Báo cáo khoa học: Sin3 is involved in cell size control at Start in Saccharomyces cerevisiae Octavian Stephan and Christian Koch ppt

Sin3 is involved in cell size control at Start in Saccharomyces cerevisiae Octavian Stephan and Christian Koch Department of Biology, Friedrich-Alexander-University Erlangen-Nurnberg, Germany ă Keywords G1 cyclins; histone deacetylase; Rpd3; Swi4; Swi6 Correspondence C Koch, Department of Biology, Chair for Biochemistry, Friedrich-Alexander-University Erlangen-Nurnberg, Staudtstr 5, 91058 ă Erlangen, Germany Fax: +49 9131 8528254 Tel: +49 9131 8528257 E-mail: ckoch@biologie.uni-erlangen.de (Received 21 February 2009, revised May 2009, accepted 13 May 2009) doi:10.1111/j.1742-4658.2009.07095.x Saccharomyces cerevisiae cells control their cell size at a point in late G1 called Start Here, we describe a negative role for the Sin3 ⁄ Rpd3 histone deacetylase complex in the regulation of cell size at Start Initiation of G1 ⁄ S-specific transcription of CLN1, CLN2 and PCL1 in a sin3D strain occurs at a reduced cell size compared with a wild-type strain In addition, inactivation of the transcriptional regulator SIN3 partially suppressed a cln3D mutant, causing sin3Dcln3D double mutants to start the cell cycle at wild-type size Chromatin immunoprecipitation results demonstrate that Sin3 and Rpd3 are recruited to promoters of SBF (Swi4 ⁄ Swi6)-regulated genes, and reveal that binding of Sin3 to SBF-specific promoters is cellcycle regulated We observe that transcriptional repression of SBF-dependent genes in early G1 coincides with the recruitment of Sin3 to specific promoters, whereas binding of Sin3 is abolished from Swi4 ⁄ Swi6-regulated promoters when transcription is activated at the G1 to S phase transition We conclude that the Sin3 ⁄ Rpd3 histone deacetylase complex helps to prevent premature activation of the S phase in daughter cells Introduction Most eucaryotic cells regulate their commitment to cell division at the G1 to S phase transition In the budding yeast Saccharomyces cerevisiae, the events in late G1 leading to S-phase entry are collectively referred to as ‘Start’ [1–3] During the G1 phase, yeast cells monitor their size and ensure that they have reached a sufficiently large size for entry into the mitotic cell cycle One of the earliest events occurring as cells pass through Start is the transcriptional activation of a large set of G1 ⁄ S-specific genes including the G1 cyclins CLN1 and CLN2 and S-phase regulators [4–6] Cln1 and Cln2 with their associated cyclin-dependent kinase Cdc28 (CDK1) activate the subsequent steps, leading to the accumulation of Clb5 ⁄ 6–CDK1 activity, DNA synthesis, budding and spindle pole body duplication The periodic expression of G1 ⁄ S-specific RNAs depends on the two transcription factor complexes SBF (Swi4 ⁄ Swi6) and MBF (Mbp1 ⁄ Swi6) which share the common subunit Swi6 but contain different DNA- binding proteins [7–9] Swi4 recognizes short cis-acting sequences called Swi4 ⁄ cell-cycle box (SCB) elements originally identified in the HO promoter, whereas Mbp1 binds to MluI cell-cycle box (MCB) elements found in many S-phase genes, including cyclins CLB5 and CLB6 [7,10–12] Genes regulated by SBF include the G1 cyclins CLN1, CLN2 and PCL1 [13,14] The timing of CLN1 and CLN2 transcription is of particular importance for the control of cell size because their ectopic expression leads to early entry into the S phase [3,15] Inactivation of SWI4 causes a defect in Startspecific transcription resulting in abnormally large cells with problems in morphogenesis [13,14,16] Different cyclins are responsible for regulating G1 ⁄ S-specific transcription Whereas repression in G2 is caused by Clb1–4 ⁄ CDK1 activity and leads to the dissociation of Swi4 ⁄ Swi6 (SBF) from the promoter, activation in late G1 requires Cln3 ⁄ CDK1 activity [3,15,17–19] Abbreviations CDK, cyclin-dependent kinase; ChIP, chromatin immunoprecipitation; MCB, MluI cell cycle box; SCB, Swi4 ⁄ cell cycle box 3810 FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS O Stephan and C Koch In early G1, SBF is already bound to the promoter but does not activate transcription [18,19] This inactivity is largely because of binding of the Whi5 repressor to SBF [20,21] Whi5 is thought to be the key target for the Cln3 ⁄ CDK Phosphorylation of Whi5 leads to its dissociation from SBF and its subsequent export from the nucleus [20,21] This mode of regulation is strikingly similar to the activation of metazoan E2F transcription factors by cyclin D ⁄ Cdk4, which phosphorylates and thereby inactivates the Rb repressor before S phase [22] In yeast, the G1 cyclin Cln3 is the key regulator that integrates signals about cell size and growth rate to promote cell-cycle progression at Start [1,2,23] Differences in Cln3 protein levels and stability have a profound influence on cell size at Start Activated alleles of CLN3 lead to smaller cells, whereas a cln3D mutant, although viable, enters the S phase at a larger cell size [2] Consistent with a function as a repressor and important target for Cln3 ⁄ CDK activity, inactivation of WHI5 advances cell-cycle entry and largely bypasses the requirement for CLN3 [20,21] Studies at the HO promoter have shown that CDK activation in late G1 is important for polymerase recruitment, whereas recruitment of Srb ⁄ mediator complex by SBF occurs prior to CDK activation [24,25] A number of additional regulators were shown to affect the amount and timing of G1 ⁄ S-specific transcription These include, in particular, BCK2, which becomes essential in the absence of CLN3 [26], CCR4 [27], XBP1 [28], MSA1 [29], NRM1 [30] and STB1 [31] Despite their similar architecture, SBF and MBF are not identically regulated For example, the corepressor Nrm1 specifically regulates MBF target genes [30] STB1 was reported to have different effects on MBF- and SBF-regulated genes although it binds to the common subunit Swi6 [31] Deletion of STB1 in a cln3D strain caused a delay in G1 ⁄ S transcription and the accumulation of large unbudded G1 cells [32] suggesting that Stb1 may act as an activator Further experiments showed that the interaction of Stb1 with Swi6 is abolished upon phosphorylation of Stb1 through Cln–Cdc28 kinase complexes [32,33] Earlier studies suggested that Stb1 may specifically act on MCB elements [31], whereas recent chromatin immunoprecipitation (ChIP) assays provided evidence that Stb1 is recruited to both SCB and MCB elements in the G1 phase [33] Stb1 was originally found to interact with the transcriptional corepressor Sin3 in a two-hybrid assay [34] Recent analysis of G1specific mRNA levels in stb1D and sin3D mutants suggested a role for Sin3 and Stb1 in regulating these genes [33] Sin3 and its associated histone deacetylase Rpd3 act together in large multiprotein complexes on tran- Sin3 involvement in cell size control scriptional repression of many genes [35–39] Through interaction with DNA-binding proteins, Sin3 recruits the deacetylase Rpd3 to specific promoters In particular, the DNA-binding protein Ume6 was shown to recruit Sin3 and Rpd3 deacetylase activity to genes involved in phospholipid biosynthesis, meiosis and sporulation [37,40–43] Genome-wide acetylation studies [44] and genome-wide binding studies for Rpd3 [39] showed that genes involved in cell growth and cell-cycle control, including the G1-specific gene PCL1, are targeted by the Rpd3 deacetylase In this study, we uncover a role for Sin3 and its associated histone deacetylase Rpd3 in cell size homeostasis at the Start of the cell cycle We find that SIN3 represses SBF-dependent transcription in early G1 and show that Sin3 is bound to promoters in G1 and released around