serotonin activated hepatic stellate cells contribute to sex disparity in hepatocellular carcinoma

1 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 ORIGINAL RESEARCH 59 60 61 62 63 64 65 Qiqi Yang,1,* Chuan Yan,1,2,* Chunyue Yin,3 and Zhiyuan Gong1,2 66 67 68 Department of Biological Sciences, 2Graduate School for Integrative Sciences and Engineering, National University of Singapore, Singapore; 3Division of Gastroenterology, Hepatology and Nutrition, Cincinnati Children’s Hospital Medical Center, 69 Cincinnati, Ohio 70 71 menopause, women showed increased occurrence of HCC, 72 SUMMARY which could be reduced with estrogen treatment.2,3 In a 73 A higher serotonin synthesis and accumulation in male carcinogen-induced mouse HCC model, administration of 74 zebrafish resulted in increased activation of hepatic stellate estrogen to male mice inhibited HCC development.4 It is 75 cells and transforming growth factor B1 expression and this interesting to note that effects elicited by sex hormones are 76 has contributed to the accelerated progression of hepatoassociated commonly with tumor microenvironment- 77 cellular carcinoma in male zebrafish with activated kras mediated inflammatory response For example, estrogen 78 oncogene expression inhibits interleukin expression in Kupffer cells (liver 79 resident macrophages) and confers resistance to HCC in 80 female mice.5 Androgen signaling polarizes tumor- Q9 81 BACKGROUND & AIMS: Hepatocellular carcinoma (HCC) associated macrophages to a protumor gene expression 82 occurs more frequently and aggressively in men than in profile during early hepatocarcinogenesis.6 Interestingly, 83 women Although sex hormones are believed to play a critical numerous HCC studies have shown a more robust and 84 role in this disparity, the possible contribution of other factors active HCC tumor microenvironment in males than in 85 largely is unknown We aimed to investigate the role of females For example, infiltrating tumor-associated macro- 86 serotonin on its contribution of sex discrepancy during HCC phage density has been found to be higher in males than in 87 METHODS: By using an inducible zebrafish HCC model through females in a mouse HCC model In human HCC patients, 88 hepatocyte-specific transgenic KrasV12 expression, differential men have considerably higher numbers of intratumoral 89 T cells; both are 90 rates of HCC in male and female sh were characterized by both inltrated CD66bỵ neutrophils and CD8ỵ indicators of poor disease prognosis 91 pharmaceutical and genetic interventions The findings were Hepatic stellate cells (HSCs), the main fibrinogenic cell 92 validated further in human liver disease samples type in the liver, primarily are responsible for the produc- 93 RESULTS: Accelerated HCC progression was observed in tion of extracellular matrix materials.9–11 Recent studies 94 V12 kras -expressing male zebrafish and male fish liver tumors have shown a tumor-promoting role of HSCs.12 Tumor 95 were found to have higher hepatic stellate cell (HSC) density and cell–secreted signals promote HSCs to transdifferentiate 96 activation Serotonin, which is essential for HSC survival and into highly proliferating myofibroblast-like cells, also known 97 activation, similarly were found to be synthesized and accumuas activated HSCs.13 Activated HSCs can induce phenotypic 98 lated more robustly in males than in females Serotonin-activated changes in cancer cells, primarily by secretion of protumor 99 HSCs could promote HCC carcinogenesis and concurrently growth factors and cytokines such as hepatocyte growth Q10 100 increase serotonin synthesis via transforming growth factor factor and transforming growth factor (TGF)b1.14 An Q11 101 (Tgf)b1 expression, hence contributing to sex disparity in HCC signature in HCC 102 Analysis of liver disease patient samples showed similar male increased HSC-specific gene expression 15 Notably, HSCs are found 103 patients indicates poor prognosis predominant serotonin accumulation and Tgfb1 expression to be of higher density in male than in female HCC 104 CONCLUSIONS: In both zebrafish HCC models and human liver patients.16 Because only activated HSCs rapidly proliferate, 105 disease samples, a predominant serotonin synthesis and accu106 mulation in males resulted in higher HSC density and activation 107 as well as Tgfb1 expression, thus accelerating HCC carcino*Authors share co-first authorship 108 genesis in males (Cell Mol Gastroenterol Hepatol 2017;-:-–-; Abbreviations used in this paper: a-SMA, a-smooth muscle actin; 109 http://dx.doi.org/10.1016/j.jcmgh.2017.01.002) cDNA, complementary DNA; dox, doxycycline; EGFP, ; 110 Gfap, ; HCC, hepatocellular carcinoma; HSC, hepatic stellate cell; Htr2b, 5-hydoxytryotamine receptor 2B; IF, immunofluo111 rescence; IHC, immunohistochemistry; PCR, polymerase chain Keywords: Liver Cancer; TGFB1; Kras; Zebrafish 112 reaction; P-Tph1, _; TGF, transforming growth factor; Tph1, 113 tryptophan hydroxylase 1; WT, wild type 114 © 2017 The Authors Published by Elsevier Inc on behalf of the AGA epatocellular carcinoma (HCC) is notably more Institute This is an open access article under the CC BY-NC-ND 115 prevalent in men than in women, with a malelicense (http://creativecommons.org/licenses/by-nc-nd/4.0/) 116 2352-345X to-female ratio of 4.5:1 The sex disparity appears to be Serotonin Activated Hepatic Stellate Cells Contribute to Sex Disparity in Hepatocellular Carcinoma Q42 Q5 Q6 Q7 Q8 H mediated by a sex hormone–regulated mechanism After http://dx.doi.org/10.1016/j.jcmgh.2017.01.002 FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC 117 118 119 120 121 122 123 124 125 126 127 128 Q12 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 Q13 150 Q14 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 Q15 168 Q16 169 170 171 172 173 174 175 Yang et al Cellular and Molecular Gastroenterology and Hepatology Vol a higher HSC density in male HCC patients implies that a sex-dependent mechanism could contribute to activation of HSCs.13 Our laboratory previously generated several inducible HCC models by transgenic expression of an oncogene in hepatocytes in zebrafish.17–21 The inducible nature of these zebrafish HCC models allows the oncogene to be activated at a given and controlled timing in both sexes, providing an excellent platform to study sex