278 gene therapy of erythropoietic porphyria mice with induced pluripotent stem cells

278 Gene Therapy of Erythropoietic Porphyria Mice with Induced Pluripotent Stem Cells Molecular Therapy Volume 20, Supplement 1, May 2012 Copyright © The American Society of Gene & Cell Therapy S109 P[.]

PLURIPOTENT STEM CELLS 277 Time-Dependent Effects of Synthetic Double-Stranded RNA on Eag1 Potassium Channel mRNA Content from Human Glioma Cells Ludmylla C Cunha,1 André S Leonardo,1 Elaine Del-Bel,2 Luis A Pardo,3 Walter Stühmer,3 Ricardo Titze-de-Almeida.1 Lab Tecnologias para Terapia Gênica, FAV, University of Brasilia, UnB, Brasilia, DF, Brazil; 2Laboratório de Neurofisiologia e Biologia Molecular, FORP, University of São Paulo, USP, Ribeirão Preto, SP, Brazil; 3Molecular Biology of Neuronal Signals, Max-Planck Institute for Experimental Medicine, Göttingen, Germany Figure Effects of siRNA e28_hnNOS on nNOS content at time points h, 24 h, and 48 hours post-transfection Dotted line represents the scramble negative control values 276 RNAi-Based Therapeutics Targeting nNOS for Prevention of Neuroblastoma Cell Apoptosis Cátia F Lustosa,1 Simoneide S Silva,1 Nádia R Ferreira,2 Elaine Del-Bel,2 Ricardo Titze-de-Almeida.1 Lab Tecnologias para Terapia Gênica, FAV, University of Brasília - UnB, Brasília, DF, Brazil; 2Lab Neurofisiologia e Biologia Molecular, FORP, University of São Paulo - USP, Ribeirão Preto, SP, Brazil The death of neurons by apoptosis is a key step in natural history of various degenerative diseases The nNOS enzyme is expressed in brain areas submitted to injury, and its blocking can decrease its neurotoxic effects This study was aimed to test an RNAi-based strategy targeting nNOS to prevent cellular apoptosis Firstly, neuroblastoma cells (ATCC® CRL-2266™ - SH-SY5Y) were plated in 96-well plates (5X104 cells/well) and incubated for 24 hours with the injuring agent neomycin® (300 μg/ml, Sigma) After that, cells received 0.2 μg of plasmid vectors mixed with Lipofectamine® (Invitrogen) and were incubated for 48h The two vectors used in our study contained the shRNA 28_hnNOS sequence (pe28_hnNOS) or a scrambled negative control sequence (pScramble) cloned into pSilencerTM 3.1-H1 (Applied Biosystems, Ambion®) Finally, the cell viability was determined by using the colorimetric MTT (3-(4, 5)-dimethylthiahiazol-2-y1)-2, 5-diphenyltetrazolium bromide) assay For that, 15 μL of the MTT-labeling reagent (0.5 mg/mL, Invitrogen) was added to each well and the plate was maintained at 37°C in a humidified atmosphere of 5% CO2 and 95% air for an additional 3h-period The insoluble formazan was dissolved with dimethylsulfoxide and the determination of MTT reduction was measured at 595 nm Control cells without treatment were taken as 100% viability Each treatment was performed in triplicate and the absorbance values were averaged The assays were repeated three times The nNOS expression plasmid vectors (pe28_hnNOS) increased the viability of neuroblastoma cells injured by neomycin to 10% compared to control, when administrated 48h after injury In conclusion we reported here an RNAi-based strategy targeting nNOS that prevented the neuronal cell death in vitro, which hold promise for treatment of neurodegenerative diseases Ether go-go (Eag) potassium channels are natively expressed in mammalian brain regions Most cancer cell lines and tumor tissues also express Eag1, the prototypic Eag potassium channel In the present study, we follow the time course of siRNA effects on Eag1 mRNA content from glioma cells in culture For that, we used small interfering RNA (siRNA) sequences synthetized by Qiagen targeted to the previously described mRNA Eag1 interfering sequence GTCCACTTGGTCCATGTCCAG The siRNA was transfected (150pmol) into glioma cells (U251MG) in culture using Lipofectamine® (Invitrogen) Cells were incubated with equilibrated-siRNA transfection reagent mix for 4, and 48 h The negative control siRNA was the commercial scramble All-Star® (Qiagen) We used commercial kits for RNA extraction (RNeasy Plus MiniKit®, Qiagen) and reverse transcription (SuperScript™ First-Strand Synthesis System for RT-PCR, Invitrogen) The relative expression (2-ΔΔCT) of Eag1 was determined by using a quantitative PCR protocol (qPCR) with SYBR Green® (Applied Biosystem 7500 Fast Real-Time PCR System) The forward and reverse primers for Eag1 were 5’ – TCTGTCCTGTTTGCCATATGATGT – 3’ and 5’ – CGGAGCAGCCGGACAA – 3’ For the housekeeping gene PAPOLA, we used the primers 5- TGTTGGTCACAGATGCTGCT –3’ and 5’- GCTACGAAGACCAGTCCATTG – 3’ The PCR mixture contained the following reagents: SYBR Green mix 5.0 μL, μL of the reverse transcription reaction mix prepared from RNA 1.5 μg, 0.4 μL of each primer 10 pmol/μL; MilliQ water up to 10 μL The qPCR cycles used in our study were: initial denaturation step at 95°C for min, followed by 40 cycles of amplification (denaturation at 95°C for min, annealing and extension at 60°C for min) Each