Genetic characterization of african swine fever virus (asfv) isolated in some northern provinces of vietnam in 2020

VIETNAM NATIONAL UNIVERSITY OF AGRICULTURE FACULTY OF BIOTECHNOLOGY -*** - UNDERGRADUATE THESIS TITLE: GENETIC CHARACTERIZATION OF AFRICAN SWINE FEVER VIRUS (ASFV) ISOLATED IN SOME NORTHERN PROVINCES OF VIETNAM IN 2020 HANOI– 2021 VIETNAM NATIONAL UNIVERSITY OF AGRICULTURE FACULTY OF BIOTECHNOLOGY -*** - UNDERGRADUATE THESIS TITLE: GENETIC CHARACTERIZATION OF AFRICAN SWINE FEVER VIRUS (ASFV) ISOLATED IN SOME NORTHERN PROVINCES OF VIETNAM IN 2020 Student : LE QUANG DAI Class : K61CNSHE Major : Biotechnology Supervisors : Assoc Prof LE VAN PHAN Dr DINH TRUONG SON HANOI – 2021 COMMITMENT I hereby declare this is my research The data and results were mentioned in this thesis is true and has not been used and published in the thesis, dissertations and scientific works ever before I hereby declare that the cited information in this thesis has been made of the source, ensuring cited as prescribed I bear full responsibility for these reassurances Hanoi, January 15th, 2021 Student Le Quang Dai i ACKNOWLEDGEMENT First and foremost, I have to thank my research supervisors, Assoc Prof Le Van Phan and Dr Dinh Truong Son Without their assistance and dedicated involvement in every step throughout the process, this thesis would have never been accomplished I would like to thank you very much for your support and understanding over these past four years I would like to honestly thanks to the teachers of the Faculty of Biotechnology for conveyed and taught me the important knowledge which has been the basis for future research and further career at Vietnam National University of Agriculture (VNUA) In addition, I send sincerely thanking the teachers and dear friends In July 2020, I went to Virology Laboratory of Key Laboratory of Veterinary Biotechnology for six months to study with MSc Nguyen Van Tam, MSc Nguyen Thi Thu Huyen, DMc Trinh Thi Bich Ngoc and DMc Vu Xuan Dang My time at Virology Laboratory has been highly productive and working with Mr Dang was an extraordinary experience Also, Ms Huyen, Ms Ngoc and Mr Tam are really helpful and whole-hearted to lead me in the laboratory and my experiments Most importantly, none of this could have happened without my family My parent and my brother - it would be an understatement to say that, as a family, we have experienced some ups and downs in the past four years This dissertation stands as a testament to your unconditional love and encouragement Ha Noi, 29 January, 2021 Student Le Quang Dai ii TABLE OF CONTENTS COMMITMENT i ACKNOWLEDGEMENT ii TABLE OF CONTENTS iii LIST OF TABLES v LIST OF ABBREVIATIONS vii ABSTRACT ix TÓM TẮT x PART INTRODUCTION 1.1 Introduction 1.2 Purposes and requirements 1.2.1 Purpose 1.2.2 Requirements PART LITERATURE REVIEW 2.1 Overview of African swine fever virus 2.1.1 Introduction 2.1.2 Geographical Distribution and Virus Isolates 2.1.3 Origin and transmission of the African Swine Fever Virus 2.1.4 Viral entry mechanism 2.2 Roles of B646L/p72 and central variable region (CVR) of B602L genes in viral entry mechanism 2.3 Review of molecular techniques to assess genetic diversity 10 PART MATERIAL AND METHOD 12 3.1 Time and place of study 12 3.2 Research subject 12 3.3 Material 12 3.3.1 Chemicals used in research 12 3.3.2 Equipment 12 3.4 Methods 12 3.4.1 Sample collection 12 iii 3.4.2 Sample preparation 15 3.4.3 Viral DNA extraction 15 3.4.4 Amplification of B646L C-terminus and central variable region (CVR) of B602L 17 3.5 Agarose gel electrophoresis 19 3.6 B646L C-terminus and central variable region (CVR) of B602L sequencing 20 3.7 Processing raw sequencing data 20 3.8 Genetic characterization 20 3.8.1 DNA sequence and phylogenetic analyses based on ASFVs‘ B646L Cterminus homologous sequences 20 3.8.2 Deducing tandem repeat sequences (TRSs) from central variable regions (CVRs) of B602L 22 PART RESULTS AND DISCUSSION 23 4.1 Sample analysis 23 4.2 Detection of the ASFV genome 24 4.3 Nucleotide sequence of p72 (B646L) gene 25 4.4 Phylogenic tree analysis of p72 (B646L) gene 27 4.5 Investigation on an intra-genotypic scale by TRSs located in the CVR within the B602L gene of ASFV sampled from