disparity in HCC initiation and progression In this study, we attempted to investigate the mechanism of the sex disparity observed in HCC patients In our krasV12-expressing HCC zebrafish model, male fish showed accelerated carcinogenesis as compared with females.17 Interestingly, we found an increased level of serotonin production in male krasV12-expressing livers as compared with female counterparts and showed that serotonin was necessary for maintaining HSC survival and activation during HCC carcinogenesis The activated HSCs in turn promoted HCC progression and at the same time increased serotonin synthesis in hepatocytes via Tgfb1, hence maintaining and promoting the sex disparity observed in krasV12-expressing zebrafish The findings in zebrafish were confirmed by our analyses of human liver disease patient samples, suggesting that serotonin is involved in the sex disparity of human HCC Materials and Methods Zebrafish Husbandry Zebrafish were maintained in compliance with Institutional Animal Care and Use Committee guidelines from the National University of Singapore Five transgenic lines, Tg(fabp10:rtTA2s-M2; TRE2:EGFP-krasG12V) (gz32Tg) in a Tet-On system for inducible hepatocyte-specific expression of oncogenic krasG12V,17 Tg(hand2:EGFP) (pd24Tg) with EGFP-labeled HSCs under the hand2 promoter,22 Tg(tp1:EGFP) (um14Tg) with EGFP-labeled cholangiocytes under a notch-responsive element,23 Tg(lyz:DsRed2) (nz50Tg) with DsRed-labeled neutrophils under the lysozyme C (lyz) promoter,24 Tg(mpeg1:mCherry) (gl22Tg), with mCherry-labeled macrophages under the mpeg1 promoter,25 and Tg(fabp10:DsRed; ela3l:EGFP) (gz15Tg) with DsRed-labeled hepatocytes under the fabp10 promoter26 were used in this study and referred to as krasỵ, hand2ỵ, lyzỵ, mpegỵ, and fabp10ỵ, respectively, in the present report Chemical Treatment All chemical/reagent treatments were conducted in 3-month-old adult fish for days The chemicals/reagents used included doxycycline (dox) (D9891; Sigma), serotonin (14927; Sigma), PCPA (C6506; Sigma), BW723C86 (B175; Sigma), SB204741 (S0693; Sigma), and SB431542 (1614; Tocris) Serotonin, PCPA, BW723C86, SB204741, SB431542, and dox were used for adult exposure at 10 mmol/L, 25 mmol/L, 15 mmol/L, 15 mmol/L, 2.5 mmol/L, and 30 mg/mL, respectively The dosages were selected based on the highest all-survival concentrations in preliminary experiments -, No - 176 At each time point of chemical treatment experiments, 177 more than 10 adult fish in each group were used for imaging 178 analyses These zebrafish were anesthetized in 0.08% tri- 179 caine (E10521; Sigma) and immobilized in 3% methylcel- 180 lulose (M0521; Sigma) before imaging Each zebrafish was 181 photographed individually with an Olympus microscope Q17 182 183 184 Isolation of Hepatocytes, Neutrophils, 185 Macrophages, Cholangiocytes, and HSCs by 186 Fluorescence-Activated Cell Sorting 187 Fabpỵ, lyzỵ, mpegỵ, tp1ỵ, and hand2ỵ transgenic 188 zebrash in wild-type background were used for 189 fluorescence-activated cell sorting isolation of hepatocytes, 190 neutrophils, macrophages, cholangiocytes, and HSCs, 191 respectively, using a cell sorter (643245; BD Aria) Ten adult Q18 192 livers were pooled and dissociated into single cells in the 193 presence of 0.05% trypsin (T1426; Sigma) using a 40-mm 194 mesh (352340; BD Falcon) as previously described.27 195 Hepatocytes (fabpỵ), cholangiocytes (tp1ỵ), and HSCs 196 (hand2ỵ) were isolated based on EGFP expression, neu- 197 trophils (lyzỵ) were isolated based on DsRed expression, 198 and macrophages (mpegỵ) were isolated based on mCherry 199 expression 200 201 202 RNA Extraction, Complementary DNA 203 Amplification, and Reverse-Transcription 204 Quantitative Polymerase Chain Reaction 205 Total RNA was extracted using the RNeasy mini kit 206 (74104; Qiagen) A total of ng RNA was used as a template Q19 207 to synthesize and amplify complementary DNA (cDNA) 208 using the QuantiTect Whole Transcriptome Kit (207043; 209 Qiagen) Amplified cDNA was performed for real-time 210 quantitative polymerase chain reaction (PCR) with Light211 Cycler 480 SYBR Green I Master (04707516001; Roche) 212 Interested cDNAs were amplified for 40 cycles (95 C, 20 s; Q20 213 65 C, 15 s; and 72 C, 30 s) The sequences of PCR primers 214 used were as follows: b-actin: CTCTGGGTCACCGCTTCTTT 215 (forward) and CAGATGCTCACGAAACCCCT (reverse); tph1b: 216 CTAAGAGCATACGGGGCTGG (forward) and GGACGCTG217 GATTGTCTTTGC (reverse); htr2b: CGCAGGATGTCCACCA218 TAGG (forward) and TGCACCTTTCACAGAGCACA (reverse); 219 and tgfb1: AGCAGAATTGCGTCTTCGGA (forward) and 220 TCAAATGAGAGCCAGCGGTT (reverse) 221 222 Histologic and Cytologic Analyses 223 Ten adult livers were fixed in 4% paraformaldehyde in 224 phosphate-buffered saline (P6748; Sigma), embedded in 225 paraffin, and sectioned at 5-mm thickness using a micro- 226 tome, followed by H&E, PicroSirus Red, Gomori’s trichome, 227 immunohistochemistry (IHC), or immunofluorescence (IF) 228 stainings H&E (H-3404; Vector), Picrosirius Red (24901B; Q21 229 Polyscience, Inc), and Gomori’s trichome (87021; Thermo 230 Scientific) stainings were conducted according to the man- Q22 231 ufacturers’ protocols For IHC and IF stainings, the primary 232 antibodies were derived mostly from rabbits, including anti- 233 PCNA (FL-261; Santa Cruz), anti–caspase (C92-065; BD Q23 234 Photography and Image Analysis FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC - 235 236 237 238 239 Q24 240 241 242 243 244 245 246 247 248 249 Q25 250 Q26 251 Q27 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 2017 Serotonin and HCC Sex Disparity Biosciences), antiserotonin (C5545; Sigma), anti-TgfB1 (04-953; Millipore), anti-PTph (SC135716; Santa Cruz), anti–a-smooth muscle actin (a-Sma) (ab15734; Abcam), anti-PSmad2 (3101; Cell Signaling) and anti–collagen I (ab23730; Abcam), except for anti-Gfap (154474; Abcam) from the mouse Anti-rabbit or anti-mouse secondary antibodies were purchased from Thermo Fisher Scientific At least fish from each treatment group were examined and high-power field was selected randomly from each fish liver and IF signals were counted manually for quantitative analyses Human Patient Samples Paraffin-embedded human liver disease progression tissue microarray slides were purchased from Biomax, Inc (LV8011a) Patients were classified into groups: normal (n ¼ 5), inflammation (n ¼ 7), cirrhosis (n ¼ 16), and HCC (n ¼ 30) Histopathology of all patients was diagnosed by a pathologist based on the information provided from Biomax, Inc (https://www.biomax.us/tissue-arrays/Liver/ LV8011a) Patient samples slides were subjected to H&E staining and IHC staining for serotonin and TGFb1, respectively Statistical Analysis Statistical significance between the groups was evaluated by a 2-tailed unpaired Student t test using inStat version 5.0 for Windows (GraphPad, San Diego, CA) Statistical data are presented as means ± SDs Results More Aggressive HCC Progression in Male KrasV12-Expressing Livers In human patients, men develop more aggressive HCC with larger tumors and a lower survival rate than women.28–30 To examine if our krasV12-expressing HCC zebrafish model recapitulated the sex disparity, male and female adult krasỵ zebrash were exposed to dox for days Initial gross morphologic examination of these krasỵ zebrash showed signicantly enlarged livers in krasỵ males than in krasỵ females after days of dox induction (Figure 1A) Histologically, krasV12-expressing livers in males showed more advanced HCC phenotype than that in females In males, krasV12-expressing hepatocytes were densely situated with lost organization of the typical 2-cell hepatic plates; these are typical features of carcinoma In contrast, female krasV12expressing livers were either hyperplastic or adenoma; these livers largely maintained the 2-cell plate but had a more prominent nucleoli and vacuolated cytoplasm (Figure 1A) As summarized in Figure 1A, 60% of female krasV12-expressing livers showed adenoma histology and the remaining 40% had hepatic hyperplasia; in contrast, 100% of the male krasV12-expressing livers showed carcinoma histology To further investigate the mechanism behind this sex disparity, the cell proliferation, apoptosis, and extent of hepatic fibrosis were examined As expected, krasV12expressing hepatocytes had higher rates of cell proliferation 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 Accelerated Carcinogenesis in Male 309 KrasV12-Expressing Livers Correlated With 310 Increased HSC Density and Serotonin Synthesis 311 In human HCC, male HCC patients have a higher HSC 312 density than female patients and a high HSC density signals 313 a poor prognosis.15,16 Hence, HSC density and activation 314 were investigated in our krasỵ HCC zebrash model Gfapỵ 315 cells in the liver demarcate both activated and quiescent 316 HSCs.32 IF staining of Gfap on HSC reporter transgenic 317 zebrash, hand2ỵ, showed nearly 90% hand2ỵ cells were 318 positive for Gfap staining in the liver; similarly, 89% of 319 Gfapỵ cells were hand2ỵ cells (Figure 2AC) Thus, there 320 was high overlap between the molecular markers for Q28 321 HSCs.22 a-Sma is a marker for activated HSC33; hence, 322 Gfapỵ/a-Smaỵ cells in the liver were used to indicate 323 activated HSCs (Figure 2D) With krasV12 expression, both 324 total HSC density and the percentage of activated HSCs were 325 significantly higher in male krasV12-expressing livers than 326 female (Figure 2E), indicating sex disparity in HSC activation 327 328 in krasV12-expressing livers Serotonin has been shown to play an activating role on 329 HSCs via 5-hydoxytryotamine receptor 2B (Htr2b) in a Q29 330 mouse liver regeneration model.34 To investigate if htr2b 331 played a role in sex disparity in the krasỵ HCC model in 332 zebrash, reverse-transcription quantitative PCR was per- 333 formed in fluorescence-activated cell sorting–isolated 334 hepatocytes, neutrophils, macrophages, HSCs and chol- 335 angiocytes Htr2b was found to be expressed the most 336 strongly in both male and female HSCs, with marginal 337 expression in neutrophils and macrophages, but almost no 338 expression was found in hepatocytes and cholangiocytes of 339 both sexes (Figure 3A) Overall, the levels of htr2b expres- 340 sion was higher in males than in females in all cell types 341 examined 342 To account for the increased HSC density and activation, 343 serotonin level was examined in male and female krasV12- 344 expressing livers Interestingly, IF staining of serotonin 345 indicated a more significantly increase in krasV12-expressing 346 hepatocytes in males than in females (Figure 3B and C) To 347 investigate the sex difference in serotonin level, expression 348 of tryptophan hydroxylase 1a (Tph1a), the rate-limiting 349 enzyme for serotonin biosynthesis, was examined Male 350 krasV12-expressing hepatocytes showed an 8-fold increase in 351 tph1a messenger RNA expression (Figure 3D) Tph1 can 352 and apoptosis than their wild-type (WT) siblings (Figure 1B and C) When comparing the sexes, male krasV12-expressing hepatocytes had a significantly higher numbers of proliferating but not apoptotic cells than female krasV12-expressing hepatocytes The extent of liver fibrosis could be a marker for early HCC.31 By IF staining, male krasV12-expressing livers showed a significantly higher expression of collagen I than WT siblings and also female krasV12-expressing livers, reflecting its more advanced liver disease status (Figure 1D) Picrosirius Red and Gomori’s trichrome staining, both of which stained for fibrotic tissues, showed consistent results with collagen I staining (Figure 1E and F) FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 web 4C=FPO Yang et al Cellular and Molecular Gastroenterology and Hepatology Vol -, No - 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 V12 Figure Sex disparity in kras -induced HCC progression Three-month-old adult zebrafish were treated with 30 mg/L 457 dox for days and examined by various assays as described below (A) Gross morphology and histology of krasỵ and WT Q34 458 (control) male and female zebrafish after dox exposure Male krasV12-expressing liver (green for green fluorescent protein 459 expression) were enlarged significantly as compared with female krasV12-expressing liver and also with WT male and female 460 livers (dotted line enclosed) Bottom left: H&E staining of the liver sections of dox-treated krasỵ and WT (control) male and 461 female zebrash Right: Quantification of tumor histology observed in the H&E-stained liver sections of dox-treated krasỵ male 462 and female zebrash is shown (n ¼ 10 each group) (B–D) IF staining of (B) PCNA, (C) caspase 