a rapid and enhanced dna detection method for crop cultivar discrimination

Journal of Biotechnology 185 (2014) 57–62 Contents lists available at ScienceDirect Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec A rapid and enhanced DNA detection method for crop cultivar discrimination Yuki Monden a , Kazuto Takasaki b , Satoshi Futo b , Kousuke Niwa c , Mitsuo Kawase c , Hiroto Akitake a , Makoto Tahara a,∗ a Graduate School of Environmental and Life Science, Okayama University, 1-1-1 Tsushimanaka Kitaku, Okayama, Okayama 700-8530, Japan FASMAC Co., Ltd., 5-1-3 Midorigaoka, Atsugi, Kanagawa 243-0041, Japan c Graduate School of Biomedical Engineering, Tohoku University, 6-6-05 Aramaki-aoba, Sendai, Miyagi 980-8579, Japan b a r t i c l e i n f o Article history: Received 24 February 2014 Received in revised form 14 May 2014 Accepted 10 June 2014 Available online 19 June 2014 Keywords: Cultivar discrimination Multiplex PCR Strawberry Practical application Retrotransposon a b s t r a c t In many crops species, the development of a rapid and precise cultivar discrimination system has been required for plant breeding and patent protection of plant cultivars and agricultural products Here, we successfully evaluated strawberry cultivars via a novel method, namely, the single tag hybridization (STH) chromatographic printed array strip (PAS) using the PCR products of eight genomic regions In a previous study, we showed that genotyping of eight genomic regions derived from FaRE1 retrotransposon insertion site enabled to discriminate 32 strawberry cultivars precisely, however, this method required agarose/acrylamide gel electrophoresis, thus has the difficulty for practical application In contrast, novel DNA detection method in this study has some great advantages over standard DNA detection methods, including agarose/acrylamide gel electrophoresis, because it produces signals for DNA detection with dramatically higher sensitivity in a shorter time without any preparation or staining of a gel Moreover, this method enables the visualization of multiplex signals simultaneously in a single reaction using several independent amplification products We expect that this novel method will become a rapid and convenient cultivar screening assay for practical purposes, and will be widely applied to various situations, including laboratory research, and on-site inspection of plant cultivars and agricultural products © 2014 The Authors Published by Elsevier B.V This is an open access article under the CC BY-NC-SA license (http://creativecommons.org/licenses/by-nc-sa/3.0/) Introduction The cultivated strawberry (Fragaria × ananassa, 2n = 8× = 56) is one of the most economically important fruit crops in the world Its global production in 2009 was estimated to be over 4.1 million tons (Food and Agriculture Organization of the United Nations; http://faostat3.fao.org/) Breeding programs of cultivated strawberry are conducted in many countries to improve fruit quality and yield, and to achieve extended storage capability and disease resistance In Japan, over 30 national and/or prefectural agricultural research centers are carrying out strawberry cultivarbreeding, Abbreviations: STH, single tag hybridization; PAS, printed array strip ∗ Corresponding author Tel.: +81 86 251 8312; fax: +81 86 251 8388 E-mail addresses: y monden@cc.okayama-u.ac.jp (Y Monden), ktakasaki@fasmac.co.jp (K Takasaki), sfuto@fasmac.co.jp (S Futo), kniwa@ecei.tohoku.ac.jp (K Niwa), m-kawase@ecei.tohoku.ac.jp (M Kawase), ag20004@s.okayama-u.ac.jp (H Akitake), tahara@cc.okayama-u.ac.jp, makoto.tahara@gmail.com (M Tahara) which has led to the creation of many popular Japanese cultivars, such as Amaou, Sagahonoka, and Hinoshizuku These Japanese strawberry cultivars have been highly improved, which indicates that they have high productivity, earliness, and high fruit quality, including an extended shelf life Thus, a precise and effective cultivar discrimination system is required to protect the