Northern Vietnam provinces and beyond Vietnam‘s boundary 29 4.6 Discussion 33 PART CONCLUSION AND SUGGESTION 38 5.1 Conclusion 38 5.2 Suggestion 38 REFERENCES 39 APPENDIX 46 iv LIST OF TABLES Table 2.1 ASF virus isolates Table 3.1 Sample used in this study .14 Table 3.2 Kit contents 16 Table 3.3 PCR sample preparation .18 Table 3.4 Primers used in this study 18 Table 3.5 PCR cycling conditions for C-terminal region of P72 and CVR region of B602L amplification with modification of MyTaq Mix™ (Bioline Reagents Ltd., United Kingdom) manual instruction 19 Table 4.1 Information about collected samples 23 Table 4.2 Information about representative query sequence 26 Table 4.3 Reference strains included on the phylogenetic tree characterizing some p72 genotypes .27 Table 4.4 List of alphabetic characters encoding each set of tetramer .29 Table 4.5 Tetrameric tandem repeat sequences (TRSs) of central variable region (CVR) of B602L gene obtained from Vietnam ASFV variants and retrieved from public sources of the same Vietnam ASFV strains‘ or diverse p72 genotypes 31 v LIST OF FIGURES Figure 2.1 Three main stage of PCR reaction and their cycles 11 Figure 3.1 Map showing sites of sample collection in Northern Vietnam 13 Figure 3.2 Kit box .16 Figure 4.1 Gel agarose electrophoresis separating the PCR products of 478bp-size B646L gene in different sample types and origins M: marker .24 Figure 4.2 Gel agarose electrophoresis separating the PCR products of 665bp-size B602L gene in different sample types and origins M: marker .25 Figure 4.3 p72 (B646L) gene sequences results of five northern provinces Conserved regions between comparable sequences were identified as dots while variations were represented by nucleotide letters Nucleic acid bases were colour-coded: A (green), T (red), G (black) and C (blue) The graphical view was produced by BioEdit version 7.2.5 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html) 26 Figure 4.4 Phylogenetic tree of p72 (partial gene nucleotide sequences) of ASF isolates between Vietnamese strains (black circle symbol) and Korea strain (red square symbol) and other countries 28 vi LIST OF ABBREVIATIONS Abbreviations Definitions A Adenine ASF African Swine Fever ASFV African Swine Fever Virus µl Microlitre BLAST Basic Local Alignment Search Tool bp Base pairs C Cytosine CSF Classical Swine Fever CSFV Classical Swine Fever Virus CVR Central variable region d.s Direct submission ds DNA Double- stranded DNA DTLCP Dịch tả lợn châu Phi E Expectation EDTA Ethylenediaminetetraacetic acid ER Endoplasmic reticulum FAO Food and Agriculture Organization FMDV Foot- and- Mouth Disease Virus G Guanine IUPAC International Union of Pure and Applied Chemistry JC Jukes Cantor MEGA Molecular Evolutionary Genetics Analysis n.g Not given NCBI National Center for Biotechnology Information NIVR National Institute of Veterinary Research NJ Neighbor Joining OIE World Organization for Animal Health PAM Pulmonary alveolar macrophage vii PBS Phosphate buffered saline PCR Polymerase chain reaction PEDV Porcine Epidemic Diarrhea Virus PRRS Porcine Reproductive and Respiratory Syndrome PRRSV Porcine Reproductive and Respiratory Syndrome Virus RT Room temperature RT- PCR Real- time PCR STR Short tandem repeat T Thymine TBE Tris/ Borate/ EDTA TE Tris/ EDTA TRS Tandem repeat sequence UPGMA Unweighted Pair- Group Method with Arithmetic VNUA Vietnam National University of Agriculture MUSCLE Multiple sequence comparison by log- expectation viii substitutions (Baldauf, 2003) Therefore, more powerful bioinformatic packages or improvement in molecular paleontology should tackle this problem in the near future The grouping outputs generated by the phylogenetic tree in Figure 4.4 also encountered the problem termed ‗long branch attraction‘ This scenario enacts when highly diverse sequences tend to cluster together irrespective of their true relationships (Baldauf, 2003) To illustrate, RSA/1/99/W (Accession Number: AF449477) and MOZ/94/8 (Accession Number: AF270712) was spuriously grouped into a lineage as the limited genotype data set had given the computational models the sensation of ‗unreal‘ similarities Due to the lack of other genotype intermediate sequences, the clustering of genotype