the onset of Start transcription We conclude that Sin3 is important for the correct timing of SBF-dependent transcription in G1 Results Sin3 represses SBF-dependent transcription Mutations that accelerate cell division relative to cell growth lead to a reduced cell size at Start [45] The timing of Start is mostly determined by the initiation of G1 ⁄ S-specific cyclin transcription Activated alleles of the regulator CLN3 lead to smaller cells, whereas loss of CLN3 delays CLN1,2 transcription causing cells to start the cell cycle at a larger size [2] We exploited this phenotype in a screen for novel dose-dependent regulators of G1 ⁄ S-specific transcription We transformed cln3D mutants with a multicopy genomic library derived from YEplac181 and used centrifugal elutriation to identify transformants with a reduced cell size in G1 Not surprisingly, we found plasmids encoding the known regulators CLN1, CLN2, CLN3 and SWI4 (data not shown) In addition, we identified a plasmid encoding a truncated version of SIN3, lacking the C-terminal part of the coding region (2l SIN3DC) (Fig 1) that led to a reduction of cell size in cln3D cells (Fig 1A) This was accompanied with increased levels of CLN2 RNA and an increased budding index (Fig 1B) The change in cell size may therefore be the result of increased G1 cyclin expression This was unexpected because Sin3 has been described as a repressor of transcription [46,47] We therefore tested whether the phenotype could be explained by a dominant-negative effect of the truncated SIN3 allele on the function of wild-type SIN3 gene Sin3D mutants were originally identified because they allow HO expression in the absence of SWI5 [46,47] Using a Swi5-dependent HO-ADE2 reporter gene we FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS 3811 Sin3 involvement in cell size control O Stephan and C Koch A 350 300 250 200 150 100 50 2.5 B 3.5 4.5 5.5 6.5 7.5 8.5 9.5 0.7 0.6 0.5 0.4 0.3 0.2 0.1 Fig Multicopy plasmids encoding a trunctated SIN3 allele reduce the mean cell size of cln3D mutants (A) Wild-type (CY979) and cln3D cells (CY2028) were transformed with YEplac181 or a YEplac181 derivative (pCK1509) encoding a truncated SIN3 allele (2 lm SIN3DC) This truncated Sin3 polypeptide lacks amino acids 811–1536 Transformants were grown at 30 °C to log phase in selective medium lacking leucine The frequency distribution of cell size was measured with a CASYÒ1 cell counter (Scharfe Systems, Innovatis AG, Reutlingen, ă Germany) (B) Budding index was determined by counting 250 cells and the mean cell size of transformants was measured with a CASYÒ1 cell counter CLN2 RNA levels were determined by northern blot analysis and quantified with the BIOCAPT v 12.3 software found that swi5 mutants transformed with the SIN3DC plasmid expressed HO-ADE2, suggesting that the truncated allele has a dominant-negative effect (data not shown) To test directly whether SIN3 has an effect on the regulation of G1 ⁄ S-specific transcription, we compared synchronized wild-type and sin3D mutant cells Because we were interested in the timing of G1 cyclin expression, we analysed small G1 cells isolated by centrifugal elutriation The collected G1 cells were diluted in fresh media and followed as they progressed through the cell cycle (Fig 2) Isolation of small unbudded sin3D cells turned 3812 out to be difficult and yielded populations with a minimum content of 8–9% budded cells The elutriated sin3D cells initiated budding at a size of 24–26 fL This was smaller than for the congenic wild-type cells, which initiated budding at 32–35 fL (Fig 2A) It is unlikely that the observed difference is caused by a lack of synchrony in the sin3D culture, because cells from the elutriated sin3D population were, on average, slightly smaller than those from the wild-type population (20.9 fL for sin3D and 21.8 fL for wild-type), although more sin3D cells had already passed the S phase (Fig 2C) To analyse SBF-dependent gene regulation, the mRNA level of G1 ⁄ S-specific genes was determined (Fig 2B) Transcripts of the SBF-regulated genes CLN2 and PCL1 started accumulating at  23 fL in sin3D cells compared with  30 fL in the wild-type population, around the time of bud emergence (Fig 2A,B) FACS analysis showed that sin3D mutant cells also replicated their DNA at a smaller cell size (Fig 2C) These observations suggest that Sin3 is involved in repression of Start-specific transcription in G1 and thereby negatively regulates cell-cycle initiation In most instances, Sin3 acts together with the histone deacetylase Rpd3 [48] We therefore analysed gene expression in congenic rpd3D cells Rpd3D cells synchronized by elutriation initiated budding at a size of 24–26 fL, comparable with the sin3D strain (Fig 2A) Transcription of SBF-regulated genes in the elutriated cells also started at around the same cell size as observed for the sin3D mutant (Fig 2B) It is therefore likely that Sin3 acts together with Rpd3 in the regulation of G1-specific transcripts Because we observed precocious activation of G1-specific transcription in elutriated sin3 mutant cells, we expected that asynchronously growing mutant cells would be, on average, smaller than a corresponding wild-type population Interestingly, analysis of mean cell size from asynchronous sin3D cultures showed no reduced average size compared with a wild-type population (Fig 3A–C) The average cell size of a population, however, also depends on the time spent in G2 Indeed, we found an increased budding index of 73% in sin3D cultures compared with 48% for wild-type cells We also observed that log phase sin3D cells had a significantly increased percentage of cells that have entered S phase and replicated their DNA This may, therefore, explain why cells from the sin3 population are, on average, not smaller than the wild-type population Inactivation of SIN3 suppresses the CLN3 requirement for Start When wild-type cells reach a critical cell size, activation of G1-specific transcription by Cln3 ⁄ Cdk1 is rate FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS O Stephan and C Koch Sin3 involvement in cell size control Budded cells (%) A Mean volume (%) B C limiting for the further events at Start [3,15] Therefore, inactivation of CLN3 results in a large cell phenotype To test whether Cln3 is involved in releasing cells from a Sin3-dependent repression of G1-specific transcription, we analysed the consequences of deleting sin3 in a cln3 mutant The cell size of sin3Dcln3D double mutants from a logarithmically growing culture was compared with that of single mutants and wild-type cells (Fig 3A–C) The average cell size of cln3D cells was reduced to approximately the size of sin3D in the double mutant, suggesting that sin3 is partly epistatic to cln3 (Fig 3A–C) The critical cell size for the initiation of budding and the activation of G1 ⁄ S-specific transcription was investigated in small G1 cells elutriated from an asynchronous sin3Dcln3D double-mutant culture (Fig 3D,E) Similar to the sin3D population (see above), it proved difficult to isolate small unbudded sin3Dcln3D cells, suggesting partial deregulation of cell-cycle entry As can be seen from the FACS profile and cell size measurements 15 after putting cells into fresh medium (Fig 3F), inactivation of SIN3 in the cln3D mutant led to a reduction in cell size at birth Moreover, although cln3D mutants started budding at a nearly twice the size of wild-type cells, sin3Dcln3D double-mutant cells initiated budding at around the size of wild-type cells (Fig 3D) and activated G1 ⁄ S-specific transcription at a much smaller size than cln3D mutants (Fig 3E) Inactivation of SIN3 in a cln3D deletion mutant also caused the cells to