Đang tải... (xem toàn văn)
ĐẠI HỌC THÁI NGUYÊN TRƯỜNG ĐẠI HỌC NÔNG LÂM HÀ VĂN QUYẾT NGHIÊN CỨU MỘT SỐ ĐẶC TÍNH CỦA VIRUS GÂY BỆNH MAREK Ở GÀ NUÔI CÔNG NGHIỆP TẠI PHÍA BẮC VIỆT NAM VÀ GIẢI PHÁP NÂNG CAO HIỆU LỰC VẮC XIN PHÒNG BỆ[.]
ĐẠI HỌC THÁI NGUYÊN TRƯỜNG ĐẠI HỌC NÔNG LÂM HÀ VĂN QUYẾT NGHIÊN CỨU MỘT SỐ ĐẶC TÍNH CỦA VIRUS GÂY BỆNH MAREK Ở GÀ NI CƠNG NGHIỆP TẠI PHÍA BẮC VIỆT NAM VÀ GIẢI PHÁP NÂNG CAO HIỆU LỰC VẮC XIN PHÒNG BỆNH LUẬN ÁN TIẾN SĨ THÚ Y THÁI NGUYÊN - 2017 ĐẠI HỌC THÁI NGUYÊN TRƯỜNG ĐẠI HỌC NÔNG LÂM HÀ VĂN QUYẾT NGHIÊN CỨU MỘT SỐ ĐẶC TÍNH CỦA VIRUS GÂY BỆNH MAREK Ở GÀ NI CƠNG NGHIỆP TẠI PHÍA BẮC VIỆT NAM VÀ GIẢI PHÁP NÂNG CAO HIỆU LỰC VẮC XIN PHÒNG BỆNH Ngành: Ký sinh trùng Vi sinh vật học thú y Mã số: 62.64.01.04 LUẬN ÁN TIẾN SĨ THÚ Y Người hướng dẫn khoa học: GS.TS Nguyễn Quang Tuyên PGS.TS Phạm Công Hoạt THÁI NGUYÊN - 2017 i LỜI CAM ĐOAN Tơi xin cam đoan rằng: Đây cơng trình nghiên cứu riêng Các số liệu, kết luận án trung thực nguyên gốc, không trùng lặp với kết công bố Tôi xin cam đoan rằng: Mọi giúp đỡ cho việc hoàn thành luận án cảm ơn, thơng tin trích dẫn luận án rõ nguồn gốc Tác giả luận án Hà Văn Quyết ii LỜI CẢM ƠN Để hoàn thành luận án này, nhận nhiều quan tâm giúp đỡ thầy, cô, bạn đồng nghiệp, quan cơng tác gia đình Tơi xin trân trọng cảm ơn: Khoa Chăn nuôi - Thú y, trường Đại học Nông lâm Thái Nguyên; Khoa Công nghệ sinh học, Viện Đại học mở Hà Nội tạo điều kiện tốt cho suốt trình học tập, nghiên cứu thực đề tài Hoàn hành luận án khoa học này, cố gắng thân, nhận giúp đỡ tận tình, đầy trách nhiệm hết lịng khoa học thầy giáo: GS.TS Nguyễn Quang Tuyên, PGS.TS Phạm Công Hoạt, PGS.TS Nguyễn Viết Không PGS.TS Phạm Thị Tâm Tôi xin trân thành cảm ơn: giúp đỡ, tạo điều kiện cho thời gian học tập, nghiên cứu Huyện ủy - Hội đồng nhân dân - Ủy ban nhân dân huyện Lập Thạch, tỉnh Vĩnh Phúc; giúp đỡ nhiệt tình Chi cục Thú y tỉnh Vĩnh Phúc, Phú Thọ, Hà Nội khoa Công nghệ sinh học - Viện Đại học mở Hà Nội tạo điều kiện, giúp đỡ q trình thí nghiệm thực luận án Nhân dịp này, tơi xin bày tỏ lịng biết ơn sâu sắc tới: thầy, cô, bạn đồng nghiệp đặc biệt gia đình ln giúp đỡ, động viên, hỗ trợ suốt thời gian qua Thái Nguyên, ngày 06 tháng 10 năm 2017 Tác giả luận án Hà Văn Quyết iii MỤC LỤC LỜI CAM ĐOAN .i LỜI CẢM ƠN ii MỤC LỤC iii DANH MỤC CÁC TỪ VIẾT TẮT vi DANH MỤC CÁC BẢNG BIỂU vii DANH MỤC CÁC HÌNH viii MỞ ĐẦU 1 Tính cấp thiết đề tài Mục tiêu đề tài Ý nghĩa khoa học thực tiễn đề tài Những đóng góp đề tài Chương TỔNG QUAN TÀI LIỆU 1.1 Tình hình lưu hành bệnh Marek nước giới 1.1.1 Tình hình lưu hành bệnh Marek Việt Nam 1.1.2 Tình thình lưu hành bệnh Marek giới 1.2 Cơ sở khoa học đề tài 1.2.1 Đặc tính sinh học virus gây bệnh Marek 1.2.2 Triệu chứng lâm sàng bệnh Marek 1.2.3 Bệnh tích bệnh Marek14 1.2.4 Chẩn đoán bệnh Marek 1.2.5 Dịch tễ học bệnh Marek 19 1.2.6 Miễn dịch chống lại MDV 1.2.7 Vắc xin với việc kiểm sốt phịng ngừa bệnh Marek 1.2.8 Các giải pháp phòng trị bệnh Marek 26 13 17 21 25 Chương NỘI DUNG, ĐỐI TƯỢNG, NGUYÊN LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 29 2.1 Nội dung nghiên cứu 29 2.1.1 Phân lập virus gây bệnh Marek gà nuôi công nghiệp số tỉnh phía Bắc Việt Nam 29 2.1.2 Nghiên cứu xác định độc lực gây bệnh thực nghiệm virus Marek phân lập giống lứa tuổi gà 29 iv 2.1.3 Nghiên cứu đặc điểm bệnh lý đặc trưng virus Marek phân lập gà thí nghiệm 2.1.4 29 Nghiên cứu thử nghiệm phối hợp chất bổ trợ với vắc xin để tăng cường hiệu miễn dịch vắc xin phòng bệnh Marek 29 2.2 Đối tượng, nguyên liệu nghiên cứu 29 2.2.1 Đối tượng nghiên cứu 2.2.2 Nguyên liệu 29 2.2.3 Hóa chất, sinh phẩm môi trường nuôi cấy 2.3 Địa điểm thời gian nghiên cứu .32 2.3.1 Địa điểm nghiên cứu 32 2.3.2 Thời gian nghiên cứu 32 2.4 Phương pháp nghiên cứu 32 2.4.1 Phương pháp thu thập xử lý mẫu 2.4.2 Phương pháp phân lập MDV nhuộm Plaque 32 2.4.3 Phương pháp hóa mơ 2.4.4 Phương pháp xác định độc lực virus phôi trứng gà 34 2.4.5 Phương pháp PCR xác định trình tự gen Meq 2.4.6 Phương pháp Real-Time PCR định lượng số copy genome virus MDV 29 30 32 34 34 36 2.4.7 Bố trí thí nghiệm xác định khả gây bệnh MDV giống gà lứa tuổi gà 2.4.8 36 Bố trí thí nghiệm đánh giá ảnh hưởng chất tăng cường miễn dịch đến hiệu vắc xin HVT/Rispens 2.5 38 Phương pháp xử lý số liệu 39 Chương