IV, VI and X into a single lineage was not in harmony with lineage arisen from other trees with similar method of reconstruction (Boshoff et al., 2007; Quembo et al., 2018) Despite this limitation, the finding on delineation of genotype I and II from a common ancestor was in accordance with the abovementioned research teams To further strengthen the p72 inter-genotyping, Vietnam ASFV strains‘ CVR residing on B602L gene was under tetrameric STR examination, which revealed a marked similarity of 10 repeats as those taxa of the same genotype II clade previously identified (Table 4.5) However, this conserved 10-letter-coded TRS pattern could not discriminate strains within p72 genotype II unlike the variation in number and composition of repeats seen in those variant recovered from African outbreaks Certainly, a lot of identical strains to Vietnam‘s swept over large geographical areas such as Asia, Caucasus, Baltic or European regions, making it impossible to reach conclusion of the exact source of infection in Vietnam based on just characterized Vietnam ASFV strains‘ genotypes (Kim et al., 2020; Ge et al., 2018; Kim et al., 2020) Many authors could only speculate ASF outbreak in Vietnam occuring after just only months since the disease first announcement in China stemmed from illegal trading of pork and pig-derived products via the long and close border between Vietnam and China (Zhou et al., 2019; Le et al., 2019; Bui et al., 2020) Two elements constituting the ASF virion this study focused on were MCP p72 and the B602L-encoding chaperone protein These two proteins are orchestrated in an 34 elaborate symphony of ASFV morphogenesis (Salas and Andrés, 2013) Basically, an extracellular virion composes of layers in total, which listed inside out orderly: the central nucleoid, the inner core shell, the inner lipid envelope, the icosahedral capsid and lastly the host membrane-derived external envelope (Figure 1, Asfarviridae description, Part II The Viruses, King et al., 2012; Breese and DeBoer, 1966) To construct the viral capsid in late stage expression of virus infection, newly synthesized p72 accumulates in two reservoirs, a soluble cytoplasmic and an endoplasmic reticulum (ER)‘s membrane-associated pools so as it can build up the megastructure of capsomers on the ER foundation (Cobbold and Wileman, 1998) Apparently, fully functional MCP p72 could only attained after being folding properly with the aid of the non-structural chaperone protein pB602L (Cobbold et al., 2001) By means of ASFV inducible recombinants, the scientists have figured out myriad defects in viral layer formation whenever one of these aforementioned proteins were inhibited, thus they could partially elucidate the inbuilt function of those structural and non-structural proteins in the viral assembly processes (Salas and Andrés, 2013) In addition, many works concentrated on the highly anti- and immunogenic p72, for instance, the conformational specific attachment between p72 epitope and its neutralizing antibodies (Borca et al., 1994), reconstruction of the p72 structure or uncover the protein-protein interaction between pB602L and p72 (Liu et al., 2019) by using cryoelectron microscopy could yield basic insights into the vaccine development or antiASF viral therapy So far, ASF has been dispersing throughout the entire Vietnam provinces and municipalities Since the last updated (5th March, 2020) ASF situation in Vietnam issued by Food and Agriculture Organization (FAO), 35 provinces announced the end of the disease due to no outbreaks occurring more than 30 days (FAO ASF situation update) However, the disease could reemerge anytime, especially, pig-farming families used to be affected by ASF in the past tend to restock their herd with imported replacement gilts (VnExpress International) Besides thorough pathogen monitoring program, investigation of ASF on a national scale should be conducted to clarify the epidemiological situation in prior to massive repopulation As a matter of fact, the 35 sample collection in this study should not be constrained in some provinces of Northern Vietnam but require expansion of sampling in accordance with historical disease documentation so that conclusive results