plant proprietary right of those superior cultivars However, discrimination based on morphological traits is affected by the environmental and/or growth conditions, and is restricted during the developmental stage (Nielsen and Lovell, 2000) Moreover, if the cultivars are closely related, it is extremely difficult to distinguish them based on morphological traits Therefore, molecular markers have been developed based on the methods of randomly amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), simple sequence repeat (SSR), and cleaved amplified polymorphic sequences (CAPS), which enable precise cultivar discrimination at any developmental stage (Arnau et al., 2001; Congiu et al., 2000; Hancock et al., 1994; Kunihisa et al., 2003, 2005; Nehra et al., 1991; Tyrka et al., 2002) However, it remains difficult to apply these methods to on-site inspection, for the following reasons: it http://dx.doi.org/10.1016/j.jbiotec.2014.06.013 0168-1656/© 2014 The Authors Published by Elsevier B.V This is an open access article under the CC BY-NC-SA license (http://creativecommons.org/licenses/by-nc-sa/3.0/) 58 Y Monden et al / Journal of Biotechnology 185 (2014) 57–62 is impossible to perform cultivar discrimination within mixed and processed products, some experimental instruments are required for agarose/acrylamide gel electrophoresis, and the preparation and staining of a gel requires several hours Retrotransposons are ubiquitous and abundant components in virtually all known eukaryotic genomes (Feschotte et al., 2002; Feschotte and Pritham, 2007; Huang et al., 2012; Kumar and Bennetzen, 1999; Levin and Moran, 2011; Wessler, 2006) In higher plants, they usually constitute more than half of the whole genomic DNA (Bento et al., 2013; Paterson et al., 2009; Schnable et al., 2009; Tenaillon et al., 2010) They amplify the number of their copies through reverse transcription of their RNA and integration of the resulting cDNAs into new genomic loci based on the “copy-andpaste” transposition mechanism (Kumar and Bennetzen, 1999) Because of their ubiquitous distribution, high copy number, and diverse dispersion within the genome, their insertion polymorphisms among cultivars have been used as molecular markers in phylogenetic analyses, in the construction of linkage maps, and in genetic diversity studies (Flavell et al., 1998; Kalendar et al., 1999, 2011; Konovalov et al., 2010; Kumar and Hirochika, 2001; Nasri ´ et al., 2013; Poczai et al., 2013; Smykal et al., 2011; Syed et al., 2005) Moreover, the uniqueness of the newly integrated insertion sites has an excellent potential for the development of multiplex DNA-based marker systems that can be used to achieve cultivar discrimination In fact, our recent research showed retrotransposon based DNA markers were useful for cultivar discrimination in several crop species, including wheat (Triticum aestivum) and sweet potato (Ipomoea batatas) (Takai and Tahara, 2011; Monden et al., 2014) In a previous research, we successfully identified eight genomic insertion sites of the FaRE1 retrotransposon that were used to discriminate 32 strawberry cultivars after screening their insertion sites comprehensively (Akitake et al., 2013) FaRE1 has been identified as an active retrotransposon family (He et al., 2010; Melnikova et al., 2012) and shows high insertion polymorphisms even among Japanese strawberry cultivars, which are known to be genetically closely related (Akitake et al., 2013) We applied sequence-specific amplified polymorphism (S-SAP) method to investigate FaRE1 insertion polymorphism among 32 cultivars This method amplifies specifically the DNA fragments between a retrotransposon end and its adjacent restriction enzyme cutting site, and visualizes multiple bands through agarose/acrylamide electrophoresis (Konovalov et al., 2010; Lou and Chen, 2007; Melnikova et al., 2012; Petit et al., 2010; Syed et al., 2005; Waugh et al., 1997) After a number of DNA fragments derived from FaRE1 insertion sites were cloned