replicate their DNA at a smaller cell size (Fig 3F) Hence, inactivation of SIN3 advances Start in a cln3D mutant These data suggest that Cln3 is also involved in releasing cells from a Sin3 dependent repression Fig G1 ⁄ S-specific gene expression in cells synchronized by centrifugal elutriation (A) Wild-type (strain CY4196), sin3D (strain CY5538), cln3D (strain CY5713) and sin3Dcln3D double-mutant cells (strain CY5715) were grown to late log phase in YEPGal medium at 25 °C Cell-cycle times were 240 (Wt; CY4196), 340 (sin3D; CY5538) and 350 (rpd3D; CY4061) Cells were harvested by centrifugation and loaded into an elutriation chamber Small unbudded cells were isolated by centrifugal elutriation and transferred into fresh medium at 25 °C To determine the budding index, 250 cells were counted Cell size during outgrowth was measured with a CASYÒ1 cell counter Displayed are mean volumes The peak of the cell size distribution at the time of budding was at 26 fL for wild-type For sin3D and rpd3D the peak values were 19 and 20 fL respectively (B) RNA levels of CLN2, PCL1 and TMP1 in samples taken during outgrowth were determined by northern blot analysis The transcript levels were normalized in comparison to the constitutively expressed CMD1 transcript (C) DNA content was analysed by flow cytometry Log, logarithmic growing cells used for elutriation FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS 3813 Sin3 involvement in cell size control O Stephan and C Koch A C B D 100% 90% Budded cells (%) 80% 70% 60% 50% 40% 30% 20% 10% 0% 20 E 30 40 50 60 80 90 70 Mean volume (fl) 100 110 120 130 F Fig Inactivation of SIN3 rescues the cell size of cln3D mutants (A) Wild-type (strain BY4742 background derived from S288C), congenic sin3D cells (strain CY5538), cln3D (strain CY5713) and sin3Dcln3D double-mutant cells (strain CY5715) were grown to mid-logarithmic phase in YEPD medium and analysed by DIC microscopy Budding index as percentage of cells with bud was determined by counting 250 cells and was 48% for wild-type, 73% for sin3D, 43% for cln3D and 76% for the sin3Dcln3D double mutant (B) Cell size analysis of wild-type, sin3D, cln3D and sin3Dcln3D double mutants The frequency distribution of cell diameters from asynchronous growing cultures in YEPD was determined using a CASYÒ1 cell counter (C) Cell size analysis of wild-type, sin3D, cln3D and sin3Dcln3D double mutants Displayed are the mean values from 10 independent experiments and their standard error (D) Wild-type (strain CY4196), cln3D (strain CY5713) and sin3Dcln3D double-mutant cells (strain CY5715) were grown to late log phase in YEPGal medium at 25 °C Cell-cycle times were 240 (Wt; CY4196), 290 (cln3D; CY5713) and 300 (sin3Dcln3D; CY5715) Small unbudded cells were isolated by centrifugal elutriation and transferred into fresh medium at 25 °C Cell size was measured with a CASYÒ1 cell counter Displayed are mean volumes The peak of the cell size distribution at the time of budding was at 26 fL for wild-type, 75 fL for cln3D and 22 fL for cln3Dsin3D (E) RNA levels of CLN2, PCL1 and TMP1 in samples taken during outgrowth were determined by northern blot analysis and the transcript levels were normalized to the constitutively expressed CMD1 transcript (F) DNA content of samples was analysed by flow cytometry Log, logarithmic growing cells used for elutriation 3814 FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS O Stephan and C Koch To elucidate if this repression by Sin3 is dependent on SBF (Swi4 ⁄ Swi6), the cell size of sin3swi4 double mutants was determined Cell size analysis of log-phase cultures from double mutants revealed that sin3D does not reduce the cell size of swi4D mutants, and did not advance transcriptional activation of G1 ⁄ S-specific genes, but instead increased the average size of swi4D mutants from 84 to 109 fL (data not shown) Sin3 involvement in cell size control A Sin3 is recruited to SBF-specific promoters The effect of Sin3 on cell size and S-phase entry suggests a role for Sin3 in the timing of CLN1 and CLN2 transcription by SBF If Sin3 were directly involved in regulating SBF (Swi4 ⁄ Swi6)-dependent transcription in late G1, it should be present at the relevant promoters Sin3 does not directly bind to DNA, but is known to be recruited to specific promoter regions by other DNA-binding proteins [40,48] We therefore asked whether Sin3 is targeted to promoters of G1 ⁄ S-specific genes in a Swi4 ⁄ Swi6-dependent manner For this, SIN3 was replaced by an epitope-tagged version at the SIN3 locus Binding of epitope-tagged Sin3–myc to G1 ⁄ S-specific promoters was assayed by ChIP experiments Coprecipitated promoter DNA fragments encompassing the SBF-binding sites from the promoter regions of CLN1 and CLN2 were amplified by multiplex PCR along with control fragments from their coding regions and from a nontranscribed region on chromosome V As shown in Fig 4, the promoter elements of CLN1 and CLN2 were significantly enriched compared with control fragments from the coding region and the nontranscribed region of chromosome V Immunoprecipitations were performed in triplicate to control for variations in the efficiency of immunoprecipiation As an additional control for the specificity of Sin3 binding, cells not expressing the epitope tag were analysed in parallel Sin3–myc binding to the promoter sequences of CLN1 and CLN2 was strongly reduced in swi4 and swi6 null mutants (Fig 4), which further demonstrated the specificity of the observed interaction These results suggest that Sin3 effects G1 ⁄ S transcription directly, and that Sin3 is recruited to G1 cyclin promoters by SBF or by factors associated with Swi4 or Swi6 Sin3 recruitment is regulated in a cell-cycle-dependent manner To detect whether the recruitment of Sin3 and its associated histone deacetylase Rpd3 to G1-specific promoters is regulated during the cell cycle, we tested promoter occupancy in cells that were arrested at B Fig Sin3 binds to G1 ⁄ S-specific promoters Chromatin immunoprecipitation assays (ChIP) were performed in triplicate using yeast strains carrying a myc tag at the SIN3 locus (CY5386, swi4D; CY5387, wt; CY4849, wt; CY5469, swi6D) ChIP assays with extracts of a strain lacking the myc tag were used as negative controls (CY1617) Crude extracts were prepared from formaldehyde cross-linked cells and chromatin precipitated with 9E11 antibodies Precipitates were analysed by multiplex PCR Primers for an untranscribed region on chromosome V were used as nonspecific control These control primers were applied in the same PCR together with either primers for the amplification of promoter elements or coding regions of CLN1 and CLN2 PCR results with primers for the coding region of CLN2 are displayed in comparison to the PCR results of promoters or the control Products were analysed on a 2% agarose gel WCE, whole cell extract; No Tag, analysis of strains lacking epitope tagged protein different stages of the cell cycle We analysed cdc28-13 cell-cycle mutants arrested in G1 at 37 °C, as well as cells that were arrested in G2 with the microtubule depolymerizing drug nocodazole Cdc28-13 mutants arrest in late G1 prior to the activation of G1 ⁄ S-specific transcription Strong Sin3 binding was detected in such cells at the CLN1, CLN2 and PCL1 promoter regions (Fig 5A,D) The stronger signal in the arrested cultures is most probably a simple reflection of cell-cycle-dependent binding Indeed, Sin3 was not associated with the promoters during G2, as we could not significantly coprecipitate CLN2 or PCL1 promoter elements with FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS 3815 Sin3 involvement in cell size control O Stephan and C Koch A B D 30 30 