KẾT QUẢ VÀ THẢO LUẬN 40 3.1 Kết phân lập virus Marek 40 3.1.1 Kết mổ khám gà nghi mắc bệnh Marek số địa phương 3.1.2 Phản ứng PCR xác định gen đặc hiệu virus Marek 3.1.3 Nuôi cấy phân lập virus Marek 41 3.1.4 Kết xác định trình tự gen Meq 43 3.2 Khả gây bệnh chủng MDV phân lập 46 3.2.1 Khả gây bệnh MDV 6.13 giống gà thí nghiệm 40 40 46 v 3.2.2 Khả gây bệnh MDV phân lập giống gà thí nghiệm độ tuổi khác 50 3.2.3 Nghiên cứu thải virus từ gà thí nghiệm gây nhiễm virus gây bệnh MDV 57 3.3 Biểu bệnh tích gà thí nghiệm chủng MDV phân lập gây nên 59 3.3.1 Biểu tổn thương đại thể tổ chức gà thí nghiệm59 3.3.2 Biểu tổn thương vi thể tổ chức gà thí nghiệm 65 3.3.3 Kết xác định khả gây bệnh phôi gà MDV phân lập 68 3.3.4 Kết xác định khả gây bệnh tế bào xơ phôi vịt lớp MDV phân lập 69 3.4 Kết nghiên cứu ảnh hưởng chất tăng cường miễn dịch đến hiệu bảo hộ vắc xin phòng bệnh Marek .71 3.4.1 Kết nghiên cứu ảnh hưởng yếu tố tăng cường miễn dịch hình thành đáp ứng miễn dịch gà thí nghiệm với vắc xin phịng bệnh Marek .73 KẾT LUẬN VÀ ĐỀ NGHỊ 103 Kết luận .103 Kiến nghị .104 TÀI LIỆU THAM KHẢO 105 PHỤ LỤC 118 vi DANH MỤC CÁC TỪ VIẾT TẮT ADC Antibody Dependent Cellmediated ADN Acide Deoxyribo Nucleotic APC Antigen Presenting Cell CAM Chorioat Antoid Membran CEF Chicken Embryo Fibroblast CKC Chicken Kidney Cell CMGF Chicken Myelomonocytic Growth Factor CPE Cytopathogenic Effect CPG-ODN Cytosine Phosphate Guanosine-Olygo Deoxy Nucleotide 10 Poly I:C Chuỗi mạch ARN đôi gồm Polyriboinosinic Polyribocytidylic 11 DEF Duck Embryo Fibroblast 12 DHBV Duck Hepatitis B Virus 13 ELISA Enzyme Linked Immuno Sorbent Assay 14 GDP Gross Domestic Product 15 HVT Herpesvirus of Turkey 16 IFN Interferon 17 IL Interleukin 18 MDV Marek Disease Virus 19 MHC Major Histocompatibility Complex 20 NKC Nature Killer Cell 21 PCR Polymerase Chain Reaction 22 PFU Plaque Forming Unit 23 RIF Resistance Inducing Factor 24 TLR Toll Like Receptor vii DANH MỤC CÁC BẢNG BIỂU Bảng 1.1 Tình hình dịch bệnh Marek tỉnh phía Nam năm 2007 Bảng 3.1 Kết mổ khám gà nghi mắc bệnh Marek số địa phương 40 Bảng 3.2: Mức độ gây bệnh chủng MDV phân lập giống gà thí nghiệm 46 Bảng 3.3: Kết theo dõi triệu chứng lâm sàng bệnh Marek 48 qua tháng theo dõi .48 Bảng 3.4: Mức độ gây bệnh chủng MDV phân lập giống gà độ tuổi 53 Bảng 3.5: Số lượng copy gen Meq bình quân cá thể gà thải ngày (log10) 58 Bảng 3.6: Biểu bệnh tích MDV gây cho gà thí nghiệm 60 Bảng 3.7: Tần suất xuất tổn thương vi thể tổ chức gà thí nghiệm 66 Bảng 3.8: Biểu bệnh tích MDV phơi gà 11 ngày tuổi 69 Bảng 3.9: Biểu bệnh tích MDV 6.13 tế bào xơ phơi vịt .70 Bảng 3.10: Ảnh hưởng yếu tố tăng cường miễn dịch đến hiệu 71 bảo hộ vắc xin phòng bệnh Marek .71 Bảng 3.11: Ảnh hưởng yếu tố tăng cường miễn dịch đến hình thành kháng thể bảo hộ vắc xin phòng bệnh Marek .75 Bảng 3.12: Ảnh hưởng yếu tố tăng cường miễn dịch đến tổng hợp - IFN 78 Bảng 3.13: Ảnh hưởng yếu tố tăng cường miễn dịch đến tổng hợp β - IFN 80 Bảng 3.14: Ảnh hưởng yếu tố tăng cường miễn dịch đến tổng hợp α-IFN 83 Bảng 3.15: Ảnh hưởng yếu tố tăng cường miễn dịch đến tổng hợp IL-4 .86 Bảng 3.16: Ảnh hưởng yếu tố tăng cường miễn dịch .87 đến tổng hợp IL-12p40 87 Bảng 3.17: Ảnh hưởng yếu tố tăng cường miễn dịch đến tổng hợp IL-10 90 Bảng 3.18: Ảnh hưởng yếu tố tăng cường miễn dịch đến hình thành khối u gà sau cơng cường độc (Tỷ lệ % gà có khối u) 92 Bảng 3.19: Mức độ giảm số copy gen Meq lách gà thí nghiệm công cường độc sau sử dụng vắc xin chất tăng cường miễn dịch 94 Bảng 3.20: Mức độ giảm copy gen Meq túi Fabricius gà thí nghiệm cơng cường độc sau sử dụng vắc xin chất tăng cường miễn dịch 97 Bảng 3.21: Mức độ giảm số copy gen Meq tuyến ức gà thí nghiệm cơng cường độc sau sử dụng vắc xin chất tăng cường miễn dịch .100 111 23.Baigent S.J., and Davison T.F (2004), Marek’s disease virus: biology and life cycle In F Davison and V K Nair (Eds.), Marek’s disease: An Evolving Problem (Vol 1, pp: 62 - 77) 24.Baigent S.J., Petherbrige L.J., Howes K., Smith L.P., Currie R.J.W & Nair V (2005), Absolute quantitation of Marek’s disease virus genome copy number in chicken feather and lymphocyte samples using real - time PCR Jour Virol Methods, 123: 53 - 64 25.Baigent S.J., Smith L.P., Nair V.K., and Currie R.J (2006), Vaccinal