and sequenced, we extracted eight insertion sites by considering combinations of their polymorphisms for discriminating 32 strawberry cultivars It was shown that the amplification of these eight insertion sites allowed the precise and rapid screening of strawberry cultivars (Akitake et al., 2013) However, this method also required agarose/acrylamide electrophoresis for signal detection, which has the difficulty in achieving on-site inspection In this study, we developed a novel cultivar discrimination system using the single tag hybridization (STH) chromatographic printed array strip (PAS) method, which affords the visualization of multiplex DNA signals in a single reaction with great sensitivity and in a dramatically short time Moreover, it does not require the preparation or staining of a gel The results of this study showed that we successfully evaluated strawberry cultivars based on the multiplex DNA signals that were derived from the amplicons of the FaRE1 retrotransposon and visualized using STH chromatographic PAS Thus, we expect that this method will facilitate rapid, efficient, and highly reliable cultivar discrimination in on-site inspection of plant materials and agricultural products Materials and methods 2.1 Development of DNA markers for strawberry cultivar discrimination This research was conducted based on the information provided from a previous research, which developed eight DNA markers for discriminating 32 strawberry cultivars (Akitake et al., 2013) Thus, we briefly described the contents of this previous research In the previous research, 32 strawberry cultivars and its wild species (Fragaria vesca) were used (Supplementary Table 1) First, genomic DNA was extracted from young leaves using the DNeasy Plant mini kit (QIAGEN) following the manufacturer’s protocol After genomic DNA was digested with AseI or RsaI restriction enzyme (New England Biolabs Japan, Inc), forked adaptors were ligated to the digested DNA The forked adapters were prepared by annealing two DNA oligomers: FA AseI and FA cmpl for AseI, and FA RsaI and FA cmpl for RsaI PCR primers were designed based on the sequence information of FaRE1 We performed primary PCR with an adapterspecific (AP2) and FaRE1-specific (FaRE1 PBS) primer combination for AseI digested DNA fragments, and also performed that with an AP2 and FaRE1-specific (FaRE1 LTR150 Up) primer combination for RsaI digested DNA fragments Then, nested PCR was performed with an adapter-specific (AP3) and FaRE1-specific (FaRE1 LTR End) primer set using the initial PCR products as the template The PCR comprised an initial denaturation at 94 ◦ C for min, which was followed by 30 cycles at 94 ◦ C for 60 s, 75 ◦ C for 60 s (this step was added for the amplification of RsaI digested DNA fragment), 58 ◦ C for 90 s and 72 ◦ C for 90 s, with a final extension at 72 ◦ C for PCR products were loaded on an ABI3730xl DNA Analyzer (Applied Biosystems) for DNA fragment analyses after the purification with QIA quick PCR purification kit (QIAGEN) GeneMapper software (Applied Biosystems) was used for the visualization of DNA fragment peaks In addition, PCR products were cloned with TOPO TA cloning kit (Invitrogen), and 446 colonies were screened and sequenced Sequences were analyzed and aligned using BLAST and ClustalW program (Larkin et al., 2007), and the sequences of 124 different FaRE1 insertion sites were obtained Out of these sites, we selected eight insertion sites (Grp 18, 41, 57, 59, 61, 65, 76 and 110) based on the combinations of their polymorphisms among 32 cultivars The primer and adapter sequences in the previous research are listed in Supplementary Table Supplementary tables related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jbiotec.2014.06.013 2.2 Sample preparation We used eight strawberry cultivars (Akihime, Nyoho, Amaou, Hokowase, Benihoppe, Asuka Ruby, Red Pearl, and Kotoka) in this research The plants of strawberry cultivars were obtained from the Tochigi Prefectural Agricultural