25 25 20 20 15 15 10 10 C log G1 log G1 log G2 log G2 Fig Sin3 and Rpd3 are recruited to CLN1, CLN2 and PCL1 promoters in G1 Chromatin immunoprecipitation (ChIP) assays were performed in triplicate using cdc28-13 yeast strains (CY239, CY5327 and CY5555) (A) Cells expressing Sin3–myc (CY5327) were grown in YEPD at 25 °C to a titre of · 107 mL)1 The culture was subsequently split in two and either arrested in G1 by shifting to 37 °C for 165 or kept at 25 °C for the same time Cells were cross-linked with 1% formaldehyde for 20 at room temperature Cell extracts were subjected to immunoprecipitation with anti-myc (9E11)-coupled Dynabeads The precipitates were analysed by PCR with primers for the amplification of promoter elements of CLN1, CLN2 and PCL1 and the coding regions of CLN2 Precipitation of DNA fragments from an untranscribed region on chromosome V was analysed as a control PCRs were analysed on 2% gels ChIP, chromatin immunoprecipitations; WCE, whole cell extract; No Tag, analysis of strains lacking epitope tagged protein (B) cdc28-13 cells expressing Rpd3–HA6 (CY5555) were treated and ChIPs performed as described in (A) (C) Binding of Sin3–myc (CY4849, wt) to the promoters of CLN2 and PCL2 in nocodazole arrested wild-type cells was analysed by ChIP Extracts were prepared from cells that were grown in YEPD to an D600 of 0.4 and subsequently arrested with nocodazole at 25 °C for 2.5 h (D) Precipitated DNA from the ChIP assays shown in (A) and (C) was analysed by realtime PCR on a Mx3000P thermocycler using the brilliant II QPCR kit, as described by the manufacturer (Stratagene, Heidelberg, Germany) Values from the untagged control samples were substracted from the signal of the tagged samples Shown are mean values derived from three independent experiments with standard deviations Sin3–myc from cells arrested with nocodazole (Fig 5C,D) To provide further evidence for the specific binding of Sin3, we analysed the recruitment of Rpd3, the catalytic component of the Sin3 ⁄ Rpd3 histone deacetylase complex, to G1 cyclin promoters in G1 (Fig 5B) Cdc28-13 mutants expressing an epitopetagged RPD3–HA6 were synchronized in late G1 by shifting log-phase cultures to 37 °C for h until all cells were arrested as large unbudded cells In ChIP assays with extracts prepared from arrested Rpd3–HA6 cells we observed recruitment of Rpd3–HA6 to SBFdependent promoters, although the signal was weaker than the signal for Sin3–myc (Fig 5B) The binding of Sin3 and Rpd3 to promoters of SBF-regulated genes in G1-arrested cells correlates with the transcriptional repression of CLN1, CLN2 and PCL1 in G1 3816 To analyse if the release of Sin3 from SBF-regulated genes coincides with transcriptional activation of G1 cyclins, we performed an arrest–release experiment Cdc28-13 mutants were shifted to 37 °C until they were arrested as unbudded cells in G1 The cells were subsequently released from cell-cycle arrest by shifting the culture to 25 °C RNA levels and Sin3 binding were analysed from samples taken every 10 For the arrested culture, ChIP analysis demonstrated strong binding of Sin3–myc to the CLN1 and CLN2 promoter (Fig 6A; min) When cells were released from the cell-cycle block, they synchronously entered the cell cycle (Fig 6C) A peak of G1 ⁄ S-specific transcription was observed between 10 and 20 after release Shortly thereafter, cells entered the S phase (FACS profile in Fig 6D) and started budding (Fig 6C) FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS O Stephan and C Koch Sin3 involvement in cell size control A B C D F E G Fig Dissociation of Sin3 from SBF-dependent promoters correlates with activation of G1 ⁄ S-specific transcription A cdc28-13 mutant expressing Sin3–myc (CY5327) was grown in YEPD to D600 = 0.4 and arrested at 37 °C for 180 Cells were released from the G1 arrest by shifting the culture to 25 °C Samples were taken at the indicated time points (A–D) (A) Sin3–myc binding was analysed by ChIP as in Fig PCRs were analysed on 2% agarose gels and quantified with the BIOCAPT v 12.3 software (B) Northern blot analysis of RNA levels of CLN2 and PCL1 were analysed in parallel with CMD1 as loading control (C) Quantified data from ChIP, CLN2 RNA levels and budding index The transcript levels of the CLN2 RNA were normalized using the constitutively expressed CMD1 transcript ChIP signals for the CLN2 promoter region were normalized to the signals of the chromosome V UTR control [(spec ChIP ⁄ control ChIP) tagged – (spec ChIP ⁄ control ChIP) untagged] (D) DNA content analysis by flow cytometry (E,F) ChIP of CLN2 and PCL1 promoter elements from small elutriated G1 cells expressing Sin3–myc Cells were grown to D600 = 2.3 in YEPGal medium and small G1 cells were isolated by centrifugal elutriation from cultures Unbudded cells were inoculated in fresh medium and incubated at 25 °C Binding of Sin3–myc to promoters was analysed at different time points by ChIP (F) PCL1 and CMD1 RNA levels determined by hybridization of northern blots with radioactive labelled DNA fragments (G) DNA content of cells was analysed by flow cytometry at the indicated time points The ChIP signal began to fade 10 after the cells were released (Fig 6A,B) The decrease in promoter occupancy by Sin3 correlated best with the timing of transcriptional activation (Fig 6B) The timing of Sin3 binding is therefore consistent with a role for Sin3 in repression of CLN transcription in the G1 phase FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS 3817 Sin3 involvement in cell size control O Stephan and C Koch content of cells were determined (Fig 6E–G) The data confirmed that SBF-specific promoters are occupied by Sin3 in the G1 phase At 160 min, most cells in the culture had left G1 and exhibited no Sin3 binding to the promoter (Fig 6E) Analysis of G1 cyclin expression showed that binding of Sin3 to the SBF-dependent promoters correlated with repression in G1, whereas disappearance of Sin3 from the promoter elements coincided with induction of Start-specific transcription (Fig 6) To elucidate whether Sin3 leaves the promoter together with Rpd3, we performed an arrest-release experiment with cdc28-13 cells expressing Rpd3–HA As shown in Fig 7, the binding of Rpd3 is very Because of their abnormally large size, G1-arrested cell-cycle mutants may not accurately reproduce the situation found in small wild-type daughter cells in the early G1 phase We therefore analysed promoter occupancy of Sin3–myc in elutriated wild-type cells Small G1 cells were isolated by centrifugal elutriation and allowed to progress through G1 The presence of Sin3– myc at the CLN2 and PCL1 promoter was compared with cell-cycle progression Because many cells were needed for ChIP assays it was not possible to analyse more than three time points At each time point, samples from the culture were analysed by ChIP assay and the RNA levels of G1 ⁄ S-specific genes and the DNA B 100% 1.8 90% 1.6 80% 1.4 Realtive RNA CLN2/CMD1 (%) and budding (%) C 70% 1.2 60% 50% 0.8 40% 0.6 30% 20% 0.4 10% Fold enrichment A 0.2 0% 0 10 20 30 40 50 Time (min) 60 70 80 D 10 20 30 40 50 60 70 80 Fig Dissociation of Rpd3 from SBF-dependent promoters correlates with activation of G1 ⁄ S-specific transcription A cdc28-13 mutant expressing Rpd3–myc (CY5555) was grown in YEPD to a titre of · 107 cellsỈmL)1 and arrested at 37 °C for 180 Shifting the culture to 25 °C released the cells from the G1 arrest Samples were taken at the indicated time points (A–D) (A) Rpd3–myc binding was analysed by ChIP as in Fig PCRs were analysed on 2% agarose gels and quantified with the BIOCAPT v 12.3 software (B) RNA levels of CLN2 and PCL1 were analysed by northern blot in parallel with CMD1 as