could be obtained Also, a comprehensive examination should be carried out by which development of reliable detection method and confirmatory surveillance tests need to be conducted simultaneously (OIE Terrestrial Manual, 2019) In the socio-economic plight due to pig scarcity, notification of ASF-affected farms must be strictly addressed as a conclusion of positive or negative to ASF will define the livelihood of the pig-raising farmers To untangle this, researcher group from the Vietnam National Institute of Veterinary Research (NIVR) has adopted the improved version of Real-time PCR (RT PCR) reaction that OIE previously described by acclimating the probe to its mismatch binding region so as false-negative results could be avoid (OIE Terrestrial Manual, 2019; Tran et al., 2019) In the outbreak situation, where time is of the essence, a rapid, robust and highly sensitive ASFV detection method plays crucial roles in control programs A direct colorimetric Loop-Mediated Isothermal Amplification (LAMP) has been developed by Tran and colleagues as a handy tool for in-field ASFV identification to the same degree as RT-PCR, but superior regarding facilities and speed (Tran et al., 2020) As ASFV featured complicated transmission route and its source of introduction in Vietnam remained ambiguous, multiple aspects related to disease propagation should be taken into consideration Only domestic pig-to-pig circle has been under study in Vietnam territory so far (Le et al., 2019; Tran et al., 2020; Bui et al., 2020) In fact, many ethnic groups have their pig holding in close proximity to the wildlife These buffer zones are potential entry for sylvatic cycle Moreover, poor biosecurity in back-yard pigsties and improper infected animal disposal have led to disease spread only in a short time period of months since its first detection (Kedkovid et al., 2020; VnExpress International; Le et al., 2019) It should be noted that Vietnam ASFV strains were characterized as p72 genotype II, which was resemble to those of most affected eastern Europe and Asia countries, where a host of cases in wild boars have been documented (Gallardo et al., 2014; Bao et al., 2019; 36 Kim et al., 2020) As a southeastern Asian country with beneficial habitat for the Argasidae family, soft-tick-borne ASF in Vietnam should not be under estimated and we might unravel novel viral variant concerning p72 genotype or TRS of B602L gene as the work of Quembo (Petney et al., 2019; Quembo et al., 2018) Hence, a vast rage of plausible transmission sources should be under investigation such as pigswill feeding, domestic-wildlife and sylvatic cycles ASFV mutations to efficiently target other host than swine with no exception for human beings is an imminent catastrophe we have to prevent Hence, in-depth study on whole viral genome sequence should be conducted further than the out of 24 p72 genotype strains done by Villiers‘s research team (de Villiers et al., 2010) By doing so, we could enrich our understanding on viral infection at a molecular level Additionally, combination of study on pathological ASF onsets with application of medicines to halt the viral growth in the animal could alleviate the severity of this epizootic instead of culling programs that cause huge socio-economical losses (Bui et al., 2020; Tran et al., 2020; Kedkovid et al., 2020) It should be noted that genetic characterization only serves molecular epidemiological purposes but cannot decipher the virulence or other disease parameters, hence, to promote the vaccine development for the disease, interdisciplinary researches concerning orchestrated biochemistry, host-pathogen interplays, implemented with the advance of bioinformatic instruments are required (FAO, EMPRES, 2019; Revilla et al., 2018) 37 PART CONCLUSION AND SUGGESTION 5.1 Conclusion In conclusion, this study first showed the important role of molecular diagnosis in terms of precisely identifying the presence of ASFV in freezing-preserved field samples and opt out of other swine diseases with similar clinical presentations Second, despite type II p72 genotype strains could not be further resolved by means of STR marker when comparing Vietnam ASFV variant of interest with others‘ in query