Experiment Station and Fukuoka Agricultural Research Center Genomic DNA was extracted from young leaves using the DNeasy plant mini kit (QIAGEN), according to the manufacturer’s protocol 2.3 PCR and signal detection by agarose gel electrophoresis In this research, PCR was performed by amplifying the internal positive control (IPC) sequence and eight FaRE1 insertion sites The IPC sequence was introduced into a pArt1 vector, which was used for the control PCR (Supplementary Fig 1) (Mano et al., 2011) The PCR amplification for IPC sequence was carried out using PrimeSTAR GXL Taq Polymerase (Takara Bio, Ohtsu, Japan) with IPC200f and IPC200r primer combinations (Table 1) and the pArt1 vector as a template, and that for eight insertion sites was carried out using the KAPA2G Fast Mutiplex PCR kit Y Monden et al / Journal of Biotechnology 185 (2014) 57–62 Table Sequences of the primers used in this study Primer name Primer sequence IPC200f IPC200r GrpR primer Grp18 primer Grp41 primer Grp57 primer Grp59 primer Grp61 primer Grp65 primer Grp76 primer Grp110 primer C-PAS4 IPC200f C-PAS4 IPC200r Bi C-PAS4 IPC100f C-PAS4 IPC100r Bi C-PAS4 GrpR Bi C-PAS4 Grp18 C-PAS4 Grp41 C-PAS4 Grp57 C-PAS4 Grp59 C-PAS4 Grp61 C-PAS4 Grp65 C-PAS4 Grp76 C-PAS4 Grp110 CTAGGGAATGACGGCAGGATAG CGCACGTATACATATGGAGTCAGC CTTAATTTCCAAATCATATCAACGAGCCAAAACAC CCTGGTTGGCAACATGATGTAAC CACCAAAACCAACAACTCATACC CAACTTCCACTCTTCGATCCAG CAATGAGGACCTTGCAATGTAAGC GACCATGTCAAAATGACCGTTCAG GGTGGAGTCCTGTCCAAATAG GTATTCCTCCAGTTCCGACCA CACATGAGGCACTGGACTTAACG [A1]-[Spacer]-CTAGGGAATGACGGCAGGATAG [Biotin]-CGCACGTATACATATGGAGTCAGC [A1]-[Spacer]-CCGAGCTTACAAGGCAGGTT [Biotin]-TGGCTCGTACACCAGCATACTAG [Biotin]-CTTAATTTCCAAATCATATCAACGAGCCAAAACAC [A2]-[Spacer]-CCTGGTTGGCAACATGATGTAAC [A3]-[Spacer]-CACCAAAACCAACAACTCATACC [A3]-[Spacer]-CAACTTCCACTCTTCGATCCAG [A4]-[Spacer]-CAATGAGGACCTTGCAATGTAAGC [A2]-[Spacer]-GACCATGTCAAAATGACCGTTCAG [A4]-[Spacer]-GGTGGAGTCCTGTCCAAATAG [A4]-[Spacer]-GTATTCCTCCAGTTCCGACCA [A3]-[Spacer]-CACATGAGGCACTGGACTTAACG [A1], [A2], [A3] and [A4] represent the tag sequences [Spacer] represents the singlestranded non-public sequence (Kapa Biosystems, Inc, Boston, MA, USA) with FaRE1 retrotransposon-specific (GrpR primer) and insertion site-specific (Grp18 , Grp41 , Grp57 , Grp59 , Grp61 , Grp65 , Grp76 , or Grp110 ) primer combinations using the genomic DNA as the template The PCR for IPC sequence comprised an initial denaturation at 98 ◦ C for 30 s, which was followed by 35 cycles at 98 ◦ C for 10 s, 59 ◦ C for 15 s, and 72 ◦ C for 10 s, with a final extension at 72 ◦ C for The PCR for eight insertion sites comprised an initial denaturation at 95 ◦ C for min, which was followed by 35 cycles at 95 ◦ C for 15 s, 59 ◦ C for 20 s, and 72 ◦ C for 12 s, with a final extension at 72 ◦ C for 30 s The control PCR products were purified with the FastGene Gel/PCR Extraction kit (NIPPON Genetics Co, Ltd) and quantified with a Qubit 2.0 Fluorometer (Invitrogen) for sensitivity investigation PCR products were resolved by electrophoresis on a 3% or 5% agarose gel and stained with GelRed (Biotium Inc., Hayward, CA, USA) The sequences of the primers used are shown in Table Supplementary figure related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jbiotec.2014.06.013 59 2.4 PCR and signal detection by STH chromatographic PAS For amplification of the PCR products detected by STH chromatographic PAS, PCR primers containing the single-stranded tag and spacer sequences were used (indicated as C-PAS4 * primers in Table 1) The PCR amplification for IPC sequence was performed with C-PAS4 IPC100f and C-PAS4 IPC100r Bi or C-PAS4 IPC200f and C-PAS4 IPC200r Bi primer combinations, and that for eight FaRE1 insertion sites was performed with FaRE1 retrotransposon-specific (C-PAS4 GrpR Bi) and insertion site-specific (C-PAS4 Grp18 2, C-PAS4 Grp 41 3, C-PAS4 Grp57 3, C-PAS4 Grp59 4, C-PAS4 Grp61 2, C-PAS4 Grp65 4, C-PAS4 Grp76 4, or C-PAS4 Grp110 3) primer combinations The genomic templates and PCR