loading control (C) Quantified data from ChIP, CLN2 RNA levels and budding index as described in the legend to Fig The transcript levels of the CLN2 RNA were normalized using the constitutively expressed CMD1 transcript ChIP signals for the CLN2 promoter region were quantified by normalising band intensities of CLN2 promoter fragments to the signals of the chromosome V UTR control (D) DNA content was analysed by flow cytometry at the indicated time points 3818 FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS O Stephan and C Koch similar to the kinetics of Sin3 binding (Fig 6) although the signal intensities for Rpd3 are generally weaker We therefore conclude that Sin3 acts together with Rpd3 at SBF-dependent promoters (Fig 7) Discussion In this study, we provide evidence that SIN3 is involved in the correct timing of G1 cyclin expression in Saccharomyces cerevisiae at the G1–S phase transition We have found that inactivation of SIN3 leads to an advanced induction of Start-specific transcription in G1 daughter cells and that budding is initiated at a smaller cell size Consistent with a direct role for Sin3 in repressing gene expression prior to Start, we find that Sin3 is present at the promoters of SBF-regulated genes in G1, but leaves the promoter around the time cells enter the S phase Furthermore, inactivation of Sin3 suppresses the phenotype of cln3 mutants, allowing them to activate G1 ⁄ S-specific transcription at a smaller cell size (Fig 3) Such a phenotype would be expected if Cln3 with its associated Cdc28 kinase were involved in the inactivation or repression of Sin3 ⁄ Rpd3-dependent histone deacetylation at the CLN1,2 promoters These data raise several questions concerning the regulation of G1 cyclin transcription In particular, whether CLN3 acts directly on Sin3 ⁄ Rpd3 and how Sin3 is recruited to SBF-regulated genes like CLN2 in the G1 phase How is Sin3 recruited to SBF-regulated promoters? Sin3 does not bind DNA directly, but associates with transcriptional regulators to bring the Rpd3 histone deacetylase to specific sites in chromatin [40,49] There are different DNA-binding proteins thought to bind to Sin3 Besides the well-characterized interaction with Ume6, these include Ash1, Mcm1 and Ssn6 [35,50,51] At the HO promoter, Sin3 is thought to be recruited in part by Ash1 [35,51] Veis et al reported cell-cycledependent binding of Sin3 to the G2 ⁄ M-specific CLB2 promoter [50] Their data further showed that the recruitment of Sin3 is dependent upon an interaction with Fkh2 and Mcm1 The removal of Sin3 and the deacetylase complex does not require B-type cyclins but Cdc28 ⁄ Cln activity [50] Similar to the recruitment of Sin3 to G2 ⁄ M-specific promoters by the regulatory factors Mcm1 and Fkh2, we propose that Sin3 is recruited to G1 ⁄ S promoters by SBF The DNA-binding protein Ume6 was shown to be responsible for Sin3 ⁄ Rpd3 recruitment at many other sites, for example, at SPO13, INO1, IME2 [40,43,52] We found no Sin3 involvement in cell size control Ume6 consensus sites [48] in the promoter regions of CLN1 and CLN2 Any one of the proteins present at the CLN2 promoter in early G1 could, in principle, be responsible for recruiting Sin3 to the promoter These include Swi4, Swi6, Whi5 and Stb1 [18,19,21,33,35] Although recruitment of Sin3 to the CLN2 promoter strongly depends on Swi4 and Swi6 (Fig 4), we found no significant effects of whi5 or stb1 mutants on the binding of Sin3 to the CLN2 promoter (data not shown) In addition, deleting WHI5 in a sin3 mutant did not reduce the cell size to the level of whi5D single mutants (data not shown) This makes it unlikely that Sin3 is recruited to the promoter via Whi5 Because the absence of Stb1 was observed to increase cell size of a cln3D mutant [32], it is not likely to mediate Sin3dependent repression, although it could be important for releasing from Sin3-dependent repression later in the cell cycle However, the timing of SBF binding [18,19], which arrives at the promoter as cells exit mitosis, would be consistent with a direct role as a Sin3 ⁄ Rpd3 recruiting factor Earlier ChIP results showed that the histone deacetylase Rpd3 is associated with the promoters of cell-cycle genes regulated by SBF, MBF, Fkh1, Fkh2, Mcm1 and Ndd1, and showed that SBF affected Rpd3 binding to CDC20 and PCL1, suggesting that Rpd3 can be recruited by several different transcription factors [39] This is consistent with our observation that both Sin3 and Rpd3 are recruited to G1 ⁄ S-specific promoters in a cell-cycledependent manner A situation in which transcriptional activators also directly recruit corepressors is in fact quite common, for example, in the case of E2F transcription factors in metazoans [53] How is Sin3 removed from the promoter in the S phase? The observation that deleting SIN3 partly suppresses the size phenotype of cln3 mutants suggests a possible role for Cln3 in the inactivation or subsequent removal of Sin3 ⁄ Rpd3 complexes from the promoter The only well-characterized, and presumably critical substrate for Cln3 ⁄ CDK1 is the repressor Whi5 [20,21] Removal of Sin3 at the beginning of the S phase is probably not a consequence of Whi5 inactivation caused by phosphorylation by Cln3 ⁄ CDK1 [20,21], because there is no evidence for a direct interaction between Whi5 and Sin3 or Rpd3 Alternatively, Sin3 may be a direct target for Cln3 kinase Sin3 is a phosphoprotein [54] and was found to coprecipitate with Cln2 in a proteomics study of yeast CDKs [54] The timing of Sin3s removal from the promoter (Fig 6) would also be compatible with a FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS 3819 Sin3 involvement in cell size control O Stephan and C Koch scenario in which the downstream Cln1 ⁄ 2–CDKs rather than Cln3 ⁄ CDK are responsible for inactivating Sin3 Such a mechanism could contribute to a positive feedback loop of CLN activation [55] assisting in making S-phase entry irreversible A role for Clns in the removal of Sin3 from promoters was suggested by Veis et al in the case of CLB2 [50] Given that Sin3, together with the Rpd3 histone deacetylase, is involved in modifying chromatin at many sites not concerned with cell-cycle control, we consider it more likely that Sin3 ⁄ Rpd3-dependent chromatin changes at the CLN2 promoter are regulated by reversible recruitment of Sin3 and or Rpd3, rather than by regulating Sin3 ⁄ Rpd3 directly A good candidate for a factor regulating Sin3 ⁄ Rpd3 binding is Stb1, because it binds to both Swi6 and Sin3 [20,21,32,34] In fact, Stb1 was originally identified as an interacting protein of Sin3 in two-hybrid assays (Stb1 for Sin three binding) [34] STB1 transcription was shown to be cell-cycle regulated and peaks in late G1 phase [32] Earlier studies showed that Stb1 binds only to synthetic MBF promoters [20], but a recent study provided evidence for in vivo binding to SBF and MBF promoters in G1 via an interaction with Swi6 [33] ChIP assays provided evidence that phosphorylation of Stb1 coincides with its dissociation from promoters at G1 ⁄ S transition [33] This study also found Stb1 to be associated with G1 ⁄ S-specific promoters until CLN transcription is inactivated [33] Phosphorylation of Stb1 inhibits interaction between Swi6 and Stb1 [20] Our finding of cell-cycle-specific promoter binding by Sin3 is in agreement with the proposal of de Bruin et al [33] for a combined role of Stb1 and Sin3 in regulating G1 ⁄ S transcription We were able to show that Sin3 binds to promoter sequences prior to transcriptional activation and leaves the promoter around the time of transcriptional activation The observation that Stb1 and Sin3 bind to promoters in G1 and leave the promoters at the time