3, and (D) collagen I in liver sections of dox-treated krasỵ and WT male and female zebrash Quantifications of stained cells are shown on the right (n > 463 in each group) (E) Picrosirius Red staining of the liver sections of dox-treated krasỵ and WT male and female zebrafish 464 Quantification of fibrotic liver tissue area in Picrosirius Red–stained liver sections is shown on the right (n > 10 in each group) 465 (F) Gomori’s trichrome staining of the liver sections of dox-treated krasỵ and WT male and female zebrafish Quantification of 466 fibrotic liver tissue area in Gomori’s trichrome–stained liver sections is shown on the right (n > in each group) *P < 05 Scale 467 bars: (A) 50 mm (top row), 20 mm (bottom row), (D–F) 500 mm, (E) 50 mm, and (B and C) 20 mm DAPI, 40 ,6-diamidino-2- 468 phenylindole 469 470 FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 web 4C/FPO - Q30 2017 Serotonin and HCC Sex Disparity 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 Figure Sex disparate increase of HSCs and activated HSCs after krasV12 induction (A) Overlap of hand2ỵ and Gfap 564 expression Gfap expression was examined in liver sections of hand2ỵ transgenic sh with 40 ,6-diamidino-2-phenylindole 565 (DAPI) staining for nuclei (blue) days after fertilization (B) Percentage of Gfapỵ HSCs as marked by hand2:gfp expres- 566 sion in liver sections (n ẳ 20) (C) Percentage of hand2ỵ HSCs as marked by Gfapỵ expression in liver sections (n ẳ 20) (D) IF 567 co-staining of GFAP (red, general HSCs) and a-Sma (green, activated HSCs) in liver sections of adult zebrafish Three-month- 568 old krasỵ and WT, male and female zebrash were treated with 30 mg/L dox for days Total HSCs, activated HSCs, and serotonin were examined as described below White boxes indicate enlarged regions shown on the right of each photograph 569 Arrows indicate Gfapỵ cells (E) Quantication of HSC density (Gfapỵ, top) and percentages of activated HSCs (Gfapỵ/ 570 Q35 571 a-Smaỵ, bottom) in liver sections (n > in each group) *P < 05 Scale bar: 20 mm 572 573 undergo phosphorylation to enhance protein stability.35 IF between sexes, serotonin and the Htr2b-receptor agonist 574 staining of P-Tph1 in liver sections showed a higher BW723C86 were used to detect krasỵ female zebrash and 575 expression of the phosphorylated enzyme in male krasV12- the Tph1 inhibitor PCPA and the Htr2b-receptor antagonist 576 expressing hepatocytes than female krasV12-expressing he- SB204741 were used for krasỵ male zebrash for days 577 patocytes (Figure 3B and E), suggesting that the sex Gross morphology of both serotonin- and BW723C86- 578 disparity in serotonin levels was owing to the higher treated krasỵ females showed significantly enlarged livers 579 expression and phosphorylation of Tph1a in males than in as compared with WT control females In contrast, krasỵ 580 females male zebrash showed a signicant deterrence of liver 581 enlargement with exposure to PCPA or SB204741 582 (Figure 4A and B) Histologically, exposure to serotonin or 583 Serotonin Promotes KrasV12-Induced activation of the Htr2b receptor significantly accelerated the 584 Carcinogenesis in Zebrafish via Activation of the rate of carcinogenesis because an increased portion of 585 female krasV12-expressing livers showed a loss of 2-cell 586 Htr2b Receptor in HSCs To examine if serotonin or Htr2b-receptor activation hepatic plate However, decreased percentages of fish with Q31 587 contributed significantly to the differential rates of HCC HCC histology were observed in male krasV12-expressing 588 FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 Yang et al Cellular and Molecular Gastroenterology and Hepatology Vol -, No - 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 web 4C/FPO FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC - 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 2017 Serotonin and HCC Sex Disparity 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 Serotonin-Activated HSCs Promote 796 Carcinogenesis and Serotonin 797 798 Synthesis via Tgfb1 799 It has been reported previously that serotonin is capable 800 of activating HSCs via the Htr2b receptor.34 To investigate if 801 serotonin was responsible for the sex disparity in HSC 802 density through controlling the Htr2b downstream 803 signaling, IF co-staining of Gfap and a-Sma was performed 804 on both female and male krasV12-expressing livers As 805 shown in Figure 6A, activation of Htr2b signaling by 806 BW723C86 but not serotonin significantly increased both 807 the total HSC density and percentage of activated HSCs 808 whereas inhibition of serotonin synthesis by PCPA or inhi809 bition of Htr2b signaling by SB204741 decreased both the 810 density and percentage of activated HSCs, as compared with 811 female or male krasV12-expressing livers, respectively 812 813 814 V12 Q36 Figure (See previous page) Htr2b expression and serotonin production after kras induction (A) Expression of htr2b in hepatocytes, HSCs, neutrophils, macrophages, and cholangiocytes These cells were isolated by fluorescence-activated 815 cell sorting based on DsRed, GFP, DsRed, mCherry, and GFP expression, respectively from fabp10ỵ, hand2ỵ, lyzỵ, 816 mpegỵ, and tp1ỵ transgenic zebrash Total RNA was extracted and htr2b expression was determined by reverse- 817 transcription quantitative PCR Relative expression levels are shown with the value from female hepatocytes set as (B) IF 818 co-staining of Hnf4a/Serotonin (top) and Hnf4a/P-Tph1 in liver sections Three-month-old krasỵ and WT, male and female 819 zebrash were treated with 30 mg/L dox for days Serotonin and P-Tph level were examined as described below (C) 820 Quantification of serotonin-positive hepatocytes in these zebrafish (n > in each group) (D) Reverse-transcription quantitative 821 PCR determination of tph1b expression in hepatocytes isolated by fluorescence-activated cell sorting from dox-treated krasỵ and fabpỵ (kras- control) male and female sh Fold change is shown between males and females in WT and krasỵ sh (E) 822 Quantication of percentage of P-Tph1positive hepatocytes in these zebrafish (n > in each group) *P < 05 Scale bar: 20 823 mm DAPI, 40 ,6-diamidino-2-phenylindole 824 livers after exposure to PCPA or SB204741 (Figure 4C) As summarized in Figure 4C, 75% and 38% of female krasV12expressing livers showed HCC