conditions were same as agarose gel electrophoresis (2.3) PCR products with a tag-spacer sequence for STH were mixed with the dye and developing solution (Tohoku Bio-Array, TBA) (Fig 1) Subsequently, the C-PAS4 membrane stick (Tohoku Bio-Array, TBA) was dipped into this developing solution for 15 The sequences of the primers used are also shown in Table Results and discussion 3.1 Description and the sensitivity of the STH chromatographic PAS method To amplify the PCR products detected by STH chromatographic PAS, PCR primers containing the single-stranded tag and spacer sequences were used (Fig and Table 1) Preliminarily, the single-stranded complementary oligonucleotides of the tag sequence were blotted onto the C-PAS membrane, which led to their hybridization with the tag sequence of the PCR products (Fig 1) This STH reaction did not require heat-based denaturation In addition, the PCR products did not have to be stained with a fluorescent dye reagent, such as ethidium bromide, and the chromatography developing reaction required 5–15 Thus, this method enabled the detection of the signals at room temperature and in a short time In addition, the C-PAS membrane allowed the visualization of the eight signals simultaneously in a single reaction Moreover, we compared the sensitivity of signal detection between STH chromatographic PAS and agarose gel electrophoresis The PCR product was amplified based on the internal positive control (IPC) sequence, which was inserted into the pArt1 vector (Supplementary Fig 1) (Mano et al., 2011) The resulting product was purified from the agarose gel After preparing various concentrations (0.1, 0.25, 0.5, 1.0, 2.5, 5.0, 10, 25, and 50 nM) of this purified product (Fig 2), their signals were detected using an Fig Procedure used for signal detection via the STH chromatographic PAS method (1) Preparation of total genomic DNA (2) PCR amplification using combinations of primers with a tag-spacer sequence and biotin-labeled primers Red line, tag sequence; gray line, spacer sequence; and green line: primer (3) DNA signal detection based on single tag hybridization (STH) The complementary oligonucleotides of the tag sequence (blue line) were preliminarily printed on the membrane, which executes single tag hybridization between the tag sequence of the PCR product and the membrane (For interpretation of the references to color in figure legend, the reader is referred to the web version of the article.) 60 Y Monden et al / Journal of Biotechnology 185 (2014) 57–62 Fig Comparison of the sensitivity of signal detection between STH chromatographic PAS and agarose gel electrophoresis The use of the C-PAS4 membrane allowed us to detect even 0.25 nM of IPC PCR products (A) In contrast, the minimum quantity detectable on agarose gel was 2.5 nM of IPC PCR products (B) Thus, the detectable sensitivity of C-PAS4 was 10 times higher than that of agarose gel IPC, internal positive control agarose gel electrophoresis and STH chromatographic PAS (Fig 2) We found that the minimum amount of the PCR product detectable by agarose gel electrophoresis was 2.5 nM, whereas that detected by chromatography PAS (C-PAS) was 0.25 nM (Fig 2) This indicated that the sensitivity of the C-PAS was 10 times greater than that of agarose gel electrophoresis Thus, the STH chromatographic PAS method has an extremely high sensitivity regarding signal detection 3.2 Multiplex PCR assay on agarose gel electrophoresis and cultivar discrimination using the STH chromatographic PAS method To evaluate the STH chromatographic PAS method for strawberry cultivar discrimination, we focused on the eight genomic loci (Grp 18, 41, 57, 59, 61, 65, 76, and 110) derived from the insertion sites of the FaRE1 retrotransposon (Akitake et al., 2013) It was shown that the combinations of these insertion sites discriminate these strawberry cultivars precisely (Table 2) Thus, we performed Table Results of the genotyping of FaRE1 insertion sites among strawberry cultivars Strawberry