from China, South Korea, the fact that strains recovered from Vietnam outbreaks belong to p72 genotype II still shed light on epidemiological links with previously reported outbreaks, especially those first occurred in China (2018) Vietnam was just a second victim of ASF after this Asian mainland, and partial p72 nucleotide identities of Vietnam ASFV strains has shared 100% to those of China lately, thus, much attention to the disease transmission has been drawn from this country In fact, in consistent with another finding demonstrating ASF situation in Vietnam, only one viral strain is known to currently circulate in the nation Thus, a multitude of intellectual efforts needed to be devoted to uncover ASF characteristics from microscopic (e.g., genomics, proteomics) to macroscopic (e.g., host-pathogen interactions, mechanisms to manipulate host defence system) scales so that the future devoid of the disease is not far 5.2 Suggestion Continue to study about the genetic relationships of African swine fever virus collected in other different parts of Vietnam with more markers to understand the genotypes and genetic relationships of virus 38 REFERENCES African swine fever infected pigs dumped on river bank in central Vietnam VnExpress.International.https://e.vnexpress.net/news/news/african-swine-feverinfected-pigs-dumped-on-river-bank-in-central-vietnam-4001726.html.(accessed 8.12.20) Alexander Malogolovkin, n.d Comparative Analysis of African Swine Fever Virus Genotypes and Serogroups Bacciu D., Deligios M., Sanna G., Madrau M.P., Sanna M.L., Dei Giudici S & Oggiano A (2016) Genomic analysis of Sardinian 26544/OG10 isolate of African swine fever virus Virol Reports 6, 81–89 doi:10.1016/j.virep.2016.09.001 Baldauf S.L (2003) Phylogeny for the faint of heart: A tutorial Trends Genet 19, 345–351 doi:10.1016/S0168-9525(03)00112-4 Bao J., Wang Q., Lin P., Liu C., Li L., Wu X., Chi T., Xu T., Ge S., Liu Y., Li J., Wang S., Qu H., Jin T & Wang Z (2019) Genome comparison of African swine fever virus China/2018/AnhuiXCGQ strain and related European p72 Genotype II strains Transbound Emerg Dis 66, 1167–1176 doi:10.1111/tbed.13124 Bastos A.D.S., Penrith M., Macome F., Pinto F & Thomson G.R (2004) Cocirculation of two genetically distinct viruses in an outbreak of African swine fever in Mozambique: no evidence for individual co-infection 103: 169–182 doi:10.1016/j.vetmic.2004.09.003 Bastos A.D.S., Penrith M.L., Crucière C., Edrich J.L., Hutchings G., Roger F., Couacy-Hymann E & Thomson G.R (2003) Genotyping field strains of African swine fever virus by partial p72 gene characterisation Arch Virol 148, 693–706 doi:10.1007/s00705-002-0946-8 Blome S., Moß C., Reimann I., König P & Beer M (2017) Classical swine fever vaccines— State-of-the-art Vet doi:10.1016/j.vetmic.2017.01.001 39 Microbiol 206: 10–20 Borca M V., Irusta P., Carrillo C., Afonso C.L., Burrage T & Rock D.L (1994) African Swine Fever Virus Structural Protein p72 Contains a Conformational Neutralizing Epitope Virology doi:10.1006/viro.1994.1311 10 Boshoff C.I., Bastos A.D.S., Gerber L.J & Vosloo W (2007) Genetic characterisation of African swine fever viruses from outbreaks in southern Africa (1973-1999) Vet Microbiol 121, 45–55 doi:10.1016/j.vetmic.2006.11.007 11 Breese S.S & DeBoer C.J (1966) Electron microscope observations of African swine fever virus in tissue culture cells Virology 28: 420–428 doi:10.1016/00426822(66)90054-7 12 Cobbold C & Wileman T (1998) The Major Structural Protein of African Swine Fever Virus, p73, Is Packaged into Large Structures, Indicative of Viral Capsid or Matrix Precursors, on the Endoplasmic Reticulum J Virol 72: 5215–5223 doi:10.1128/jvi.72.6.5215-5223.1998 13 Cobbold C & Wileman T (1998) The Major Structural Protein of African Swine Fever Virus, p73, Is Packaged into Large Structures, Indicative of Viral Capsid or Matrix Precursors, on the Endoplasmic Reticulum J Virol 72: 5215–5223 doi:10.1128/jvi.72.6.5215-5223.1998 14 Cobbold C., Windsor M & Wileman T (2001) A Virally Encoded Chaperone Specialized for Folding of the Major Capsid Protein of African Swine Fever Virus J Virol 75, 7221–7229 doi:10.1128/jvi.75.16.7221-7229.2001 15 Costard S., Wieland B., De Glanville W., Jori F., Rowlands