histology when exposed to serotonin and BW723C86, respectively In contrast, 25% and 20% of male krasV12-expressing livers showed milder histology when exposed to PCPA and SB204741, respectively Cytologic analysis of cell proliferation was consistent with morphologic and histologic changes After days of dox exposure, male krasV12-expressing livers had a significantly higher level of proliferating cells than females Exposure of serotonin or BW723C86 to krasỵ females significantly increased the level of proliferating cells Conversely, exposure of SB204741 and PCPA significantly reduced the number of proliferating cells (Figure 4D) In contrast, exposure to PCPA or SB204741 to krasỵ males increased apoptotic liver cells signicantly (Figure 4E) IF staining of collagen I, Picrosirius Red, or Gomori’s trichrome staining consistently indicated an increased collagen deposition in the extracellular matrix when comparing male and female krasV12-expressing livers (Figure 5) Exposure of krasỵ female sh to BW723C86 increased collagen deposition as compared with krasỵ female controls In contrast, exposure to either SB204741 or PCPA decreased collagen deposition as compared with male krasỵ control (Figure 5) Hence, either serotonin or the activation of the Htr2b receptor could accelerate carcinogenesis significantly in our krasV12-expressing model (Figure 6A) Thus, serotonin regulates HSCs through Htr2b, which could increase both the proliferation and activation of HSCs It has been reported that Htr2b activation is required for both HSC survival and tgfb1a expression.34 To further elucidate the molecular outcome of Htr2b activation, expression of tgfb1a was examined in various cell types in the liver, including hepatocytes, HSCs, neutrophils, macrophages, and cholangiocytes As shown in Figure 6B, HSCs had the highest level of tgfb1a expression in both male and female adult zebrafish (Figure 6B) Treatments with serotonin or BW723C86 significantly increased the percentage of Tgfb1-expressing HSCs in female krasV12-expressing livers whereas treatments with PCPA or SB204741 significantly decreased HSCs of male krasV12-expressing livers (Figure 6C) IF co-staining of Gfap with caspase-3 or Tgfb1 also was performed to show apoptotic HSCs (Gfapỵ/ Cas3ỵ) In contrast, the percentage of apoptotic HSCs remained unchanged in female krasV12-expressing livers exposed to serotonin or BW723C86, but there was a significant increase in apoptotic HSCs in male krasV12expressing livers exposed to PCPA or SB204741 (Figure 6D) In contrast, therefore, serotonin activation of Htr2b signaling in HSCs is necessary for HSC survival as well as increased Tgfb1 expression Curiously, IF staining of serotonin indicated that BW723C8 activation of Htr2b in female krasV12-expressing hepatocytes increased serotonin significantly, suggesting increased Tgfb1 or HSCs activation could promote serotonin synthesis (Figure 7A) To confirm the role of HSCs or Tgfb1 in serotonin synthesis, 3-month-old adult krasỵ male zebrash were exposed to either SB204741 or SB431542 (Tgfb receptor inhibitor) for days Inhibition of HSCs or Tgfb signaling relaxed the HCC histology in male krasV12expressing livers (Figure 7B) Cytologic analysis of proliferating cells showed a significant decrease with both SB204741 and SB431541 exposure (Figure 7C) Tgfb1 is known to induce both cell senescence and apoptosis.36,37 b-galactosidase staining for senescent cells showed no difference between 3-month-old adult krasỵ female and krasỵ male zebrash after exposure to SB204741 or SB431542 (data not shown), whereas IF staining of caspase3 showed significantly higher apoptotic cells with either SB204741 or SB431542 exposure to krasỵ males (Figure 7D) Notably, both SB204741- and SB431542treated zebrash showed decreased Tgfb1 expression and FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC Cellular and Molecular Gastroenterology and Hepatology Vol -, No - 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 Figure Effects of serotonin level and HSC activation on krasV12-induced carcinogenesis Three-month-old adult 936 zebrafish were treated with dox with or without serotonin, BW23C86, PCPA, and SB204741 for days (A) Gross Q37 morphology and H&E staining of liver sections (B) Quantification of tumor size as a percentage of total abdominal area (C) 937 Quantification of tumor histology observed in the H&E-stained liver sections of these zebrafish is shown on the right (n > in 938 each group) (D and E) IF staining and quantication of (D) PCNAỵ and (E) caspase 3ỵ cells in liver sections of these 939 zebrafish (n > 8) *P < 05 Scale bars: (A) 50 mm (top row) and 20 mm (bottom row), and (D and E) 20 mm DAPI, Q38 940 40 ,6-diamidino-2-phenylindole 941 942 web 4C/FPO 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 Yang et al FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC - Serotonin and HCC Sex Disparity web 4C/FPO 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 Q32 995 996 997 998 999 1000 1001 2017 Figure Effects of serotonin level and HSC activation on krasV12-induced liver fibrosis Three-month-old adult zebrafish were treated with dox with or without serotonin, BW23C86, PCPA, and SB204741 for days (A) IF staining of collagen I antibody and quantification of fibrotic liver tissue area in collagen I antibody–stained liver sections (n > in each group) (B) Staining and quantification of fibrotic liver tissue area in Picrosirius Red–stained liver sections (n > in each group) (C) Staining and quantification of fibrotic liver tissue area in Gomori’s trichrome–stained liver sections (n > in each group) *P < 05 Scale bars: (A) 50 mm, and (B and C) 500 mm DAPI, 40 ,6-diamidino-2-phenylindole corresponding down-regulation of P-Erk and P-Smad2 signaling (Figure 7E and F), suggesting that inhibition of Htr2b-mediated HSC activation or inhibition of Tgfbr2 decreased both Tgfb1 expression and its downstream signaling Interestingly, inhibition of both HSC activation and Tgfb1 signaling showed an inhibition of Tph1 phosphorylation and hence the serotonin production (Figure 7G and H), suggesting a potential role of HSC and their secreted Tgfb1 in regulating Tph1 activity Sex Differences in Serotonin and TGFB1 Level in Human Liver Disease Patients In human liver diseases, serum serotonin levels have been shown to increase significantly