control of Marek's disease: Current challenges and future strategies to maximize protection Veterinary Immunology and Immunopathology, 112: 78 - 86 26.Barrow A.D., Burgess S.C., Baigent S.J., Howes K., Nair V.K (2003), Infection of macrophages by a lymphotropic herpesvirus: a new tropism for Marrek’s disease virus Jour Gen Virol 10: 1636 27.Beasley J N., Patterson L.T., and McWade D H (1970), Transmission of Marek’s disease by poultry house dust and chicken dander Avian Dis., 14: 45 - 53 28.Beckey Y., Asher Y., Tabor E., Davison I., Malkinson M & Weisman Y (1992), Polymerase chain reaction for differentiation between pathogenic and non - pathogenic serotype Marek’s disease virus (MDV) and vaccine viruses of MDV - serotypes and Jour Virol Methods, 40 307 - 322 29.Biggs P.M., Purchase H.G., Bee B.R., Dalton P.J (1965), Preliminary report on acute Marek's disease (fowl paralysis) in Great Britain Vet Rec 6; 77(45): 1.339 - 1.340 30.Biggs P.M., Thorpe R.J and Payne L.N (1968), Studies on genetic resistance to Marek’ disease in the dometic chicken, Brit Poult Sci., 9: 37 - 52 31.Brewer R.N., Reid W.M., Johnson J., Schmittle S C (1969), Studies on the acute Marek’s disease VIII The role of mosquitoes in transmission under experimental conditions Avian Diseases, 13: 83 - 88 32.Budiani D.R., Hutahaean S., Haryana S.M (2002), Interleukin-10 levels in EpsteinBarr virus-associated nasopharyngeal carcinoma Jour Micro Immuno Infect, 35 (4), pp 265 33.Bulow V.V (1971), Diagnosis and Certain Biological Properties of the Virus of Marek's Disease Am Jour Vet Res., 32: 1.270 - 1.275 112 34.Bumstead N., Sillibourne J., Rennie M., Ross N & Davison F (1997), Quantification of Marek’s disease virus in chicken lymphocytes using the polymerase chain reaction with fluorescence detection Jour Virol Methods, 65, 75 - 81 35.Burgess S.C and Davison T.F (2002), Identification of the neoplastically transformed cells in Marek’s disease herpesvirus-induced lymphomas: recognition by the monoclonal antibody AV37, Journal of Virology, 76: 7.276 - 7.292 36.Buscaglia C., Calnek B.W & Schat K.A (1988), Effect of immunocompetence on the establishment and maintenance of latency with Marek's disease herpesvirus, Journal of General Virology, 69: 1.067 - 1.077 37.Buza J.J and Burgess S.C (2007), Modeling the proteome of a Marek’s disease transformed cell line: a natural animal model for CD30 overexpressing lymphomas, Proteomics, 7: 1.316 - 1.326 38.Calnek B W (1986), Marek’s disease-a model for herpesvirus oncology, Critical Reviews in Microbiology, 12: 293 - 320 39.Calnek B.W., Hitchner S.B & Adldinger H K (1970), Lyophilization of cell free Marek’s disease herpesvirus and a herpesvirus from turkeys Appl Microbiol., 20: 723 - 726 40.Calnek, B.W (2001), Pathogenesis of Marek’s Disease virus infection Current Topics in microbiology and immunology, 255, pag 25 - 55 Berlin, Heidel berg, New York: Springer - Verlag 41.Cantello J.L., Anderson A.S and Morgan R.W (1994), Identification of latency associated transcripts that map antisense to the ICP4 homolog gene of Marek’s disease virus Journal of Virology, 68: 6.280 - 6.290 42.Cantello J.L., Parcells M.S., Anderson A.S and Morgan R.W (1997), Marek’s disease virus latency - associated transcripts belong to a family of spliced RNAs that are antisense to the ICP4 homolog gene Journal of Virology, 71: 1.353 - 1.361 43.Cebrian J., Kaschka Dierich C., Berthelot N & Sheldrick P (1982), Inverted repeat nucleotide sequences in the genomes of Marek disease virus and the herpesvirus of the turkey Proceedings of the National Academy of Sciences, USA, 79: 555 - 558 113 44.Charles E Samuel (2001), Antiviral Actions of Interferon, Clinical Microbiology Reviews, Vol.14, No.4, P 778 - 809 45 Christian B., Gan Z., Folkert S., Takeshi K., and Dennis M.K (2011), CpG ADN as a vaccine adjuvant Expert Rev Vaccines, Apr 10(4): 499 - 511 46.Churchill A.E., Payne L.N., and Chubb R.C (1967), Immunization against Marek's disease using a live attenuated virus Nature, 211: 744 - 747 47.Cole R.K (1968) Studies on Genetic Resistance to Marek's Disease Avian Diseases, Vol 12, No 1, pag - 28 48.Cole R.K (1966), Genetic resistance to J.M leukosis virus Poultry Science, 45: 1.077 49.Davidson