of transcriptional activation suggests that Stb1 and Sin3 may exert effects on G1 ⁄ S-specific transcription in a concerted manner A possible model for the regulation of SBF by Sin3 ⁄ Rpd3 may be that Sin3 is directly recruited by SBF in early G1 and that changes in Stb1 remove Sin3 from the promoter Data concerning the timing of Sin3 removal from the promoter are consistent with a function for both Cln3 and the downstream cyclins Cln1 and Cln2 in removing Sin3 from the promoter The timing is, however, not compatible with a model in which removal of Sin3 is a simple consequence of SBF removal from the promoter by Clb-kinase activity, because Swi6 remains associated with the CLN2 promoter for much longer [19] Cell-cycle-dependent 3820 binding of Sin3 has also been observed at the CLB2 locus [50] At the G2-specific CLB2 gene we found that Sin3 is recruited by Fkh2 in G1 and lost from the promoter after activation of Cln1,2 associated kinases [50] Although the timing is clearly different from the situation at the SBF-regulated genes analysed here, the inactivation by Cln-kinases may occur by a similar mechanism How important is Sin3 for the regulation of G1 ⁄ S-specific transcription? Sin3 mutants are not obviously smaller than wild-type cells, when the average size in the population is analysed, although we found a larger proportion of post-S-phase cells This, and the fact that Sin3 mutants are rather pleiotropic, may explain why the deregulation of G1 ⁄ S-specific genes becomes evident only in isolated G1 cells or in cln3D mutants In addition, the effect of ectopically expressing the dominant-negative allele of SIN3 on cell size was most obvious in cln3 mutants The importance of Sin3 for regulating CLN2 expression is therefore not so obvious In the absence of Cln3, the timing of Start execution becomes quite variable, whereas once activated, all Start-related events occur in a coherent fashion [55,56] It has been argued that cln3 mutants are particularly dependent on a positive feedback mechanism for G1 ⁄ S transcription, i.e Cln2 and Cln1 have to accumulate to a certain level before firing the positive feedback loop [55,56] As a consequence, every mutation that partly deregulates CLN2 expression will potentially lower the threshold at which such a positive loop will fire This may be one of the reasons why in cln3 mutants cell size is particularly sensitive to the inactivation of SIN3 and may make SIN3 apparently more important for repressing transcription in daughter cells with little Cln3 Remarkably, Aparicio et al [57] reported similar effects of Sin3 in the regulation of S-phase timing They showed that the S phase is advanced in the absence of the Sin3 ⁄ Rpd3 histone deacetylase complex In summary, we have identified an additional level of control at the G1- to S-phase transition that contributes to the astonishing precision of transcriptional timing observed in cell cycle regulated transcription in late G1 Materials and methods Strains and DNA Strains used in this study were derived from strains W303, BY4741 or BY4742 (Table 1) Gene deletions were created by integrational transformation of PCR cassettes, as described FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS O Stephan and C Koch Sin3 involvement in cell size control Table Yeast strains Strain Genotype Source W303 MATa, ade2-1, trp1-1, can1-100, leu2-3,112, his3-11,15, ura3, GAL, psi+ CY5450 CY4196 CY239 CY979 CY1617 CY2028 CY4256 CY4265 CY4266 CY4849 CY5327 CY5386 CY5387 CY5469 CY5538 CY5555 CY5713 CY5715 MATa; his3D1, leu2D0, met15D0, ura3D0 a MATalpha; his3D1, leu2D0, lys2D0, ura3D0 a MAT alpha, cdc28-13 (congenic to W303) MATa, MATa, pep4 :: URA3 (congenic to W303) MATa, cln3::URA3 (congenic to W303) MATa, [YEplac181] MATa, cln3::URA3, [YEplac181] MATa, cln3::URA3 [pCK1509] MATa, trp1-D63, sin3::SIN3-myc9(KLTRP1), pep4::URA3 (congenic to W303) MAT alpha, trp1-D63, cdc28-13, sin3::SIN3-myc9(KLTRP1), pep4::URA3 (congenic to W303) MATalpha, trp1-D63, swi4::LEU2, sin3::SIN3-myc9(KLTRP1), pep4::URA3 (congenic to W303) MATa, trp1-D63, sin3::SIN3-myc9(KLTRP1), pep4::URA3 (congenic to W303) MATalpha, trp1-D63, swi6::TRP1, sin3::SIN3-myc9(KLTRP1), pep4::URA3 (congenic to W303) MATa, congenic to By4741, except for sin3::KANMX a MATa, trp1-D63, cdc28-13, rpd3::RPD3–HA6(KLTRP1), pep4::URA3 (congenic to W303) MATalpha, congenic to By4741, except for cln3::KANMXa MATalpha, congenic to By4741, except for sin3::KANMX, cln3::KANMX b K Nasmyth (Oxford, UK) By4741 [58] By4742 [58] K Nasmyth W303 [61] [61] CY979 This study CY2028 This study This study This study This study This study [58] This study [58] This study a Strains were obtained from BIOCAT (Heidelberg, Germany) b Strain was created by crossing strain CY5538 with CY5713 previously [58] Double mutants were created by mating After incubation on sporulation media plates for 2–10 days at 25 °C, tetrads were dissected with a micromanipulator (Singer Instruments, Roadwater, UK) and distributed on YEPD plates After days at 25 °C the phenotypes were analysed by replica plating Genotypes of meiotic segregants were confirmed by PCR Epitope tagging of yeast genes at the C-terminus was performed using a PCR-based strategy to introduce epitope tags to the chromosomal loci [59] Deletion mutant strains used for cell size measurements were obtained from BIOCAT (BY4741, BY4742, CY5713 and CY5538) and double mutants (CY5715) were created by mating (Table 1) The genomic library was a gift from R Jansen (LMU Munich, Germany) and was generated by inserting genomic Sau3A fragments into the multicopy YEplac181 vector Plasmid pCK1509 contains a fragment that comprises 488 bp of the 5¢-UTR and 2436 bp of the SIN3 coding region Growth conditions and cell-cycle arrests Yeast cells were cultivated in YEP-based media with 2% glucose (YEPD) or 2% galactose (YEPGal) Cell-cycle arrests of temperature-sensitive mutants (cdc28-13) were performed by growing the cells to a titre of 107 cellsỈmL)1 at 25 °C (YEPD) in a water bath and then shifting the culture to 37 °C for 165 For centrifugal elutriation, cells were grown to D600 = 2.0 in YEPGal The elutriation chamber was loaded with a total of 8000 D600 cells Fractions of small cells were collected, pooled and cultivated at 25 °C in fresh media Samples from the culture were taken at specific time points and cell size and cell-cycle progression were monitored Budding index was determined by counting  250 cells Flow cytometry was used to observe cell-cycle distribution as described previously [19] Cell size measurements Cell number and average cell size were analysed by using a CASYÒ1 cell counter model TT from Scharfe Systems ă (Innovatis AG, Reutlingen, Germany) To determine cell number and size distribution of yeast cultures, the cell suspensions were diluted in CASY-tonÒ isotonic buffer and sonicated for 30 s before the measurement ChIP assays ChIPs were carried out with modifications as described previously [24,60] Crude extracts were prepared from cultures (55 mL, 2.5 · 107 cellsỈmL)1) treated with 1% formaldehyde for 20 at room temperature before harvesting After addition of 135 mm glycine and incubation for at room temperature, cells were harvested and washed four times with mL NaCl ⁄ Tris buffer (20 mm Tris ⁄ HCl pH 7.5, 150 mm NaCl) to remove residual formaldehyde Cells were resuspended in 600 lL lysis buffer (50 mm Hepes KOH pH 7.5, 140 mm NaCl, mm EDTA, 1% Triton X-100, 0.1% deoxycholic acid) and cell breakage was carried out by addition of glass beads, and usage of a IKAÒ Vibrax VXR basic (25 2500 rpm, °C) Extracts were sonicated five times for 30 s using a Bandelin Sonoplus HD2070 ⁄ SH70G and the debris was removed by centrifugation (16 000 