in patients with FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 Yang et al Cellular and Molecular Gastroenterology and Hepatology Vol -, No - 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 web 4C/FPO 10 FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC - 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 2017 Serotonin and HCC Sex Disparity 11 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 Discussion 1260 Higher Expression of Serotonin in Males 1261 1262 HSCs Maintain Sex Disparity in HCC via a Contributed to Sex Disparity via Htr2b 1263 Serotonin/Tgfb1 Loop Activation of HSCs In our investigation of human liver disease samples, In our zebrafish study, serotonin level was found to be 1264 serotonin levels were increased significantly in inflamma- dependent on Htr2b activation A role of TGFB1 in the 1265 tion and cirrhosis, and marginally in HCC samples as regulation of TPH1 expression and phosphorylation via ERK 1266 compared with normal liver control samples This is and SMAD pathways has been shown in human cells.42,43 1267 consistent with a previous observation that serotonin was a Depletion of HSCs via Htr2b antagonist and inhibition of 1268 more sensitive serum marker for cirrhosis and HCC than a- Tgfb signaling in krasV12-expressing livers of male zebrafish 1269 fetoprotein.32 The level of serotonin in HCC was significantly inhibited P-Tph1 and serotonin expression, suggesting that 1270 lower than in inflammation and cirrhosis samples, sug- the role of activated HSCs on serotonin synthesis is medi- 1271 gesting that the contribution of serotonin to liver diseases is ated by Tgfb signaling Hence, the robust activation of HSCs 1272 possibly more important in early phases of the progression via Htr2b in male krasV12-expressing livers would establish 1273 to HCC Notably, in the cohort of human patients we a positive feedback loop, ensuring constant and high levels 1274 analyzed, an apparent sex-dependent accumulation was of serotonin synthesis, thus accelerating carcinogenesis via 1275 observed in both inflammation and cirrhosis samples the multifunctional cytokine, Tgfb1 Although this molecular 1276 because serotonin was generally not detected in female mechanism similarly would exist in female krasV12- 1277 patients of both stages This is in line with the prevailing expressing livers, the lower initial P-Tph level would result 1278 knowledge that men have a significantly higher rate of in the initiation of a less-robust feedback loop This is at 1279 serotonin synthesis than women.39 Our zebrafish studies least in part consistent with our analyses on human liver 1280 recapitulated the sex disparity of serotonin accumulation, disease samples TGFB1 showed a similar sex-biased 1281 which likely can be attributed to the difference in the expression in inflammation, cirrhosis, and HCC patients 1282 expression and phosphorylation of rate-limiting enzyme However, significant correlation between serotonin and 1283 Tph1a A previously conducted study suggested androgen to TGFB1 was observed only in inflammation and cirrhosis 1284 be responsible for the activation of Tph1 in macaques, thus samples but not in HCC patients, possibly because of many 1285 1286 1287 Figure (See previous page) Manipulation of serotonin level and HSC density affects HSC activation and apoptosis 1288 (A) IF staining and quantication of HSC density (Gfapỵ) in liver sections (n > in each group) Three-month-old adult 1289 zebrafish were treated with dox with or without serotonin, BW23C86, PCPA, and SB204741 for days Percentages of 1290 activated HSCs (Gfapỵ/a-Smaỵ) in the liver sections (n > in each group) (B) Expression of tgfb1 in hepatocytes, HSCs, 1291 neutrophils, macrophages, and cholangiocytes These cells were isolated by fluorescence-activated cell sorting based on 1292 DsRed, GFP, DsRed, mCherry, and GFP expression, respectively, from fabp10ỵ, hand2ỵ, lyzỵ, mpegỵ, and tp1ỵ transgenic Q39 1293 zebrafish Total RNAs were extracted and htr2b expression was determined by reverse-transcription quantitative PCR Relative expression levels are with the values with female hepatocytes set as (C and D) IF staining and quantication of 1294 percentages of (C) TgfB1ỵ HSCs (Gfapỵ/Tgfb1ỵ) and (D) apoptotic HSCs in the liver sections as described in panel A n > in 1295 each group *P < 05 Scale bar: 20 mm 1296 cirrhosis and HCC.38 To observe if the sex disparate serotonin levels observed in our krasV12 HCC zebrafish model would be reflected in human patients, a panel of liver disease samples, including normal, liver inflammation, cirrhosis, and HCC, were analyzed for levels of serotonin and TGFB1 Each sample then was stained for H&E, serotonin, and TGFB1, respectively (Figure 8A–C) Notably, serotonin levels in inflammation and cirrhosis samples were significantly higher in males than in females (Figure 8D) This sex disparity was less evident in HCC samples but still was very significant Similarly, male-biased TGFB1 expression also was evident in inflammation, cirrhosis, and HCC samples Serotonin and TGFB1 protein showed a positive and significant correlation in both inflammation and cirrhosis patients, suggesting the molecular mechanism of serotonininduced TGFB1 expression potentially translated in this cohort of patients However, the correlation between the molecules was abrogated in HCC patients, suggesting other confounding factors might contribute to TGFB1 expression in HCC patients (Figure 8E) providing a link to the sex difference in serotonin.40 The sex differential production of serotonin and HSC density and activation also similarly were observed in other oncogeneinduced (xmrk and Myc) zebrafish HCC models generated in our laboratory18,19; thus, the involvement of serotonin and HSCs in the sex disparity of HCC is not oncogenespecific (our unpublished observations) Serotonin can act on a variety of serotonin receptors We showed that Htr2b was highly expressed in HSCs, consistent with a previously reported mouse study.34 The sex disparity in serotonin synthesis resulted in a higher rate of Htr2b-mediated activation of HSCs in males than in females, and led to both a higher density of total HSCs and a higher percentage of activated HSCs, in line with a human HCC patient study in which male patients had a higher density of HSCs than female patients.16 