cultivars Amplicon name Product size (bp) Fig Results of multiplex PCR on agarose gel The PCR products were resolved on a 5% agarose gel in 1× TAE buffer The sizes of PCR amplicons (Grp 18, 41, 57, 59, 61, 65, 76, and 110) are shown in Table The banding pattern in this figure corresponds to the results shown in Table C, control DNA; 1, Akihime; 2, Nyoho; 3, Amaou; 4, Hokowase; 5, Benihoppe; 6, Asuka Ruby; 7, Red Pearl; 8, Kotoka; and M: All Purpose Hi-Lo DNA Marker (Bionexus) Grp 57 195 Grp 61 162 Grp 65 142 Grp 59 128 Grp 76 119 Grp 110 100 Grp 18 85 Grp 41 74 Note: white cells, no product; blue cells, the presence of a product 1, Akihime; 2, Nyoho; 3, Amaou; 4, Hokowase; 5, Benihoppe; 6, Asuka; 7, Red Pearl; 8, Kotoka Y Monden et al / Journal of Biotechnology 185 (2014) 57–62 61 Fig STH chromatographic assay showing the procedures used in this method (A) The red line indicates the positional marker [A-1], [A-2], [A-3] and [A-4] represent the tag IPC, internal positive control product (B) Signal of the PCR amplicons (Grp 18, 41, 57, 59, 61, 65, 76, and 110) used for strawberry cultivar discrimination multiplex PCR (Markoulatos et al., 2002) to amplify the products that were derived from these eight insertion sites simultaneously, and visualized the signals on agarose gel electrophoresis prior to the STH chromatographic PAS method Fig shows the exact banding pattern of the PCR amplicons of all cultivars, as expected (Table 2) Thus, it was shown that the simultaneous detection of these eight products allows the precise discrimination of these strawberry cultivars Next, we detected the signals of the PCR products derived from these eight insertion sites (Grp 18, 41, 57, 59, 61, 65, 76, and 110) using the STH chromatographic PAS method This time, we used the C-PAS4 membrane, which allows the visualization of the four signals simultaneously (Fig 4A) The combination of the PCR products and the tag sequences on three types of C-PAS4 (C-PAS4-1, -2, and -3) is shown in Fig 4B (the IPC product containing the [A-1] tag sequence was used as a control) In addition, other PCR products were combined with three types ([A-2], [A-3], and [A-4]) of tag sequences (Fig 4B) Fig 4A shows the practical procedure used to perform the STH chromatographic PAS method First, the PCR products, the dye, and the developing solution were mixed Subsequently, the C-PAS4 membrane was placed in this solution for 15 and the signals were detected as shown in Fig 4B The signal pattern of all samples was fully consistent with the results of the multiplex PCR assay (Fig 3) Table Comparison of C-PAS with agarose gel electrophoresis Content C-PAS Agarose gel electrophoresis Operating time Minimum detectable quantity Need to consider the size of PCR products for signal detection 15 0.63 nM 2.5 nM No Yes (in the case of mutiplex PCR) a This time includes the preparation and the staining of the gel Conclusions In this study, we used the STH chromatographic PAS method for strawberry cultivar discrimination This novel signal detection method has several advantages over traditional methods, such as agarose gel electrophoresis, because it enables the detection of signals with dramatically high sensitivity and in a short time without any preparation or staining of gels (Fig and Table 3) Moreover, this method can be used to visualize several signals derived from several independent PCR products of any size simultaneously In contrast, the detection of the signals derived from these amplicons on an agarose gel requires caution regarding size, to achieve sufficient resolution of these multiplex PCR amplicons; moreover, 62 Y Monden et al / Journal of Biotechnology 185 (2014) 57–62 amplicons of the same size cannot be resolved (Table 3) In the case of STH chromatographic PAS, however, several independent PCR amplicons with the same size can be distinguished precisely (Table 3) Importantly, this multiplex signal detection suggests that we might discriminate crop cultivars within the mixed and