green dye, 1 yl of primer assay and 5yl of nuclease free water Gapdh (4352339) was used as a housekeeping gene for data normalization of the four target genes, Elovl3, Dio2, Ucp-] and PGC-1a For each tissue sample, 3 +RT reactions per primer, | —RT control and two GAPDH controls were run Three NTC controls were run for each 96 well PCR plate to ensure there was no DNA contamination or primer dimer formation in the reactions The qRT-PCR reactions ran for 1 hour and

Trang 32

50 minutes and the data was analyzed using the BioRad Manager software accompanying the instrumert

Gene Expression Analysis

2°4C method The relative changes in gene expression were calculated using the

With this method, all Dio2, Ucp-1, PGC1-a and Elovi3 cycle threshold (Ct) values were normalized to the Gapdh control for each sample The Ct value provides a measure for the amount of mRNA present in the sample After all experimental values were

normalized, the values of the treatment groups were compared to the untreated groups In calculating the effect of ambient temperature on mRNA levels, the relative changes in gene expression from qRT-PCR were quantified with the 20°C singly housed mice serving as the treatment group and the 30°C singly housed mice as the untreated control This method relates the PCR signal of the target transcript in a treatment group (CS) to the PCR signal of an untreated control (WS) The mean fold-change in expression of the target gene was calculated using the AACr method whereby AACT= (Craze CrGapan )ws

2°44Ct method helps to determine the effect of the cold — (CTurge- CTGapan)cs The

treatment on the expression of the candidate genes in the brown fat of the treated mice (CS) In analyzing the effect of group housing and running on Elovl3 mRNA levels, the 24°C method was also used Within the 30°C housed mice, the singly housed mice (WS) served as the untreated control while the group housed and running wheel mice served as the treatment groups Within the 20°C housed mice, the singly housed mice (CS) served as the untreated control, with the group housed and running mice serving as the treatment groups (CG and CRW respectively)

Trang 33

Extraction of Lipids:

For all samples, the lipids from the second brown fat pad were extracted using the Bligh and Dyer (1959) protocol Two ml of methanol and one ml of chloroform were added to each fat sample in a 16x100 mm screw cap tube After sitting for five minutes, the samples were macerated with a glass stir rod, one ml of chloroform was added and the samples were held for seven hours to allow for complete extraction of the lipids 1.5 ml of 1% NaCl was then added to each sample and the samples were held at room temperature for 48 hours to allow for full separation of the upper aqueous and lower chloroform phases The samples were then centrifuged for five minutes at medium speed to separate the mixture into two clear phases and remove any water droplets from the lower chloroform phase A Pasteur pipette was used to draw up approximately 1.5 ml of the lower chloroform phase, which was placed into a clean 16x100 mm tube and capped with a polyethylene screw cap A few drops of ethanol were added to each sample to bind any traces of water remaining in the chloroform 750 1! of the extracted lipid was transferred to a second 16x100 mm tube and capped with a black screw cap for fatty acid methyl esterification

Fatty-acid Esterification

To derivatize the extracted lipids, all solvent was evaporated under a stream of N2 and one ml of boron triflouride/methanol was immediately added to each tube The samples were held in 16x100 mm tubes capped with a black screw cap and placed in a

100°C heating block for 12 minutes; the samples were vortexed several times over the course of the 12 minutes to emulsify the fat droplets After heating, the samples cooled for five minutes and one ml of water followed by two ml of hexane was added to each

Trang 34

sample The samples were then vortexed briefly, centrifuged for five minutes and 1.5 ml of the upper hexane phase was transferred to a 5 ml conical tube and capped with a clear polyethylene cap for gas chromatography (GC) analysis

Gas Chromatography

The prepared fatty-acid methyl esters were analyzed with the Hewlett-Packard 5890 bench top chromatograph with FID (flame ionization detector) The gas

chromatograph had a 15m x 0.25 mm DB-23 fused silica capillary column Before the samples were run, a standard mixture was injected into the GC to identify the retention times of the major fatty acids and thus be able to correlate the peaks with known fatty acids The samples were concentrated down to half the original volume under a stream of N> and then run for 10 minutes to detect all major fatty acids The detector quantifies the relative amount of each fatty acid within the sample by integrating the areas under the peaks For all brown fat samples, the relative amounts of the following fatty acids were identified: 16:0 (palmitic acid), 16:1 (palmitoleic acid), 18:0 (stearic acid), 18:1 (oleic acid), 18:2 (linoleic acid), 18:3 (a-linolenic acid) and 20:46 (arachidonic acid) Gas chromatography allows for quantitative analysis of fatty acid compositions for each sample

Thin-Layer Chromatography

A dual-development system was used for TLC analysis The samples were placed on thin-layer plates coated with silica gel H The extracted fat from the brown adipose tissue of 20°C singly housed, 20°C group housed and 30°C singly housed samples were analyzed The samples were spotted in small bands with a micro-capillary tube The

Trang 35

initial solvent system consisted of chloroform/methanol/acetic acid/water in a ratio of 85:15:15:3 and was used to separate out the polar lipids The second solvent system consisted of petroleum ether/ethyl etheracetic acid in a ratio of 80:20:1 and was used to separate the nonpolar lipids The plates were placed in a solvent tank and the samples were run a short distance up the TLC plate with the first solvent system The same plate was then run with the second solvent system and then removed from the solvent system and placed in a tank with iodine crystals that bind to the lipids and create visible yellow bands marking the presence of lipids The total amount of triglyceride (TG) across sample groups was compared to determine differences in TG content as a function of ambient temperature and group housing

Data Analysis

The data derived from gene expression and GC was consolidated on Microsoft Excel and expressed as means + standard error Statistical analysis was performed using SPSS software One-way ANOVA Tukey tests were used to determine the statistical significance of differences in gene expression and fatty acid profiles across the different groups of mice P values less than 0.05 were considered statistically significant