In this study, increased Htr2b activation in HSCs resulted in overexpression of Tgfb1 Both inactivation of HSCs and depletion of TgfB1 signaling significantly relaxed the rate of carcinogenesis in male krasV12-expressing livers, consistent with the current notion that TGFB1 acts as a protumor cytokine in human HCC.41 FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC 12 Yang et al Cellular and Molecular Gastroenterology and Hepatology Vol 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 -, No - web 4C=FPO 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 Figure Tgfb1 promotes 1372 serotonin synthesis and 1373 krasV12-induced carcino- 1374 genesis Three-month-old 1375 adult zebrafish were 1376 treated for days with 30 1377 mg/L dox with or without mmol/L serotonin, 1378 BW23C86, PCPA, and 1379 SB204741 (A) IF staining 1380 of serotonin in liver section 1381 of these zebrafish These 1382 slides also were co-stained 1383 for hepatocytes (HNF4a) 1384 and nuclei (40 ,6-diamidino2-phenylindole [DAPI]) 1385 Right: Quantification of 1386 serotonin-positive liver 1387 cells as percentages of 1388 hepatocytes (n ¼ 10) 1389 Three-month-old Male 1390 krasV12-expressing zebra1391 fish were treated with dox with or without 1392 SB204741 and SB431542, 1393 respectively (B) Gross 1394 morphology and H&E 1395 staining of liver sections of 1396 these zebrafish Quantifi- 1397 cation of tumor histology observed in the H&E- 1398 stained liver sections of Q40 1399 these zebrafish (n > in 1400 each group) (C–H) IF 1401 staining and quantification 1402 of (C) PCNAỵ, (D) caspase 1403 3ỵ, (E) P-Erkỵ, (F) P1404 Smad2, (G) P-Tphỵ, and (H) serotoninỵ cells in liver 1405 sections (n > in each 1406 group) *P < 05 Scale 1407 bars: (A) 50 mm (top row) 1408 and 20 mm (bottom row), 1409 and (B–G) 20 mm 1410 1411 1412 1413 1414 FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC - Serotonin and HCC Sex Disparity 13 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 Figure Sex difference in serotonin and TGFB1 levels in human liver disease samples A panel of liver disease samples 1520 from human patients was examined for histology by H&E staining and for serotonin and TGFB1 levels by antibody staining 1521 These samples were categorized into normal, inflammation, cirrhosis, and HCC for both males and females (A) H&E staining of 1522 human liver disease samples (B and C) IHC staining of antibody against (B) serotonin and (C) TGFB1 (D and E) Quantification 1523 of the percentages of (D) serotonin or (E) TGFB1-positive liver cells in inflammation, cirrhosis, and HCC patients (F–H) Quantification of correlation between serotonin with TGFB1 in (F) inflammation, (G) cirrhosis, and (H) HCC patients *P < 05 Q41 1524 1525 Scale bar: 20 mm 1526 1527 other factors affecting TGFB1 expression during disease progression between sexes, which could be attrib- 1528 carcinogenesis uted to the disparity of P-Tph level in the sexes of krasỵ 1529 In summary, as shown in Figure 9, data from both zebrafish We further showed the novel role of serotonin in 1530 zebrafish models and human liver disease samples showed initiating and promoting a sex-disparate tumor microenvi- 1531 the differential accumulation of serotonin during liver ronment via Htr2b activation of HSCs Htr2b-activated HSCs 1532 web 4C/FPO 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 2017 FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC 14 Yang et al Cellular and Molecular Gastroenterology and Hepatology Vol web 4C/FPO 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 Figure Schematic summary of serotonin-activated 1562 HSCs and Tgfb signal in accelerating liver tumorigen1563 esis in krasD-expressing male transgenic fish 1564 1565 expressed Tgfb1, which not only promoted HCC progression 1566 but also increased serotonin synthesis Hence, HSCs not 1567 only promote liver tumor progression but also play a vital 1568 role in maintaining the sex disparity observed in HCC 1569 patients 1570 1571 1572 References 1573 Lee CM, et al Age, gender, and local geographic varia1574 tions of viral etiology of hepatocellular carcinoma in a 1575 hyperendemic area for hepatitis B virus infection Cancer 1576 Q33 1999;86:1143–1150 1577 Mucci LA, Kuper HE, Tamimi R, et al Age at menarche 1578 and age at menopause in relation to hepatocellular 1579 carcinoma in women BJOG 2001;108:291–294 1580 Yu MW, Chang HC, Chang SC, et al Role of reproductive 1581 factors in hepatocellular carcinoma: impact on hepatitis 1582 B- and C-related risk Hepatology 2003;38:1393–1400 1583 Nakatani T, Roy G, Fujimoto N, et al Sex hormone de1584 pendency of diethylnitrosamine-induced liver tumors in mice and chemoprevention by leuprorelin Jpn J Cancer 1585 Res 2001;92:249–256 1586 Naugler WE, Sakurai T, Kim S, et al Gender disparity in 1587 liver cancer due to sex differences in MyD88-dependent 1588 IL-6 production Science 2007;317:121–124 1589 Wolf MJ, Adili A, Piotrowitz K, et al Metabolic activation 1590 of intrahepatic CD8ỵ T cells and NKT cells causes 1591 10 11 12 13 14 15 16 17 18 19 20 21 22 23 -, No - nonalcoholic steatohepatitis and liver cancer via crosstalk with hepatocytes Cancer Cell 2014;26:549–564 Yang W, Lu Y, Xu Y, et al Estrogen represses hepatocellular carcinoma (HCC) growth via inhibiting alternative activation of tumor-associated macrophages (TAMs) J Biol Chem 2012;287:40140–40149 Li YW, Qiu SJ, Fan J, et al Intratumoral neutrophils: a poor prognostic factor for hepatocellular carcinoma following resection J Hepatol 2011;54:497–505 Krizhanovsky V, Yon M, Dickins RA, et al Senescence of activated stellate cells limits liver fibrosis Cell 2008; 134:657–667 Bocca C, et al Angiogenesis and fibrogenesis in chronic liver diseases Cell Mol Gastroenterol Hepatol 2015; 1:477–488 Roth KJ, Copple BL Role of hypoxia-inducible factors in the development of liver fibrosis Cell Mol Gastroenterol Hepatol 2015;1:589–597 Hirsova P, Gores GJ Death receptor-mediated cell death and proinflammatory signaling in nonalcoholic steatohepatitis Cell Mol Gastroenterol Hepatol 2015;1:17–27 Amann T, Bataille F, Spruss T, et al Activated hepatic stellate cells promote tumorigenicity of hepatocellular carcinoma Cancer Sci 2009;100:646–653 Kang N, Gores GJ, Shah VH Hepatic stellate cells: partners in crime for liver metastases? Hepatology 2011; 