sample run in triplicate wells in the same plate Relative expressions of Eag1 in treated groups were 0.7, 0.4 and 0.8 fold in comparison to the negative control at 4, and 48 h post-transfection, respectively In conclusion, the siRNA targeting Eag1 produced time-dependent silencing effects on Eag1 mRNA from glioma cells in culture The effects were detectable at h and reached their maximum at h posttransfection A further study would clarify the dose-response curve and the resulting effects on cell Pluripotent Stem Cells 278 Gene Therapy of Erythropoietic Porphyria Mice with Induced Pluripotent Stem Cells Yann Duchartre,1 Magalie Lalanne,1 Véronique GuyonnetDuperat,2 Alice Bibeyran,2 Cécile Ged,1 Pierre Dubus,3 Miguel Taillepierre,1 Aurélie Bedel,1 Hubert de Verneuil,1 Emmanuel Richard.1 INSERM U1035, University Segalen Bordeaux, Bordeaux, France; 2Plateforme de Vectorologie, SFR Transbiomed, Bordeaux, France; 3Histology and Molecular Pathology of Tumors, University Segalen Bordeaux, Bordeaux, France Erythropoietic Porphyrias (EP) are inborn error of haem biosynthesis, resulting from the deficient activity of a specific enzyme of the haem biosynthetic pathway and accumulation of porphyrins in erythroid bone marrow cells, erythrocytes, spleen and liver Porphyrin Molecular Therapy Volume 20, Supplement 1, May 2012 Copyright © The American Society of Gene & Cell Therapy S109 PLURIPOTENT STEM CELLS accumulation is responsible for cutaneous skin photosensitivity whose severity varies between diseases The only curative treatment for severe cases of EP is allogenic bone marrow transplantation (ABMT) that requires an HLA-matched donor Autologous hematopoietic stem cell (HSC) gene therapy represents an alternative to ABMT We have successfully used retroviral vectors for HSC gene therapy in congenital erythropoietic porphyria (CEP) and erythropoietic protoporphyria (EPP) mice However, due to multiple random integrations of integrative vectors, insertional mutagenesis represents a serious side effect that was observed in clinical trials Over the last few years, researchers were able to generate induced pluripotent stem cells (iPSCs) by reprogramming differentiated cells with retroviral expression of stem cell factors (Oct3/4, Sox2, Klf4 and c-Myc) These iPSCs cells shared many properties with embryonic stem cells (selfrenewal and totipotency) and give rise to many cell types, including HSC We have induced and characterised iPSCs lines from EP mice and evaluated their therapeutic potential after genetic correction and hematopoietic differentiation We have reprogrammed adult skin fibroblasts from EPP, CEP and wild type mice with a single integrative lentiviral vector expressing Oct3/4, Klf4 and Sox2 proteins (0.05% efficiency) We obtained iPSCs from the three mice models which presented ES-like morphology and expressed embryonic factors using RT-PCR and immunocytochemistry analysis LoxP sequences in the LTR of the provirus allowed us to remove the reprogramming vector by transient adenoviral expression of the recombinase CRE We showed that reprogramming vector-free iPSCs clones continue to express pluripotent markers and are able to form embryoid bodies in vitro and teratomas in immunodeficient mice For genetic correction of EP iPSCs cells, we used a lentiviral vector expressing either the ferrochelatase (FECH) or the uroporphyrinogen-III-synthase (UROS) cDNA from a chimeric erythroid-specific promoter We used the LAM-PCR to select for safe therapeutic proviral integration, far from known oncogenes The therapeutic efficiency was analysed after hematopoietic differentiation of corrected-iPSCs on OP9 cell stroma We obtained up to 48% CD41+ hematopoietic progenitors cells We are actually performing in vivo hematopoietic repopulation assays in EP mice to evaluate the therapeutical potential of our EPiPSCs-derived hematopoietic progenitor cells Transplanted EP mice will be monitored over time for metabolic and phenotypic correction These experiments represent important steps in the development of preclinical gene therapy protocols for erythropoietic porphyria 279 Derivation and Functional Analysis of Patient Specific Induced Pluripotent Stem Cells as an In Vitro Model of Chronic Granulomatous Disease Ulrich Siler,1 Yan Jiang,3 Sally A Cowley,2 Dario Melguzo,4 Katarzyna Tilgner,3 Cathy Browne,2 Angus deWilton,2 Stefan Pryzborski,5 Gabriele Saretzki,6 William S James,2 Reinhard A Seger,1 Janine Reichenbach,1 Majlinda Lako,1 Lyle Armstrong.1 Immunology, University Children’s Hospital Zürich, Switzerland; James Martin Stem Cell Facility, Sir William Dunn School of Pathology, University of Oxford, United Kingdom; 3Institute of Genetic Medicine, Newcastle University, Newcastle, United Kingdom; 4Centro de Investigacion Principe Felipe, Valencia, Spain; 5School of Biomedical Sciences, University of Durham, United Kingdom; 6Institute for Ageing and Health, Newcastle University, Newcastle, United