g min, °C) The supernatant was FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS 3821 Sin3 involvement in cell size control O Stephan and C Koch applied to 50 lL DynabeadsÒ Pan Mouse IgG (DynalÒ Invitrogen (Karlsruhe, Germany); 400 000 beadsỈlL)1) that were loaded with epitope tag-specific antibodies (0.05 lg of antibodies per lL of bead suspension) and incubated for h at °C on a rotator Antibodies used for ChIP assays were anti-myc 9E11 (Dianova, Hamburg, Germany) and anti-HA 12CA5 (lab preparation) Thereafter, the beads were washed twice with mL lysis buffer, high salt buffer (50 mm Hepes KOH pH 7.5, 500 mm NaCl, mm EDTA, 1% Triton X-100, 0.1% deoxycholic acid), washing buffer (10 mm Tris ⁄ HCl pH 8, 250 mm LiCl, mm EDTA, 0.5% NP40, 0.5% deoxycholic acid) and TE buffer Precipitates were eluted in 50 lL elution buffer (50 mm Tris ⁄ HCl pH 8, 10 mm EDTA, 1% SDS) at 65 °C for 10 Eluted proteins were analysed by SDS ⁄ PAGE and western blotting We added 120 lL 1% SDS ⁄ TE buffer to 30 lL of the supernatant and incubated for 16 h at 65 °C The eluates were treated with 0.5 lgỈlL)1 proteinase K for h at 37 °C Thereafter, coprecipitated DNA was purified by phenol extraction DNA fragments of promoters and coding regions were amplified by multiplex PCR and analysed on 2% agarose gels As a control, we coamplified an untranscribed region of chromosome V (10562–10699) together with either the promoter or the coding region of CLN1, CLN2 and PCL1 in the same PCR The primers for amplification of the control region on chromosome V were CK2229 (CAGTTTAACCCGAAGTTCTG) and CK2230 (AACAACGCAGCTGCTTTAAC) Primers used for the amplification of fragments from promoter fragments were: CLN2, CK2148 (ATCTTTTTCGTATCCTCCGC) and CK2149 (AAAGGGCCAACAGTTGTTTC); CLN1, CK2158 (TAGGGTAGCGTGCCACAAAA) and CK2159 (CGTCT CTTGCAGGCTGAACA); PCL1, CK2364 (GCTAACAA CTGAGAATGCGA) and CK2366 (ACACAAGAGTTAA GGACAAG) The primers used for the amplification of fragments from the coding regions were: CLN2, CK1724 (ATAGTGATGCCACTGTAGAC) and CK1725 (CATGATGGGGTTGATATGGT); CLN1, CK2254 (TAGTTCACCGCAAAGTACTG) and CK2255 (TATTGTAGAGGCCAGTTGCA); PCL1, CK2348 (CCA TCCATCGCATTTTCTTG) and CK2349 (CTGTGTTG TTCGCTATGTTG) Northern analysis Yeast cells were harvested and chilled on ice before they were washed with cold TE buffer Cell pellets were frozen in liquid nitrogen and stored at )80 °C Precipitated cells were resuspended in RNA buffer (10 mm Tris ⁄ HCl pH 7.5, 300 mm NaCl, mm EDTA, 0.2% SDS) and vortexed vigorously with phenol ⁄ chloroform ⁄ isoamylalcohol and glass beads for 15 After centrifugation the aqueous phases were mixed with ethanol (1 : v ⁄ v) and incubated 3822 for 20 at )20 °C Tubes were centrifuged for 15 at 16 000 g Pellets were resuspended in RNA buffer (10 mm Tris ⁄ HCl pH 7.5, mm EDTA, 0.2% SDS) and incubated for at 65 °C RNA content was measured at 260 nm with a SmartspecÔ 3000 from BioRad (Munich, Germany) RNA (20 lg per sample) was separated on 1.3% agarose gels containing 1.3% formaldehyde RNA was transferred to Gene Screen membranes Hybridizations with 32P-labelled DNA probes were performed at 65 °C for 16 h in Church buffer (0.5 m NaCl ⁄ Pi pH 7.2, 7% SDS, 10 mm EDTA, 1% BSA) Filters were washed twice for in 2· NaCl ⁄ Cit ⁄ 0.1% SDS and twice for 10 in 1· NaCl ⁄ Cit ⁄ 0.1% SDS at 65 °C CMD1 RNA levels were determined as internal loading control Acknowledgements We gratefully thank Marlis Dahl, Rosi Sollner, Alexă ander Schwahn, Uwe Sonnewald and Martin Korn for their support and helpful discussions We thank Gustav Ammerer and Kim Nasmyth for strains We thank Michael Schwenkert and Christian Kellner for their help with the FACS analysis References Cross FR (1995) Starting the cell cycle: what’s the point? Curr Opin Cell Biol 7, 790–797 Nash R, Tokiwa G, Anand S, Erickson K & Futcher AB (1988) The WHI1+ gene of Saccharomyces cerevisiae tethers cell division to cell size and is a cyclin homolog EMBO J 7, 4335–4346 Tyers M, Tokiwa G & Futcher B (1993) Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2 and other cyclins EMBO J 12, 1955–1968 Bahler J (2005) Cell-cycle control of gene expression in budding and fission yeast Annu Rev Genet 39, 69–94 Bloom J & Cross FR (2007) Multiple levels of cyclin specificity in cell-cycle control Nat Rev Mol Cell Biol 8, 149–160 Mendenhall MD & Hodge AE (1998) Regulation of Cdc28 cyclin-dependent protein kinase activity during the cell cycle of the yeast Saccharomyces cerevisiae Microbiol Mol Biol Rev 62, 1191–1243 Andrews BJ & Herskowitz I (1989) The yeast SWI4 protein contains a motif present in developmental regulators and is part of a complex involved in cell-cycledependent transcription Nature 342, 830–833 Breeden L & Nasmyth K (1987) Similarity between cellcycle genes of budding yeast and fission yeast and the Notch gene of Drosophila Nature 329, 651–654 Koch C, Moll T, Neuberg M, Ahorn H & Nasmyth K (1993) A role for the transcription factors Mbp1 and FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS O Stephan and C Koch 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Swi4 in progression from G1 to S phase Science 261, 1551–1557 Iyer VR, Horak CE, Scafe CS, Botstein D, Snyder M & Brown PO (2001) Genomic binding sites of the yeast cell-cycle transcription factors SBF and MBF Nature 409, 533–538 Lowndes NF & Johnston LH (1992) Parallel pathways of cell cycle-regulated gene expression Trends Genet 8, 79–81 Pizzagalli A, Valsasnini P, Plevani P & Lucchini G (1988) DNA polymerase I gene of Saccharomyces cerevisiae: nucleotide sequence, mapping of a temperature-sensitive mutation, and protein homology with other DNA polymerases Proc Natl Acad Sci USA 85, 3772–3776 Nasmyth K & Dirick L (1991) The role of SWI4 and SWI6 in the activity of G1 cyclins in yeast Cell 66, 995–1013 Ogas J, Andrews BJ & Herskowitz I (1991) Transcriptional activation of CLN1, CLN2, and a putative new G1 cyclin (HCS26) by SWI4, a positive regulator of G1-specific transcription Cell 66, 1015– 1026 Dirick L, Bohm T & Nasmyth K (1995) Roles and regulation of Cln–Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae EMBO J 14, 4803–4813 Stern M, Jensen R & Herskowitz I (1984) Five SWI genes are required for expression of the HO gene in yeast J Mol Biol 178, 853–868 Amon A, Tyers M, Futcher B & Nasmyth K (1993) Mechanisms that help the yeast cell cycle clock tick: G2 cyclins transcriptionally activate G2 cyclins and repress G1cyclins Cell 74, 993–1007 Harrington LA & Andrews BJ (1996) Binding to the yeast SwI4,6-dependent cell cycle box, CACGAAA, is cell cycle regulated in vivo Nucleic Acids Res 24, 558–565 Koch C, Schleiffer A, Ammerer G & Nasmyth K (1996) Switching transcription on and off during the yeast cell cycle: Cln ⁄ Cdc28 kinases activate bound transcription factor SBF (Swi4 ⁄ Swi6) at start, whereas Clb ⁄ Cdc28 kinases displace it from the promoter in G2 Genes Dev 10, 129–141 Costanzo M, Nishikawa JL, Tang X, Millman JS, Schub O, Breitkreuz K, Dewar D, Rupes I, Andrews B & Tyers M (2004) CDK activity antagonizes Whi5, an inhibitor of G1 ⁄ S transcription in yeast Cell 117, 899–913 de Bruin RA, McDonald WH, Kalashnikova TI, Yates J III & Wittenberg C (2004) Cln3 activates G1-specific transcription via phosphorylation of the SBF bound repressor Whi5 Cell 117, 887–898 Cooper K (2006) Rb, whi it’s not just for metazoans anymore Oncogene 25, 5228–5232 Polymenis M & Schmidt EV (1997) Coupling of cell division to cell growth by translational control of the G1 cyclin CLN3 in yeast Genes Dev 11, 2522–2531 Sin3 involvement in cell size control 24 Cosma MP, Panizza S & Nasmyth K (2001) Cdk1 triggers association of RNA polymerase to cell cycle promoters only after recruitment of the mediator