54:707–713 Ji J, Eggert T, Budhu A, et al Hepatic stellate cell and monocyte interaction contributes to poor prognosis in hepatocellular carcinoma Hepatology 2015;62:481–495 Dai CX, et al Hypoxia-inducible factor-1 alpha, in association with inflammation, angiogenesis and MYC, is a critical prognostic factor in patients with HCC after surgery BMC Cancer 2009;9:418 Chew TW, Liu XJ, Liu L, et al Crosstalk of Ras and Rho: activation of RhoA abates Kras-induced liver tumorigenesis in transgenic zebrafish models Oncogene 2014; 33:2717–2727 Li Z, Huang X, Zhan H, et al Inducible and repressable oncogene-addicted hepatocellular carcinoma in Tet-on xmrk transgenic zebrafish J Hepatol 2012;56:419–425 Li Z, Zheng W, Wang Z, et al A transgenic zebrafish liver tumor model with inducible Myc expression reveals conserved Myc signatures with mammalian liver tumors Dis Model Mech 2013;6:414–423 Nguyen AT, Emelyanov A, Koh CH, et al An inducible kras(V12) transgenic zebrafish model for liver tumorigenesis and chemical drug screening Dis Model Mech 2012;5:63–72 Sun L, Nguyen AT, Spitsbergen JM, et al Myc-induced liver tumors in transgenic zebrafish can regress in tp53 null mutation PLoS One 2015;10:e0117249 Yin C, Evason KJ, Maher JJ, et al The basic helix-loophelix transcription factor, heart and neural crest derivatives expressed transcript 2, marks hepatic stellate cells in zebrafish: analysis of stellate cell entry into the developing liver Hepatology 2012;56:1958–1970 Parsons MJ, Pisharath H, Yusuff S, et al Notchresponsive cells initiate the secondary transition in larval zebrafish pancreas Mech Dev 2009;126:898–912 FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 - 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709 2017 Serotonin and HCC Sex Disparity 24 Hall C, Flores MV, Storm T, et al The zebrafish lysozyme C promoter drives myeloid-specific expression in transgenic fish BMC Dev Biol 2007;7:42 25 Ellett F, Pase L, Hayman JW, et al mpeg1 promoter transgenes direct macrophage-lineage expression in zebrafish Blood 2011;117:e49–e56 26 Korzh S, Pan X, Garcia-Lecea M, et al Requirement of vasculogenesis and blood circulation in late stages of liver growth in zebrafish BMC Dev Biol 2008;8:84 27 Manoli M, Driever W Fluorescence-activated cell sorting (FACS) of fluorescently tagged cells from zebrafish larvae for RNA isolation Cold Spring Harb Protoc 2012;2012:8 28 Dohmen K, Shigematsu H, Irie K, et al Longer survival in female than male with hepatocellular carcinoma J Gastroenterol Hepatol 2003;18:267–272 29 Farinati F, Sergio A, Giacomin A, et al Is female sex a significant favorable prognostic factor in hepatocellular carcinoma? Eur J Gastroenterol Hepatol 2009; 21:1212–1218 30 Hefaiedh R, Ennaifer R, Romdhane H, et al Gender difference in patients with hepatocellular carcinoma Tunis Med 2013;91:505–508 31 Huang M, Chang A, Choi M, et al Antagonistic interaction between Wnt and Notch activity modulates the regenerative capacity of a zebrafish fibrotic liver model Hepatology 2014;60:1753–1766 32 Morini S, Carotti S, Carpino G, et al GFAP expression in the liver as an early marker of stellate cells activation Ital J Anat Embryol 2005;110:193–207 33 Carpino G, Morini A, Ginanni Corradini S, et al AlphaSMA expression in hepatic stellate cells and quantitative analysis of hepatic fibrosis in cirrhosis and in recurrent chronic hepatitis after liver transplantation Dig Liver Dis 2005;37:349–356 34 Ebrahimkhani MR, Oakley F, Murphy LB, et al Stimulating healthy tissue regeneration by targeting the 5HT(2)B receptor in chronic liver disease Nat Med 2011; 17:1668–1673 35 Huang Z, Liu T, Chattoraj A, et al Posttranslational regulation of TPH1 is responsible for the nightly surge of 5-HT output in the rat pineal gland J Pineal Res 2008; 45:506–514 36 Senturk S, Mumcuoglu M, Gursoy-Yuzugullu O, et al Transforming growth factor-beta induces senescence in 15 1710 1711 37 1712 1713 1714 38 1715 1716 1717 1718 39 1719 1720 1721 1722 40 1723 1724 1725 1726 41 1727 1728 1729 42 1730 1731 1732 43 1733 1734 1735 1736 1737 1738 Received August 3, 2016 Accepted January 5, 2017 1739 Q1 Correspondence 1740 Address correspondence to: Zhiyuan Gong, MD, Department of Biological Q2 1741 Sciences, National University of Singapore, Singapore 117543 e-mail: dbsgzy@nus.edu.sg; fax: (65)-67792486 1742 1743 Acknowledgment Chuan Yan, Qiqi Yang, and Zhiyuan Gong conceived and designed the 1744 experiments; Qiqi Yang and Chuan Yan performed the experiments; Qiqi 1745 Yang, Chuan Yan, Chunyue Yin, and Zhiyuan Gong analyzed the data; Chuan Yan, Qiqi Yang, and Zhiyuan Gong wrote the paper; and Chunyue Yin 1746 provided material 1747 Conflicts of interest 1748 Q3 The authors disclose no conflicts 1749 1750 Funding Supported by research grants from the National Medical Research Council and 1751 the Ministry of Education of Singapore The sponsors had no role in the study Q4 1752 design, or the collection, analysis, or interpretation of data 1753 1754 1755 1756 1757 1758 1759 1760 1761 1762 1763 1764 1765 1766 1767 1768 hepatocellular carcinoma cells and inhibits tumor growth Hepatology 2010;52:966–974 Jang CW, Chen CH, Chen CC, et al TGF-beta induces apoptosis through Smad-mediated expression of DAP-kinase Nat Cell Biol 2002;4:51–58 Abdel-Razik A, Elhelaly R, Elzehery R, et al Could serotonin be a potential marker for hepatocellular carcinoma? A prospective single-center observational study Eur J Gastroenterol Hepatol 2016;28:599–605 Nishizawa S, Benkelfat C, Young SN, et al Differences between males and females in rates of serotonin synthesis in human brain Proc Natl Acad Sci U S A 1997; 94:5308–5313 Bethea CL, Reddy AP, Robertson N, et al Effects of aromatase inhibition and androgen activity on serotonin and behavior in male macaques Behav Neurosci 2013; 127:400–414 Giannelli G, Villa E, Lahn M Transforming growth factorbeta as a therapeutic target in hepatocellular carcinoma Cancer Res 2014;74:1890–1894 Imbe H, Senba E, Kimura A, et al Activation of mitogenactivated protein kinase in descending pain modulatory system J Signal Transduct 2011;2011:468061 Estevez M, Estevez AO, Cowie RH, et al The voltagegated calcium channel UNC-2 is involved in stressmediated regulation of tryptophan hydroxylase J Neurochem 2004;88:102–113 FLA 5.4.0 DTD Š JCMGH191 proof Š February 2017 Š 5:03 pm Š ce DVC