R., Vosloo W., Roger F., Pfeiffer D.U & Dixon L.K (2009) African swine fever: How can global spread be prevented? Philos Trans R Soc B Biol Sci 364: 2683–2696 doi:10.1098/rstb.2009.0098 16 David A.G C., Alistair C D., Melissa D S., Chris U., Alan D R & L.K.D (2011) Genomic Analysis of Highly Virulent Isolate of African Swine Fever Virus 40 17 Dixon L.K., Abrams C.C., Bowick G., Goatley L.C., Kay-Jackson P.C., Chapman D., Liverani E., Nix R., Silk R & Zhang F (2004) African swine fever virus proteins involved in evading host defence systems Vet Immunol Immunopathol 100: 117–134 doi:10.1016/j.vetimm.2004.04.002 18 Dixon L.K., Chapman D.A.G., Netherton C.L & Upton C (2013_ African swine fever virus replication and genomics Virus Res 173: 3–14 doi:10.1016/j.virusres.2012.10.020 19 Edgar R.C (2004a) MUSCLE: A multiple sequence alignment method with reduced time and space complexity BMC Bioinformatics 5: 1–19 doi:10.1186/1471-2105-5-113 20 Edgar R.C (2004a) MUSCLE: Multiple sequence alignment with high accuracy and high throughput Nucleic Acids Res 32, 1792–1797 doi:10.1093/nar/gkh340 21 Etienne P de Villiers, Carmina Gallardo, Marisa Arias, Melissa da Silva, Chris Upton, Raquel Martin, R.P.B., 2010 Phylogenomic analysis of 11 complete African swine fever virus genome sequences 22 Eustace Montgomery R (1921) On A Form of Swine Fever Occurring in British East Africa (Kenya Colony) J Comp Pathol Ther 34, 159–191 doi:10.1016/s0368-1742(21)80031-4 23 FAO ASF situation update - African Swine Fever (ASF) - FAO Emergency Prevention System for Animal Health (EMPRES-AH) URL http://www.fao.org/ag/againfo/programmes/en/empres/ASF/situation_update.html (accessed 8.12.20) 24 Gallardo C., Anchuelo R., Pelayo V., Poudevigne F., Leon T., Nzoussi J., Bishop R., Pérez C., Soler A., Nieto R., Martín H., Arias M (2011) African swine fever virus p72 genotype IX in domestic Pigs, Congo Emerg Infect Dis doi:10.3201/eid1708.101877 25 Gallardo C., Fernández-Pinero J., Pelayo V., Gazaev I., Markowska-Daniel I., Pridotkas G., Nieto R., Fernández-Pacheco P., Bokhan S., Nevolko O., Drozhzhe Z., Pérez C., Soler A., Kolvasov D & Arias M (2014) Genetic variation among african swine fever genotype II viruses, Eastern and Central Europe Emerg Infect Dis doi:10.3201/eid2009.140554 41 26 Gallardo C., Mwaengo D.M., MacHaria J.M., Arias M., Taracha E.A., Soler A., Okoth E., Martín E., Kasiti J & Bishop R.P (2009) Enhanced discrimination of African swine fever virus isolates through nucleotide sequencing of the p54, p72, and pB602L (CVR) genes Virus Genes 38: 85–95 doi:10.1007/s11262-0080293-2 27 Gallardo C., Soler A., Nieto R., Cano C., Pelayo V., Sánchez M.A., Pridotkas G., Fernandez-Pinero J., Briones V & Arias M (2017) Experimental Infection of Domestic Pigs with African Swine Fever Virus Lithuania 2014 Genotype II Field Isolate Transbound Emerg Dis 64: 300–304 doi:10.1111/tbed.12346 28 Gasteiger E., Gattiker A., Hoogland C., Ivanyi I., Appel R.D., Bairoch A & Servet R.M (2003) ExPASy : the proteomics server for in-depth protein knowledge and analysis 31: 3784– 3788 doi:10.1093/nar/gkg563 29 Ge S., Li J., Fan X., Liu F., Li L., Wang Q., Ren W., Bao J., Liu C., Wang H., Liu Y., Zhang Y., Xu T., Wu X & Wang Z (2018) Molecular characterization of African swine fever virus, China, 2018 Emerg Infect Dis 24: 2131–2133 doi:10.3201/eid2411.181274 30 Gerdts V & Zakhartchouk A (2017) Vaccines for porcine epidemic diarrhea virus and other swine coronaviruses Vet Microbiol 206: 45–51 doi:10.1016/j.vetmic.2016.11.029 31 Gilliaux G., Garigliany M., Licoppe A., Paternostre J., Lesenfants C., Linden A & Desmecht D (2019) Newly emerged African swine fever virus strain Belgium/Etalle/wb/2018: Complete genomic sequence and comparative analysis with reference p72 genotype II strains Transbound Emerg Dis 66: 2566–2591 doi:10.1111/tbed.13302 32 Global African Swine Fever Research Alliance (GARA) African swine fever: Gap Analysis Report (2018) Dis swine 110 doi:10.1007/s40664-014-0022-8 33 Gogin A., Gerasimov V., Malogolovkin A & Kolbasov D (2013) African swine fever in the North Caucasus region and the Russian Federation in years 2007 – 2012 Virus Res 173: 198– 203 doi:10.1016/j.virusres.2012.12.007 42 34 Gómez-Villamandos