I and Borenshtain R (2002), The feather tips of commercial chickens are a favourable source of ADN for the amplification of MDV and ALV Jour Avian Pathol., 31: 237 - 240 50 Davidson I.L, Raibshtein I, Al Touri A (2013), Quantitation of Marek's disease and chicken anemia viruses in organs of experimentally infected chickens and commercial chickens by multiplex real-time PCR Avian Dis. 57 (2 Suppl): 532-8 51.Djeraba A., Musset E., Bernardet N., Le Vern Y., and Quere P (2002), Similar pattern of iNOS expression, NO production and Cytokine response in genetic and vaccination-acquired resistance to Marek’s disease Veterinary Immunology and Immunopathology, 85: 63 - 75 52 Dunn JR (2014), Correlation between Marek's disease virus pathotype and replication Avian Dis. 58(2): 287-92 53.Faiz NM (2016), Early infection with Marek's disease virus can jeopardize protection conferred by laryngotracheitis vaccines: a method to study MDVinduced immunosuppression Avian Pathol 4: 1-10 54 Faiz NM (2016), Efficacy of various Marek's disease vaccines protocols for prevention of Marek's disease virus-induced immunosuppression Vaccine. 29; 34 55.Geerligs H (2013), Efficacy and safety of cell-associated vaccines against Marek's disease virus grown in QT35 cells or JBJ-1 cells Avian Dis. 57 (2 Suppl): 448-53 114 56.Gimeno I.M (2008), Marek’s disease vaccines: a solution for today but a worry for tomorrow Vaccine, 26 Suppl 3, C31 - 41 57 Gimeno M.A (2012), Standardization of a model to study revaccination against Marek's disease under laboratory conditions Avian Pathol. 41(1): 59-68 58.Gomis S., Babiuk I., Allan B., Willsion P., Waters E., Ambrose N (2004), Protection of neonatal chicks against a lethal challenge of Escherichia coli using ADN containing cytosine - phosphodiester guanine motif Avian Dis: 48(4): 813 - 22 59.Gong C., Xin Z., Weiyao Y., Weifeng Y., Xiaopin Z., Kai H., Yang L., Jie C., Jialong W., Wei C., Mingqiu L., Huanhe G., Jiulian C., Yonggan L and Zhaoxin Z (2007), Alpha interferon is a powerful adjuvant for a recombinant protein vaccine against foot - and - mouth disease virus in swine, and an effective stimulus of in vivo immune response Vaccine, Vol 25, Issue 28, Pag 5.199 - 5.208 60.Haiqi H., Kenneth J Genovesea C.L Swaggertya K.M., Mac Kinnonb, Michael H.K (2012), Co - stimulation with TLR3 and TLR21 ligands synergistically up - regulates Th1 - Cytokine IFN - c and regulatory Cytokine IL - 10 expression in chicken monocytes Develop and Comparative Immunology 36:756 - 760 61.Haq K., Brisbin J.T., Thanthrige D.N., Heidari M., and Sharif S (2010), Tran scriptome and proteome profiling of host responses to Marek’s disease virus in chickens Veterinary Immunology and Immunopathology 138: 292 - 302 62.Haq K., Schat K.A., Sharif S (2013), Immunity to Marek’s disease: when are we now Dev Comp Immunol 41(3):.439 - 46 63.Http://www.oie.int (2015) 64.Ionica F., Coman M (2009), An outbreak of Marek’s disease in Broiler chickens: epidemiological, clinical and anatomopathological aspects Lucrari Stintifice Medicin Veterinar, Vol XLII (1) 65.Islam A., Harrison B., Cheetham B.F., Mahony T.J., Young P.L & Walkden Brown S.W (2004), Differential amplification and quantitation of Marek’s disease viruses using real - time polymerase chain reaction Jour Virol Methods, 119 (2), 103 - 113 115 66 Jarosinski K.W., Jia W., Sekellick M.J., Marcus P.I., Schat K.A (2001), Cellular responses in chickens treated with IFN - alpha orally or inoculated with recombinant Marek's disease virus expressing IFN - alpha Jour Interferon Cytokine Res., 21(5): 287 - 296 67.Joseph M Cummins, Steven G Krakowka and Chad G.T (2005), Systemic effects of interferons after oral administration in animals and humans Am Jour Vet Resear., Vol 66, No.1 68 Juanita M.M., Catherine H., Giorgio T (1998), Role of Interleukin - 12 in Primary Influenza Virus Infection Jour Virol, vol 72, No 64: 425 - 483 69.Kaiser P., Underwood G and Davison F (2003), Differendtial Cytokine responses following Marek’s disease virus infection of chickens differing in resistance to Marek’s disease Jour Virol, 77: 762 - 768 70.Kanji Hirai (2001), Marek’s Disease Virology Journal, BioMed Central, vol 68, No 55: 365 - 380 71.Kano R., Konnai