Kingdom Chronic granulomatous disease (CGD) is an inherited disorder of phagocytes in which NADPH oxidase is defective in generating reactive oxygen species In this study, we reprogrammed three normal unrelated patient’s fibroblasts (p47phox and gp91phox) to pluripotency by lentiviral transduction with defined pluripotency factors These induced pluripotent stem cells (iPSC) share the morphological features of human embryonic stem cells, express the key pluripotency factors S110 and posses high telomerase activity Furthermore, all the iPSC lines formed embryoid bodies in vitro containing cells originating from all three germ layers and were capable of teratoma formation in vivo They were isogenic with the original patient fibroblasts, exhibited normal karyotype and retained the gp47phox or gp91phox mutations found in the patient fibroblasts We further demonstrated that these iPSC could be differentiated into monocytes and macrophages with a similar cytokine profile to blood-derived macrophages under resting conditions Most importantly, CGD-patient specific iPSC derived macrophages showed normal phagocytic properties but lacked reactive oxygen species production, which correlates with clinical diagnosis of CGD in the patients Together these results suggest that CGD-patient-specific iPSC lines represent an important tool for modelling CGD disease phenotypes, screening candidate drugs and the development of gene therapy 280 Generation of Integration-Free iPSCs from an X-CGD Patient’s Blood Cells as Clinically Relevant Target for Gene-Repair Using Designer ZFN or TALEN Jizhong Zou,1 Colin L Sweeney,2 Harry L Malech,2 Linzhao Cheng.1 Division of Hematology, Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, MD; 2Laboratory of Host Defenses, NIAID/NIH, Bethesda, MD Human induced pluripotent stem cells (iPSCs) provided an unlimited cell resource for gene and cell therapy As an alternative approach to current viral vector-based, random integration-mediated gene transfer method, patient-derived iPSCs bearing defined diseasecausing mutations can be precisely corrected by homologous recombination mediated gene targeting, and then indefinitely expanded and differentiated into desired cell lineages for autologous transplantation Current genome engineering technologies offer two powerful DNA sequence-specific nucleases, zinc finger nuclease (ZFN) and transcriptional activator-like effector nuclease (TALEN) to create double-strand break and thus significantly stimulate the efficiency of homologous recombination For clinical applications of iPSCs it is advantageous to develop iPSC using reprogramming vectors and correction plasmids that either not integrate or that can be partially or completely excised following integration To develop clinically applicable iPSCs, we efficiently generated integrationfree patient-specific iPSCs from the CD34+ hematopoietic stem/ progenitor cells of an adult suffering X-chronic granulomatous disease (X-CGD), an inherited immunodeficiency disease caused by mutations in X-linked CYBB gene Using either a single polycistronic or a combination of three EBNA1/OriP-based episomal vectors, we delivered the reprogramming factors efficiently (>60%) to in vitro expanded CD34+ cells We obtained 3∼30 TRA-1-60+ colonies per million transfected CD34+ cells The derived integrationfree X-CGD iPSCs bearing a mutation in CYBB exon have normal ESC-like characteristics (such as AP+, SSEA-4+, OCT4+, NANOG+) and karyotype They form cystic embryoid body(EB) and teratoma containing three germ layer lineages during in vitro and in vivo differentiation, respectively Upon directed hematopoietic differentiation using a serum-free medium, 30∼50% CD34+CD45+ cells were detected 14 days after EB formation The episomal plasmids carrying reprogramming factors were undetectable after 10 passages following the iPSC derivation In order to enhance the gene targeting efficiency, both ZFNs and TALENs targeting the diseasecausing mutation were designed and synthesized Approximately 50% of context-dependent assembly (CoDA)-based designs generate active ZFNs that can boost gene targeting efficiency >100-fold TALEN offers more flexibility, therefore more candidates can be tested around Molecular Therapy Volume 20, Supplement 1, May 2012 Copyright © The American Society of Gene & Cell Therapy ... development of preclinical gene therapy protocols for erythropoietic porphyria 279 Derivation and Functional Analysis of Patient Specific Induced Pluripotent Stem Cells as an In Vitro Model of Chronic... able to generate induced pluripotent stem cells (iPSCs) by reprogramming differentiated cells with retroviral expression of stem cell factors (Oct3/4, Sox2, Klf4 and c-Myc) These iPSCs cells shared... hematopoietic stem cell (HSC) gene therapy represents an alternative to ABMT We have successfully used retroviral vectors for HSC gene therapy in congenital erythropoietic porphyria (CEP) and erythropoietic