Trang 36

RESULTS

Experiment 1: Effect of Temperature on Brown Fat Gene Expression Body Weights and Running

All 37 mice were housed in their respective conditions for the 21 day period Daily food intake and body weights were measured for all mice However, in several of the cages water leaked onto the food and thus it was not possible to obtain accurate daily food intake measurements Across all 7 groups of mice, there was no significant change in body weight over the 21-day period (Figure 1) The average body weight across all 37 mice was 22.2 + 0.3g Mean Body Weights Over 21-Day Period 25 B 2 SN a sia 2 = ti a aa Leer lt = 2i LỆ FO — i a ct ee 3 3 19 a § 17 8 = b + ooo ooo to 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Day —\wS ==\WRW === WG —cs =e CRW F—(G —FS

Figure 1: Daily body weight measurements are compared for all 7 groups of mice The mean body weight within each group is plotted for each day of the experiment (+ SE) All mice were provided with food ad libitum

For the mice housed with a running wheel, there was variability in the running behaviors across mice In the WRW mice, three out of the six mice ran sporadically over the course of the 21 days and two of those mice ran for over half the number of days

Trang 37

(Table 1, Figure 2) While only half of the WRW mice ran, all 6 housed at 20°C ran over the course of the 21 days Four of those mice ran over half the days (Table 2, Figure 2)

Table 1: Average and total distances ran for running mice at 30°C (WRW1-WRW6) Only three of the six mice ran over the course of the 21 days Distances were recorded daily at time of body and food weights Mouse # Days Ran Total Distance Ran (km) | Average Distance Ran (km/day) WRW1 6 12.3 0.6 WRW2 21 147.6 7.0 WRW3, 0 0 0 'WRW4 0 0 0 WRWS 14 122.5 5.8 WRW6 0 0 0

Trang 38

Total Distances Run Over 21 Days 200 £ 19/21 an x/21=animal = 21/21 1 = 150 14/21 19/21 21/21 ran x days 5 during the 21 3 100 day period £ Š s0 a 5S 1/21 ek oO WRW1 WRW2 WRW3 WRW4 WRWS5 WRWE6 CRW1 CRW2 CRW3 CRW4 CRWS CRW6 Individual Animal

Figure 2: Mice were housed with a running wheel at 30°C (WRW1-WRW6) or 20°C (CRW1-CRW6) for 21 days The distance each mouse ran was measured with a bike odometer The total number of days ran during the 21 day period is labeled for each individual mouse

Brown Fat Gene Expression

In the initial quantification of gene expression, qRT-PCR was performed for the 30°C and 20°C singly housed mice, using mouse-specific primers for Dio2, UCP-1, PGCI-a and Elovi3 There was not sufficient mRNA product yield for the 10°C housed mice (FS1-F3); these samples were omitted from qRT-PCR data analysis

For Dio2, there was no significant difference in relative mRNA expression in BAT between the 20°C and 30°C singly housed mice (p>0.05) The 24“ calculations indicated only a 1.9 + 4 (p>0.05) fold-increase in Dio2 mRNA levels from 30°C to 20°C housing (Figure 3)

Trang 39

Effect of Ambient Temperature on Ÿ a Brown Fat Dio2 mRNA 2 3 & & 2.0 = 1.0 3 2 004 ah WS cs Sample Type

Figure 3: qRT-PCR quantification of Dio2 mRNA levels in brown adipocyte tissue, using the 2“ method The 30°C singly housed (WS) mice (n=4) serve as the control and the 20°C singly housed (CS) mice (n=6) serve as the experimental The mean 24 values for the CS group were compared to the standardized WS group Bars represent 244“

means + SE P>0.05 compared with the value of the control (WS)

There was no significant difference in relative PGC-1a mRNA levels between the 30°C singly housed mice and 20°C singly housed mice (p>0.05) The 24C' calculations yielded a 0.6 + 0.2 (p>0.05) fold-decrease in PGC-1a mRNA levels from 30°C and 20°C (Figure 4) Effect of Ambient Temperature on $40 Brown Fat PGC-1a mRNA 3 Ễ 3.0 $ & ws cs Sample Type

Figure 4: qRT-PCR quantification of PGC-1a mRNA levels in BAT, using the 224G method The 30°C singly housed (WS) mice (n=4) serve as the control and the 20°C singly housed (CS) mice (n=6) serve as the experimental The mean 2“““ values for the CS group were compared to the standardized WS group Bars represent 2“““' means + SE P>0.05 compared with the value of the control (WS)

Trang 40

For UCP-1, the 2“*“' calculations yielded a 1.1 + 0.1 (p>0.05) fold-increase in

brown fat UCP-1 mRNA from 30°C to 20°C; however, this value was not statistically significant (Figure 5) Effect of Ambient Temperature on Brown ° kì $ 40 Fat UCP-1 mRNA = kŠ = @ 20 § $ 10 3 k2 0.0 WS cs Sample Type

Figure 5: qRT-PCR quantification of UCP-1 mRNA levels in brown adipocyte tissue, using the 24" method The 30°C singly housed (WS) mice (n=4) serve as the control and the 20°C singly housed (CS) mice (n=6) serve as the experimental The mean 24“ values for the CS group were compared to the standardized WS group Bars represent

means + SE P>0.05 compared with the value of the control (WS)

There was a substantial difference in relative E/ovl3 mRNA levels between the 24“ calculations warm singly housed mice and cold singly housed mice (p<0.05) The

yielded a statistically significant 21.9 + 0.1 (p<0.05) fold-increase in brown fat Elovl3 mRNA from 30°C to 20°C singly housed mice (Figure 5)