S., Onuma M and Ohashi K (2009), Cytokine profiles in chickens infected with virulent and avirulent Marek’s disease viruses: interferon - gamma is a key factor in the protection of Marek's disease by vaccination Jour Microbiology and Immunology, 53: 224 - 232 72.Karaca G., Anobile J., Downs D (2004), Herpesvirus of turkeys: microarray analysis of host gene responses to infection Virology, 318: 102 - 111 73.Katherine E (2015), Modelling Marek's Disease Virus (MDV) infection: parameter estimates for mortality rate and infectiousness Licensee Bio Med Central Ltd 74.Katz D and Kohn A (1971), Isolation and identification of Marek's disease herpesvirus by yolk sac inoculation method Avian Dis 15: 187 - 198 75.Kennedy D.A., Dunn J.R., Dunn P.A & Read A.F (2015) An observational study of the temporal and spatial patterns of Marek's-disease-associated leukosis condemnation of young chickens in the United States of America Prev Vet Med 120: 328-335 76.Kottaridis S.D., Luginbuhl R.E & Fredrickson T.N (1968), Marek’s disease Propagation of the Connecticut - A isolate in cell culture Avian Diseases, 12: 246 - 258 116 77.Laurent Hunt H D and Cheng H H (2001), Genetic Resistance to Marek’s Disease Current Topics in Microbiology and Immunology, 255: 121 - 141 78.Lee L.F., Kreager K.S., Arango J., Paraguassu A., Beckman B., Zhang H., Fadly A.M., Lupiani B & Reddy S.M (2010), Comparative evaluation of vaccine efficacy of recombinant Marek’s disease virus vaccine lacking Meq oncogene in commercial chickens, Vaccine, 28: 1.294 - 1.299 79.Levy A.M., Gilad O., Xia L., Izumiya Y., Choi J., Tsalenko A., Yakhini Z., Witter R., Lee L., Cardona C.J and Kung H.J (2005), Marek’s disease virus Meq transforms chicken cells via the v-Jun transcriptional cascade: a converging transforming pathway for avian oncoviruses Proceedings of the National Academy of Sciences of the United States of America, 102: 14.831 - 14.836 80.Lobago F., Woldemeskel M (2014), An outbreak of Marek's disease in chickens in central Ethiopia Trop Ani Health Prod 36 (4): 397 - 406 81.Long J.E., Huang L.N., Qin Z.Q., Wang W.Y and Qu D (2005), IFN - gamma increases efficiency of ADN vaccine inprotecting ducks against infection World Journal of Gastroentorology, 11: 4.967 - 4.973 82.Lupiani B., Lee L.F and Reddy S.M (2001), Protein coding content of the sequence of Marek’s disease virus serotype Current Topics in Microbiology and Immunology, 255: 159 - 190 83.Mikami T, Bankowski R.A (1970), Plaque types and cell - free virus from tissue cultures infected with Cal-1 strain of herpesvirus associated with Marek's disease Jour N Cancer Inst., 45(2): 319 - 33 84.Mimeno I.M (2008), Marek’s disease vaccine: a solution for today but a worry for tomorrous Vaccine, 26 (Suppl 3): C31 - 41 85.Moran T.M., Isobe H., Fernandez S.A and Schulman J.L (1996), Interleukin causes delayed virus clearance in influenza virus - infected mice Jour Virol ; 70(8): 5.230 - 5.235 86.Morgan R.W., Sofer L., Anderson A., Bernberg E., Cui J., Burnside J (2001), Induction of host gene expression following infection of chicken embryo fibroblasts with oncogenic Marek’s disease virus Jour of Virology, 75: 533 - 539 117 87.Moriguchi R., Yoshida H., Fujimoto Y., Mikami T and Izawa H (1987), Feather pulp lesions in chickens with naturally occurring Marek’s disease lymphomas Avian Diseases, 31: 156 - 168 88.Mosleuddin and Dewan M.L (1974), Incidence and diagnosis of Marek’s disease in two poultry farms of Bangladesh Bangl Vet Jour , 8: 45 - 48 89.Omar A.R., Schat K.A., Lee L.F., Hunt H.D (1998), Cytotoxic T lymphocyte response in chickens immunized with a recombinant fowlpox virus expressing Marek’s disease herpesvirus glycoprotein B Vet, Immunol Immunopathol, 62, 73 - 82 90.Osterrieder N., Kamil J.P., Schumacher D., Tischer B.K., Trapp S (2006), Marek's disease virus: from miasma to model, Nat Rev., Microbiol, (4), 283 - 294 91.Paludan S.R., Bowie A.G., Horan K.A and Fitzgerald K.A (2011), Recognition of herpesviruses by the innate immune system, Nature Reviews Immunology, 11: 143 - 154 92.Parcells M.S, Lin S.F., Dienglewicz R.L., Majerciak V., Robinson D.R., Chen H.C., Wu Z (2001), Marek’s disease virus (MDV) encodes an interleukin - homolog (vIL - 