J.C., Carrasco L., Bautista M.J., Sierra M.A., Quezada M., Hervas J., Chacón M de L.F., Ruiz-Villamor E., Salguero F.J., Sónchez-Cordón P.J., Romanini S., Núđez A., Mekonen T., Méndez A & Jover A (2003) African swine fever and classical swine fever: a review of the pathogenesis Dtsch Tierarztl Wochenschr 110: 165–169 35 Hall B.G (2018) Phylogenetic Trees Made Easy: A How-To Manual, Fifth ed, Psikologi Perkembangan Sinauer Associates doi:10.1017/CBO9781107415324.004 36 Hu J & Zhang C (2014) Porcine reproductive and respiratory syndrome virus vaccines: Current status and strategies to a universal vaccine Transbound Emerg Dis 61: 109–120 doi:10.1111/tbed.12016 37 Zhang J F (1985) Confidence Limits on Phylogenies : An Approach Using the Bootstrap Author (s):Joseph Felsenstein Stable URL : http://www.jstor.org/stable/2408678 Evolution (N Y) 39: 783–791 38 Jeffrey J Z., Locke A K., Alejandro R., Kent J & Schwarts G.W.S (2012) Diseases of SWINE, 10th ed, Wiley-Blackwell doi:10.1017/CBO9781107415324.004 39 Jori F & Bastos A.D.S (2009) Role of wild suids in the epidemiology of african swine fever Ecohealth 6: 296–310 doi:10.1007/s10393-009-0248-7 40 Kedkovid R., Sirisereewan C & Thanawongnuwech R (2020) Major swine viral diseases: an Asian perspective after the African swine fever introduction Porc Heal Manag 6: 20 doi:10.1186/s40813-020-00159-x 41 Kim H.J., Cho K.H., Lee S.K., Kim D.Y., Nah J.J., Kim H J., Kim H J., Hwang, J.Y., Sohn H.J., Choi J.G., Kang H.E & Kim Y.J (2020) Outbreak of African swine fever in South Korea, 2019 Transbound Emerg Dis 67: 473–475 doi:10.1111/tbed.13483 42 Kim S.H., Kim J., Son K., Choi Y., Jeong H.S., Kim Y.K., Park J.E., Hong Y.J., Lee S.I., Wang S.J., Lee H.S., Kim W.M & Jheong W.H (2020) Wild boar harbouring African swine fever virus in the demilitarized zone in South Korea, 2019 Emerg Microbes Infect 9, 628–630 doi:10.1080/22221751.2020.1738904 43 43 King A.M.Q., Adams M.J., Carstens E.B & Lefkowitz E.J (2012) Virus Taxonomy Classification and Nomenclature of Viruses Ninth Report of the International Committee on Taxonomy of Viruses 44 Kumar S., Stecher G., Li M., Knyaz C & Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms Mol Biol Evol 35: 1547–1549 doi:10.1093/molbev/msy096 45 Le V.P., Jeong D.G., Yoon S., Kwon H., Bich T., Trinh N., Nguyen T.L., To T., Bui N., Oh J., Kim J.B., Cheong K.M., Tuyen N Van, Bae E., Thu T., Vu H., Yeom M., Na W., Song D (2019) Outbreak of African Swine Fever, Vietnam, 2019 Emerg Infect Dis 25: 2017–2019 doi:https://doi.org/10.3201/eid2507.190303 46 Liu Q., Ma B., Qian N., Zhang F., Tan X., Lei J & Xiang Y (2019) Structure of the African swine fever virus major capsid protein p72 Cell Res 29: 953–955 doi:10.1038/s41422-019-0232-x 47 Lubisi B.A., Bastos A.D.S., Dwarka R.M., Vosloo W (2005) Molecular epidemiology of African swine fever in East Africa Arch Virol 150, 2439–2452 doi:10.1007/s00705-005-0602-1 48 Masatoshi Nei S.K (2000) Molecular Evolution and Phylogenetics 49 Misinzo G., Kwavi D.E., Sikombe C.D., Makange M., Peter E., Muhairwa A.P & Madege M.J (2014) Molecular characterization of African swine fever virus from domestic pigs in northern Tanzania during an outbreak in 2013 1199–1207 doi:10.1007/s11250-014-0628-z 50 Misinzo G., Magambo J., Masambu J., Yongolo M.G., Van Doorsselaere J & Nauwynck H.J (2011) Genetic Characterization of African Swine Fever Viruses from a 2008 Outbreak in Tanzania Transbound Emerg Dis 58: 86–92 doi:10.1111/j.1865-1682.2010.01177.x 51 Morgan S.B., Graham S.P & Steinbach F (2015) Host–pathogen interactions during porcine reproductive and respiratory syndrome virus infection of piglets Virus Res 1–9 doi:10.1016/j.virusres.2014.12.026 44 52 Nga N.T.D., Ninh H.N., Hung P Van & Lapar M.L (2014) Smallholder pig value chain development in Vietnam: Situation analysis and trends Int Livest Res Inst 53 Nix R.J., Gallardo C., Hutchings G., Blanco E & Dixon L.K (2006) Molecular epidemiology of African swine fever virus studied by analysis of four variable genome regions Arch Virol 151: 2475–2494 doi:10.1007/s00705-006-0794-z 54 Olasz F., Mészáros I., Marton S., Kaján G.L., Tamás V., Locsmándi G., Magyar T., Bálint Á., Bányai K & Zádori Z (2019) A simple method for sample