by SBF Mol Cell 7, 1213–1220 25 Cosma MP, Tanaka T & Nasmyth K (1999) Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle- and developmentally regulated promoter Cell 97, 299–311 26 Wijnen H & Futcher B (1999) Genetic analysis of the shared role of CLN3 and BCK2 at the G(1)-S transition in Saccharomyces cerevisiae Genetics 153, 1131–1143 27 Manukyan A, Zhang J, Thippeswamy U, Yang J, Zavala N, Mudannayake MP, Asmussen M, Schneider C & Schneider BL (2008) Ccr4 alters cell size in yeast by modulating the timing of CLN1 and CLN2 expression Genetics 179, 345–357 28 Mai B & Breeden L (2000) CLN1 and its repression by Xbp1 are important for efficient sporulation in budding yeast Mol Cell Biol 20, 478–487 29 Ashe M, de Bruin RA, Kalashnikova T, McDonald WH, Yates JR III & Wittenberg C (2008) The SBFand MBF-associated protein Msa1 is required for proper timing of G1-specific transcription in Saccharomyces cerevisiae J Biol Chem 283, 6040–6049 30 de Bruin RA, Kalashnikova TI, Chahwan C, McDonald WH, Wohlschlegel J, Yates J III, Russell P & Wittenberg C (2006) Constraining G1-specific transcription to late G1 phase: the MBF-associated corepressor Nrm1 acts via negative feedback Mol Cell 23, 483–496 31 Costanzo M, Schub O & Andrews B (2003) G1 transcription factors are differentially regulated in Saccharomyces cerevisiae by the Swi6-binding protein Stb1 Mol Cell Biol 23, 5064–5077 32 Ho Y, Costanzo M, Moore L, Kobayashi R & Andrews BJ (1999) Regulation of transcription at the Saccharomyces cerevisiae start transition by Stb1, a Swi6-binding protein Mol Cell Biol 19, 5267–5278 33 de Bruin RA, Kalashnikova TI & Wittenberg C (2008) Stb1 collaborates with other regulators to modulate the G1-specific transcriptional circuit Mol Cell Biol 28, 6919–6928 34 Kasten MM & Stillman DJ (1997) Identification of the Saccharomyces cerevisiae genes STB1–STB5 encoding Sin3p binding proteins Mol Gen Genet 256, 376–386 35 Carrozza MJ, Florens L, Swanson SK, Shia WJ, Anderson S, Yates J, Washburn MP & Workman JL (2005) Stable incorporation of sequence specific repressors Ash1 and Ume6 into the Rpd3L complex Biochim Biophys Acta 1731, 77–87 36 Carrozza MJ, Li B, Florens L, Suganuma T, Swanson SK, Lee KK, Shia WJ, Anderson S, Yates J, Washburn MP et al (2005) Histone H3 methylation by Set2 directs deacetylation of coding regions by Rpd3S to suppress spurious intragenic transcription Cell 123, 581–592 FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS 3823 Sin3 involvement in cell size control O Stephan and C Koch 37 Kadosh D & Struhl K (1998) Targeted recruitment of the Sin3-Rpd3 histone deacetylase complex generates a highly localized domain of repressed chromatin in vivo Mol Cell Biol 18, 5121–5127 38 Kasten MM, Dorland S & Stillman DJ (1997) A large protein complex containing the yeast Sin3p and Rpd3p transcriptional regulators Mol Cell Biol 17, 4852–4858 39 Robert F, Pokholok DK, Hannett NM, Rinaldi NJ, Chandy M, Rolfe A, Workman JL, Gifford DK & Young RA (2004) Global position and recruitment of HATs and HDACs in the yeast genome Mol Cell 16, 199–209 40 Kadosh D & Struhl K (1997) Repression by Ume6 involves recruitment of a complex containing Sin3 corepressor and Rpd3 histone deacetylase to target promoters Cell 89, 365–371 41 Kadosh D & Struhl K (1998) Histone deacetylase activity of Rpd3 is important for transcriptional repression in vivo Genes Dev 12, 797–805 42 Kurdistani SK, Robyr D, Tavazoie S & Grunstein M (2002) Genome-wide binding map of the histone deacetylase Rpd3 in yeast Nat Genet 31, 248–254 43 Rundlett SE, Carmen AA, Suka N, Turner BM & Grunstein M (1998) Transcriptional repression by UME6 involves deacetylation of lysine of histone H4 by RPD3 Nature 392, 831–835 44 Robyr D, Suka Y, Xenarios I, Kurdistani SK, Wang A, Suka N & Grunstein M (2002) Microarray deacetylation maps determine genome-wide functions for yeast histone deacetylases Cell 109, 437–446 45 Jorgensen P, Nishikawa JL, Breitkreutz BJ & Tyers M (2002) Systematic identification of pathways that couple cell growth and division in yeast Science 297, 395–400 46 Nasmyth K, Stillman D & Kipling D (1987) Both positive and negative regulators of HO transcription are required for mother-cell-specific mating-type switching in yeast Cell 48, 579–587 47 Sternberg PW, Stern MJ, Clark I & Herskowitz I (1987) Activation of the yeast HO gene by release from multiple negative controls Cell 48, 567–577 48 Silverstein RA & Ekwall K (2005) Sin3: a flexible regulator of global gene expression and genome stability Curr Genet 47, 1–17 49 Washburn BK & Esposito RE (2001) Identification of the Sin3-binding site in Ume6 defines a two-step process for conversion of Ume6 from a transcriptional repressor to an activator in yeast Mol Cell Biol 21, 2057–2069 50 Veis J, Klug H, Koranda M & Ammerer G (2007) Activation of the G2 ⁄ M-specific gene CLB2 3824 51 52 53 54 55 56 57 58 59 60 61 requires multiple cell cycle signals Mol Cell Biol 27, 8364–8373 Mitra D, Parnell EJ, Landon JW, Yu Y & Stillman DJ (2006) SWI ⁄ SNF binding to the HO promoter requires histone acetylation and stimulates TATA-binding protein recruitment Mol Cell Biol 26, 4095–4110 Elkhaimi M, Kaadige MR, Kamath D, Jackson JC, Biliran H Jr & Lopes JM (2000) Combinatorial regulation of phospholipid biosynthetic gene expression by the UME6, SIN3 and RPD3 genes Nucleic Acids Res 28, 3160–3167 Asp P, Acosta-Alvear D, Tsikitis M, van Oevelen C & Dynlacht BD (2009) E2f3b plays an essential role in myogenic differentiation through isoform-specific gene regulation Genes Dev 23, 37–53 Ficarro SB, McCleland ML, Stukenberg PT, Burke DJ, Ross MM, Shabanowitz J, Hunt DF & White FM (2002) Phosphoproteome analysis by mass spectrometry and its application to Saccharomyces cerevisiae Nat Biotechnol 20, 301–305 Skotheim JM, Di Talia S, Siggia ED & Cross FR (2008) Positive feedback of G1 cyclins ensures coherent cell cycle entry Nature 454, 291–296 Bean JM, Siggia ED & Cross FR (2006) Coherence and timing of cell cycle start examined at single-cell resolution Mol Cell 21, 3–14 Aparicio JG, Viggiani CJ, Gibson DG & Aparicio OM (2004) The Rpd3-Sin3 histone deacetylase regulates replication timing and enables intra-S origin control in Saccharomyces cerevisiae Mol Cell Biol 24, 4769–4780 Winzeler EA, Shoemaker DD, Astromoff A, Liang H, Anderson K, Andre B, Bangham R, Benito R, Boeke JD, Bussey H et al (1999) Functional characterization of the S cerevisiae genome by gene deletion and parallel analysis Science 285, 901–906 Knop M, Siegers K, Pereira G, Zachariae W, Winsor B, Nasmyth K & Schiebel E (1999) Epitope tagging of yeast genes using a PCR-based strategy: more tags and improved practical routines Yeast 15, 963–972 Strahl-Bolsinger S, Hecht A, Luo K & Grunstein M (1997) SIR2 and SIR4 interactions differ in core and extended telomeric heterochromatin in yeast Genes Dev 11, 83–93 Koch C, Wollmann P, Dahl M & Lottspeich F (1999) A role for Ctr9p and Paf1p in the regulation G1 cyclin expression in yeast Nucleic Acids Res 27, 2126–2134 FEBS Journal 276 (2009) 3810–3824 ª 2009 The Authors Journal compilation ª 2009 FEBS ... SIN3 leads to an advanced induction of Start- specific transcription in G1 daughter cells and that budding is initiated at a smaller cell size Consistent with a direct role for Sin3 in repressing... to approximately the size of sin3D in the double mutant, suggesting that sin3 is partly epistatic to cln3 (Fig 3A–C) The critical cell size for the initiation of budding and the activation of G1... caused the cells to replicate their DNA at a smaller cell size (Fig 3F) Hence, inactivation of SIN3 advances Start in a cln3D mutant These data suggest that Cln3 is also involved in releasing cells