8): characterization of the vIL - protein and a vIL - deletion mutant MDV, Journal of Virology, 75: 5159 - 5173 93.Parcells Mark S., Arumugaswami V., Prigge J T., Pandya K., and Dienglewicz R.L (2003), Marek’s disease virus reactivation from latency: changes in gene expression at the origin of replication, Poultry Science, 82: 893 - 898 94.Park J.H., Sung H.W., Yoon B.I and Kwon H.M (2009), Protection of chicken against very virulent IBDV provided by in ovo priming with ADN vaccine and boosting with killed vaccine and the adjuvant effects of plasmid encoded chicken interleukin - and interferon - gamma Journal of Veterinary Science, 10: 131 - 139 95 Parvizi P., Mallick A.I., Haq K., Haghighi H.R., Orouji S., Thanthrige D.N., Paul M., Brisbin J.T., Read L.R., Behboudi S., Sharif S (2012), A toll like receptor ligand enhances protective effects of vaccination against Marek's disease virus and hinders tumor development in chickens Viral Immunol, 25(5): 394 - 401 118 96.Payne L.N., Frazier J.A., and Powell P.C (1976), Pathogenesis of Marek’s disease Int Rev Exp Pathol., 16: 59 - 154 97.Payvand P., Mohamed F., Abdul C., Amirul I.M., Kamran H., Hamid R.H., Shahriar O., Mohammad H., Shahriar B (2014), The effects of administration of ligands for Toll - like receptor and 21 against Marek’s disease in chickens, Vaccine, 32: 1.932 - 1.938 98.Purchase H (1971) Effect of vaccination with herpesvirus of turkey (HVT) on horizontal spread of Marek’disease herpes virus Avian Dis., 15: 391 - 397 99.Quéré P., Rivas C., Ester K., Novak R and Ragland W.L (2005), Abundance of IFN-alpha and IFN-gamma mRNA in blood of resistant and susceptible chickens infected with Marek’s disease virus (MDV) or vaccinated with turkey herpesvirus; and MDV inhibition of subsequent induction of IFN gene transcription Archives of Virology, 150: 507 - 519 100 Schat K.A and Baranowski E (2007), Animal vaccination and the evolution of viral pathogens Revue Scientifique et Technique, 26: 327 - 338 101 Schat K.A., Calnek B.W and Fabricant J (1982), Characterisation of two highly oncogenic strains of Marek;s disease virus Avian Pathol 11: 593 - 605 102 Schat K.A & Nair V (2008), Marek’s disease In: Diseases of Poultry 12th Edition, Blackwell Publishing, Ames Iowa, USA, 452 - 514 103 Sevoian M and Chamberlain D.M (1963), Avian lymphomatosis III Incidence and manifestations in experimentally infected chickens of various ages Avian Disease 7: 97 - 102 104 Sevoian M., Chamberlain D., Larose R.H (1962), Avian lymphomatosis Experimantal reproduction of the neural and visceral forms, Vet Med, 57: 500 - 50 105 Sevoian M., Chamberlain D.H and Counter F.T (1972), Avian lymphomatosis I Experimental reproduction of the neural and visceral forms Veterinary Medicine, 57: 500 - 50 106 Sharma J.M and Coulson B.D (1977), Cell - mediated cytotoxic response to cells bearing Marek's disease tumor - associated surface antigen in chickens infected with Marek's disease virus Journal of the National Cancer Institute, 58:1647 - 1651 119 107 Solomon J.J., Witter R.L., Nazerian K & Burmester B.R (1968), Studies on the etiology of Marek’s disease I Propagation of the agent in cell culture Proceedings of the Society of Experimental Biology and Medicine, 127, 173 - 177 108 Spencer J.L & Calnek B.W (1970), Marek’s disease: application of immunofluorescence for detection of antigen and antibody Am Jour Vet Res., 31, 345 - 58 109 St Paul M, Paolucci S, Read LR, Sharif S (2012), Characterization of responses elicited by Toll - like receptor agonist in cells of the bursa of Fabricius in chickens Vet Immunol Immunopathol: 149 (3 - 4): 237 - 44 110 Takeshi I., Izumi W., Satoshi I., Hideki F., Masami M., Shinichi T., Hidehiro T., Hirofumi S., Joe C., Takeshi K., Tetsutaro S and Hideki H (2005), Synthetic Double - Stranded R 111 NA, PolyI:C Combined with Mucosal Vaccine Protects against Influenza Virus Infection Jour Virol., Vol 79, No 5, 2.910 - 2.919 112 Therwa H., John B.B and Bingyun L (2010), Interleukin 12 a Key Immunoregulatory Cytokine in Infection Applications Int Jour Mol Sci., 11: 789 - 806 113 Tian M., Zhao Y., Lin Y., Zou N., Liu C., Liu P., Cao S., Wen X., & Huang Y (2011) Comparative analysis of oncogenic genes revealed unique