preparation to facilitate efficient whole-genome sequencing of African swine fever virus Viruses 11 doi:10.3390/v11121129 55 Pelayo R V., Frontaura C.G & Arias Neira M.L (2016) LA PESTE PORCINA AFRICANA EN EL ESTE DE EUROPA: Evolución de los aislados circulantes y 56 Petney T.N., Saijuntha W., Boulanger N., Chitimia-Dobler L., Pfeffer M., Eamudomkarn, C., Andrews, R.H., Ahamad, M., Putthasorn, N., Muders, S V., Petney D.A & Robbins R.G (2019) Ticks (Argasidae, Ixodidae) and tick-borne diseases of continental Southeast Asia, Zootaxa doi:10.11646/zootaxa.4558.1.1 57 Phosphate-buffered saline (PBS) Cold Spring Harb Protoc pdb.rec8247 doi:10.1101/pdb.rec8247 58 Quembo C.J., Jori F., Vosloo W & Heath L (2018) Genetic characterization of African swine fever virus isolates from soft ticks at the wildlife/domestic interface in Mozambique and identification of a novel genotype Transbound Emerg Dis 65: 420–431 doi:10.1111/tbed.12700 45 APPENDIX Sequencing p72 (B646L) gene >ASFV LC_VN/2020 ATGCAGCCCACTCACCACGCAGAGATAAGCTTTCAGGATAGAGATACAGC TCTTCCAGACGCATGTTCATCTATATCTGATATTAGCCCCGTTACGTATCCG ATCACATTACCTATTATTAAAAACATTTCCGTAACTGCTCATGGTATCAATC TTATCGATAAATTTCCATCAAAGTTCTGCAGCTCTTACATACCCTTCCACTA CGGAGGCAATGCGATTAAAACCCCCGATGATCCGGGTGCGATGATGATTA CCTTTGCTTTGAAGCCACGGGAGGAATACCAACCCAGTGGTCATATTAACG TATCCAGAGCAAGAGAATTTTATATTAGTTGGGACACGGATTACGTGGGGT CTATCACTACGGCTGATCTTGTGGTATCGGCATCTGCTATTAACTTTCTTCT TCTTCAG >ASFV BG_VN/2020.1 ATGCAGCCCACTCACCACGCAGAGATAAGCTTTCAGGATAGAGATACAGC TCTTCCAGACGCATGTTCATCTATATCTGATATTAGCCCCGTTACGTATCCG ATCACATTACCTATTATTAAAAACATTTCCGTAACTGCTCATGGTATCAATC TTATCGATAAATTTCCATCAAAGTTCTGCAGCTCTTACATACCCTTCCACTA CGGAGGCAATGCGATTAAAACCCCCGATGATCCGGGTGCGATGATGATTA CCTTTGCTTTGAAGCCACGGGAGGAATACCAACCCAGTGGTCATATTAACG TATCCAGAGCAAGAGAATTTTATATTAGTTGGGACACGGATTACGTGGGGT CTATCACTACGGCTGATCTTGTGGTATCGGCATCTGCTATTAACTTTCTTCT TCTTCAG >ASFV HY_VN/2020.2 ATGCAGCCCACTCACCACGCAGAGATAAGCTTTCAGGATAGAGATACAGC TCTTCCAGACGCATGTTCATCTATATCTGATATTAGCCCCGTTACGTATCCG ATCACATTACCTATTATTAAAAACATTTCCGTAACTGCTCATGGTATCAATC TTATCGATAAATTTCCATCAAAGTTCTGCAGCTCTTACATACCCTTCCACTA CGGAGGCAATGCGATTAAAACCCCCGATGATCCGGGTGCGATGATGATTA CCTTTGCTTTGAAGCCACGGGAGGAATACCAACCCAGTGGTCATATTAACG TATCCAGAGCAAGAGAATTTTATATTAGTTGGGACACGGATTACGTGGGGT 46 CTATCACTACGGCTGATCTTGTGGTATCGGCATCTGCTATTAACTTTCTTCT TCTTCAG >ASFV TB_VN/2020 ATGCAGCCCACTCACCACGCAGAGATAAGCTTTCAGGATAGAGATACAGC TCTTCCAGACGCATGTTCATCTATATCTGATATTAGCCCCGTTACGTATCCG ATCACATTACCTATTATTAAAAACATTTCCGTAACTGCTCATGGTATCAATC TTATCGATAAATTTCCATCAAAGTTCTGCAGCTCTTACATACCCTTCCACTA CGGAGGCAATGCGATTAAAACCCCCGATGATCCGGGTGCGATGATGATTA CCTTTGCTTTGAAGCCACGGGAGGAATACCAACCCAGTGGTCATATTAACG TATCCAGAGCAAGAGAATTTTATATTAGTTGGGACACGGATTACGTGGGGT CTATCACTACGGCTGATCTTGTGGTATCGGCATCTGCTATTAACTTTCTTCT TCTTCAG >ASFV HN_VN/2020.1 ATGCAGCCCACTCACCACGCAGAGATAAGCTTTCAGGATAGAGATACAGC TCTTCCAGACGCATGTTCATCTATATCTGATATTAGCCCCGTTACGTATCCG ATCACATTACCTATTATTAAAAACATTTCCGTAACTGCTCATGGTATCAATC TTATCGATAAATTTCCATCAAAGTTCTGCAGCTCTTACATACCCTTCCACTA CGGAGGCAATGCGATTAAAACCCCCGATGATCCGGGTGCGATGATGATTA CCTTTGCTTTGAAGCCACGGGAGGAATACCAACCCAGTGGTCATATTAACG TATCCAGAGCAAGAGAATTTTATATTAGTTGGGACACGGATTACGTGGGGT CTATCACTACGGCTGATCTTGTGGTATCGGCATCTGCTATTAACTTTCTTCT TCTTCAG 47 Central variable region (CVR) of B602L sequencing >ASFV LC_VN/2020 CTTCATGCTCAAAGTGCGTATACTTGTGCAGATACCAATGTAGACACTTGT GCAAGCATGTGTGCAGATACCAATGTAGACACCTGTGCAAGCATGTGTGC AGATACCAATGTAGATACCTGTGCAAGCACTTGTACAAGCACAGAATACA CCGATTTAGCAGATCCTGAGCGCAT >ASFV BG_VN/2020.1 CTTCATGCTCAAAGTGCGTATACTTGTGCAGATACCAATGTAGACACTTGT GCAAGCATGTGTGCAGATACCAATGTAGACACCTGTGCAAGCATGTGTGC AGATACCAATGTAGATACCTGTGCAAGCACTTGTACAAGCACAGAATACA CCGATTTAGCAGATCCTGAGCGCAT >ASFV HY_VN/2020.2 CTTCATGCTCAAAGTGCGTATACTTGTGCAGATACCAATGTAGACACTTGT GCAAGCATGTGTGCAGATACCAATGTAGACACCTGTGCAAGCATGTGTGC AGATACCAATGTAGATACCTGTGCAAGCACTTGTACAAGCACAGAATACA CCGATTTAGCAGATCCTGAGCGCAT >ASFV TB_VN/2020 CTTCATGCTCAAAGTGCGTATACTTGTGCAGATACCAATGTAGACACTTGT GCAAGCATGTGTGCAGATACCAATGTAGACACCTGTGCAAGCATGTGTGC AGATACCAATGTAGATACCTGTGCAAGCACTTGTACAAGCACAGAATACA CCGATTTAGCAGATCCTGAGCGCAT >ASFV HN_VN/2020.1 CTTCATGCTCAAAGTGCGTATACTTGTGCAGATACCAATGTAGACACTTGT GCAAGCATGTGTGCAGATACCAATGTAGACACCTGTGCAAGCATGTGTGC AGATACCAATGTAGATACCTGTGCAAGCACTTGTACAAGCACAGAATACA CCGATTTAGCAGATCCTGAGCGCAT 48