evolutionary features ò field Marek’s disease virus prevalent in recent years in China Virol Jour., 8: 121 114 Tovey M.G and Lallemand C (2010), Adjuvant activity of Cytokines Methods in Molecular Biology, 626: 287 - 309 115 Tovey M.G., Bloch F., Launay O., Guillet J.G., Lebon P., Lallemand C., Meritet J.F., Maury C (2006), Adjuvant activity of interferon alpha in influenza vaccination Host defence in Eur Cytokine Netw., Vol.17, Special Issue “Cytokine 2006”, 124 - 132 116 Ulf Dittmer, Karin E.P., Ron M., Ingunn M.S., Brent R and Kim J.H (2001), Role of Interleukin - (IL - 4), IL - 12, and Gamma Interferon in Primary and Vaccine-Primed Immune Responses to Friend Retrovirus Infection Jour Virol. Vol 75 2; 654 - 660 120 117 Vindel J.A (1964), Cytochemistry of neurolymphomatosis virus reproduction invitro Nat Cancer Inst Mono 17: 147 - 157 118 Volpini L.M., Calnek B.W., Sekellick M.J and Marcus P.I (1995), Stages of Marek’s disease virus latency defined by variable sensitivity to interferon modulation of viral antigen expression Vet Microbiol 47: 99 - 109 119 Von Bulow V (1977), Further characterization of the CVI988 strain of Marek’s disease virus Avian Pathology, 6: 394 - 403 120 Whitmire J.K., Tan J.T., Whitton J.L (2005), Interferon - gamma acts directly on CD8+ T cells to increase their abundance during virus infection Jour Exp Med 201: 1.053 - 1.059 121 Witter R.L (1983), Characteristics of Marek disease viruses isolated from vaccinated commercial chicken flocks: association of viral pathotype with lymphoma frequency Avian Dis 27:.113 - 132 122 Witter R L (2001), Protective efficacy of Marek’s disease vaccines In K Hirai (Ed.), Marek’s Disease, Vol 1, pp 57 - 91 123 Witter R.L and Lee L.F (1984), Polyvalent Marek’s disease vaccines: safety, efficacy and protective synergism in chickens with maternal antibodies Avian Pathol., 13: 75 - 92 124 Witter R.L and Schat K.A (2003), Marek’s disease In Y M Saif (Ed.), Diseases of Poultry Pag: 407 - 467 125 Witter R.L., Nazerian K., Purchase H.G & Burgoyne G.H (1970), Isolation from turkeys of a cell - associated herpesvirus antigenically related to Marek's disease virus American Journal of Veterinary Research, 31: 525 - 538 126 Witter R.L., Solomon J.J.,Champion L.R and Nazerian K (1971), Long term studies of Marek’ disease infection in individual chickens Avian Disease 15: 346 - 365 127 Woźniakowski G1, Samorek Salamonowicz E (2014) Direct detection of Marek's disease virus in poultry dust by loop-mediated isothermal amplification Arch Virol. 159(11): 3.083 128 Xing Z., Schat K.A (2001), Inhibitory effects of nitric oxide and gamma interferon on invitro and in vivo replication of Marek’s disease virus Jour Virol., 74 (8): 3605 - 12 121 129 Xinyu Z., Haitao Z., Huoying S., Hongxia S., Jianqiang Y., Ji M., Genghua W., and Aijian Q (2015), Outbreak of Marek’s disease in a vaccinated broiler breeding flock during its peak egg - laying period in China BMC Vet Res 11: 157 130 Zanella A & Granelli G (1974) Marek's disease control: comparative efficacy of cell-associated and cell-free lyophilized HVT vaccine Avian Pathol., 3: 45-50 131 Zelnik V.L., Harlin O., Fehler F., Kaspers B., Göbel T.W., Nair V.K., Osterrieder N (2004), An enzyme-linked immunosorbent assay (ELISA) for detection of Marek's disease virus-specific antibodies and its application in an experimental vaccine trial Jour Vet Med B Infect Dis Vet Public Health. 51(2): 61-70 132 Zhenhua G.E., Lijuan Z., Jianlin W., Linlin C., Hu S., Zhiliang W and Hongchao M (2013), Isolation and analysis of a very virulent Marek’s disease virus strain in China Virology Journal, 10: 155 122 PHỤ LỤC SO SÁNH ĐỘ TƯƠNG ĐỒNG CỦA ĐOẠN GEN GIẢI TRÌNH TỰ VỚI GEN Meq CỦA GALLID HERPESVIRUS Gallid herpesvirus isolate MDJ/1212 MEQ gene, complete cds Sequence ID: gb|KP888857.1|Length: 1020Number of Matches: Related Information Range 1: to 174GenBankGraphics Next Match Previous Match First Match Alignment statistics for match #1 Score 311 bits(168) Expect Identities 2e - 80() 171/172(99%) Gaps 1/172(0%) Strand Frame Plus/Plus Features: Query 25 GTCTCAGGAGCCAGAGCCGGGCGCTATGCCCTACAGTCCCGCTGACGATCCGTCCCCC CT 84 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct GTCTCAGGAGCCAGAGCCGGGCGCTATGCCCTACAGTCCCGCTGACGATCCGTCCCCC CT 62 Query 85 CGATCTTT TCTCGGGTCGACTTCGAGACGGaaaaaaaGGAAAAGTCACGACATCCCCAA 143 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 63 CGATCTTTCTCTCGGGTCGACTTCGAGACGGAAAAAAAGGAAAAGTCACGACATCCCC AA 122 Query 144 CAGCCCCTCCAAACACCCCTTCCCTGACGGCCTATCTGAGGAGGAGAAACAG 195 |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 123 CAGCCCCTCCAAACACCCCTTCCCTGACGGCCTATCTGAGGAGGAGAAACAG 174 Range 2: 178 to 1020 GenBankGraphics Next Match Previous Match First Match Alignment statistics for match #2 Score 1339 bits(725) Expect 0.0() Identities 833/877(95%) Gaps 40/877(4%) Strand Plus/Plus Frame 123 Features: Query 230 CTGGAAAGGAGGAGAAAAAGGAATCGTGACGCCGCTCGGAGAAGACGCAGGGA CAGACG 288 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 178 CTGGAAAGGAGGAGAAAAAGGAATCGTGACGCCGCTCGGAGAAGACGCAGGGAGCA GACG 237 Query 289 TACTATGTAGACAAACTCCATGAAGCATGTGAAGAGCTTGGTGGTTTCGCAGAGGGCC AA 348 |||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct 238 TACTATGTAGACAAACTCCATGAAGCATGTGAAGAGCT - - - - - - - - - GCAGAGGGCCAA 287 Query 349 TGAACACCTACGTAAGGAAATTCGAGATCTAAGGACTGAGTGTTTGTCCCTGCGTGCA CA 408 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 288 TGAACACCTACGTAAGGAAATTCGAGATCTAAGGACTGAGTGCACGTCCCTGCGTGCA CA 347 Query 409 GTTGGCTTGTCATGAGCCAGTTTGCCCTATGGCGGTACCCCTAACGGTGACCCTTGGAC T 468 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 348 GTTGGCTTGTCATGAGCCAGTTTGCCCTATGGCGGTACCCCTAACGGTGACCCTTGGAC T 407 Query 469 GCTTACCGCCACATCCGGCCCCGCACGATCCCGTTCCTGAACCTCCCATTTGCACTCCT C 528 ||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct 408 GCTTACC - - - - - - - - - GCCCCGCACGATCCCGTTCCTGAACCTCCCATTTGCACTCCTC 457 124 Query 529 CACCTCCCTCACCGGATGAACCTAACGCTCCACATTGCTCCGGTTCCCAACCTCCTATC T 588 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 458 CACCTCCCTCACCGGATGAACCTAACGCTCCACATTGCTCCGGTTCCCAACCTCCTATC T 517 Query 589 GTACCCCCCGTCCTCCCGATACGGAGGAACTTT CGCCCAGCTCTGCTCGACCCCACCAC 647 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct 518 GTACCCCCCGTCCTCCCGATACGGAGGAACTTTGCGCCCAGCTCTGCTCGACCCCACC AC 577 Query 648 CTCCCATCTCTACTCCCCATATTATCTACGCTCCGGGGCCTTCCCCCCTCCAACCTCCTA 707 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 578 CTCCCATCTCTACTCCCCATATTATCTACGCTCCGGGGCCTTCCCCCCTCCAACCTCCTA 637 Query 708 TCTGTACCCCCGCCACGTCCTCCCGATGCGGAGGAGC - - - CGCCCAGCTCTGCTCGACC 763 ||||||||||||| |||||||||||||||||||| ||||||||||||||||||| Sbjct 638 TCTGTACCCCCGC - - - TCCTCCCGATGCGGAGGAGCTTTGCGCCCAGCTCTGCTCGACC 693 Query 764 CCACCACCTCCCATCTGTACTCCCCATTCCCTCTTCTGCCCTCCCCAGCCTCCATCTCCC 823 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 694 CCACCACCTCCCATCTGTACTCCCCATTCCCTCTTCTGCCCTCCCCAGCCTCCATCT - - 750 Query 824 TTTTTACCCGGAGGGCATCTTCCCTGCATTGTGTCCTGTTACCGAGCCGTGTACCCCTC C 883 ||||||||||||||||||||||||||||||||||||||||||||||||||||| 125 Sbjct 751 - - - - - - CCGGAGGGCATCTTCCCTGCATTGTGTCCTGTTACCGAGCCGTGTACCCCTCC 803 Query 884 ATCGCCGGGGACGGTTTACGCTCAGCTTTGTCCTGTTGGCCAGGCTCCCCTTTTTACCC C 943 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 804 ATCGCCGGGGACGGTTTACGCTCAGCTTTGTCCTGTTGGCCAGGCTCCCCTTTTTACCC C 863 Query 944 ATCTCCCCCACATCCGGCTCCGGAGCCGGAGAGGCTTTATGCTCGTCTTACCGAGGAT CC 1003 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 864 ATCTCCCCCACATCCGGCTCCGGAGCCGGAGAGGCTTTATGCTCGTCTTACCGAGGAT CC 923 Query 1004 CGAACAGGATTCCTTGTATTCGGGCCAGATTTATATTCAGTTTCCCTAGGATACTCAGT C 1063 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct 924 CGAACAGGATTCCTTGTATTCGGGCCAGATTTATATTCAGTTTCCCTCGGATACTCAGT C 983 Query 1064 TACGGTCTGGTGGTTTCCAGGTGACGGGAGACCCTGA 1100 ||||||||||||||||||||||||||||||||||||| Sbjct 984 TACGGTCTGGTGGTTTCCAGGTGACGGGAGACCCTGA 1020 ... NGHIÊN CỨU MỘT SỐ ĐẶC TÍNH CỦA VIRUS GÂY BỆNH MAREK Ở GÀ NI CƠNG NGHIỆP TẠI PHÍA BẮC VIỆT NAM VÀ GIẢI PHÁP NÂNG CAO HIỆU LỰC VẮC XIN PHÒNG BỆNH Ngành: Ký sinh trùng Vi sinh vật học thú y Mã số: ... định số đặc tính virus gây bệnh Marek đàn gà nuôi công nghiệp tiêm vắc xin phòng bệnh Marek có biểu mắc bệnh số tỉnh phía Bắc Việt Nam Đánh giá khả gây bệnh, đặc điểm gây bệnh lý chủng virus. .. có sở khoa học thực tiễn cho ứng dụng này, tiến hành đề tài: ? ?Nghiên cứu số đặc tính virus gây bệnh Marek gà nuôi công nghiệp phía Bắc Việt Nam giải pháp nâng cao hiệu lực vắc xin phòng bệnh? ??