processed products precisely by using cultivar-specific DNA fragments Furthermore, this method does not require experimental instrumentation, which means that this novel method is quite valuable for application not only to laboratory research, but also to on-site inspection of plant cultivars and agricultural products Acknowledgements This work was supported by a Research and Development Projects for Application in Promoting New Policy of Agriculture Forestry and Fisheries grant from the Ministry of Agriculture, Forestry and Fisheries of Japan, and by the Program to Disseminate Tenure Tracking System from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan (to Y.M.) References Akitake, H., Tahara, M., Monden, Y., Takasaki, K., Futo, S., 2013 Strawberry cultivar identification by retrotransposon insertion polymorphisms DNA Polymorph 21, 64–72 (in Japanese) Arnau, G., Lallemand, J., Bourgoin, M., 2001 Are AFLP markers the best alternative for cultivar identification? Acta Hortic 546, 301–306, Retrieved from http://www.actahort.org/books/546/546 37.htm Bento, M., Tomás, D., Viegas, W., Silva, M., 2013 Retrotransposons represent the most labile fraction for genomic rearrangements in polyploid plant species Cytogenet Genome Res 140, 286–294, http://dx.doi.org/10.1159/000353308 Congiu, L., Chicca, M., Cella, R., Rossi, R., Bernacchia, G., 2000 The use of random amplified polymorphic DNA (RAPD) markers to identify strawberry varieties: a forensic application Mol Ecol (2), 229–232, Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10672167 FAO, 2014 Food and Agriculture Organization of the United Nations, Available from http://faostat3.fao.org/ Feschotte, C., Jiang, N., Wessler, S.R., 2002 Plant transposable elements: where genetics meets genomics Nat Rev Genet (5), 329–341, http://dx.doi.org/ 10.1038/nrg793 Feschotte, C., Pritham, E., 2007 DNA transposons and the evolution of eukaryotic genomes Annu Rev Genet 41, 331–368, http://dx.doi.org/10.1146/annurev genet.40.110405.090448 Flavell, A.J., Knox, M.R., Pearce, S.R., Ellis, T.H.N., 1998 Retrotransposon-based insertion polymorphisms (RBIP) for high throughput marker analysis Plant J 16 (5), 643–650, Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10036780 Hancock, J.F., Callow, P.A., Shaw, D.V., 1994 Randomly amplified polymorphic DNAs in the cultivated strawberry Fragaria × ananassa J Am Soc Hortic Sci 119 (4), 862–864 He, P., Ma, Y., Zhao, G., Dai, H., Li, H., Chang, L., Zhang, Z., 2010 FaRE1: a transcriptionally active Ty1-copia retrotransposon in strawberry J Plant Res 123 (5), 707–714, http://dx.doi.org/10.1007/s10265-009-0290-0 Huang, C.R.L., Burns, K.H., Boeke, J.D., 2012 Active transposition in genomes Annu Rev Genet 46, 651–675, http://dx.doi.org/10.1146/annurev-genet-110711155616 Kalendar, R., Flavell, A.J., Ellis, T.H.N., Sjakste, T., Moisy, C., Schulman, A.H., 2011 Analysis of plant diversity with retrotransposon-based molecular markers Heredity 106 (4), 520–530, http://dx.doi.org/10.1038/hdy.2010.93 Kalendar, R., Grob, T., Regina, M., Suoniemi, A., Schulman, A.H., 1999 IRAP and REMAP: two new retrotransposon-based DNA fingerprinting techniques Theor Appl Genet 98, 704–711, http://dx.doi.org/10.1007/s001220051124 Konovalov, F.A., Goncharov, N.P., Goryunova, S., Shaturova, A., Proshlyakova, T., Kudryavtsev, A., 2010 Molecular markers based on LTR retrotransposons BARE-1 and Jeli uncover different strata of evolutionary relationships in diploid wheats Mol Genet Genomics 283, 551–563, http://dx.doi.org/10.1007/ s00438-010-0539-2 Kumar, A., Bennetzen, J.L., 1999 Plant retrotransposons Annu Rev Genet 33, 479–532, http://dx.doi.org/10.1146/annurev.genet.33.1.479 Kumar, A., Hirochika, H., 2001 Applications of retrotransposons as genetic tools in plant biology Trends Plant Sci (3), 127–134, Retrieved from http://www ncbi.nlm.nih.gov/pubmed/11239612 Kunihisa, M., Fukino, N., Matsumoto, S., 2003 Development of cleavage amplified polymorphic sequence (CAPS) markers for identification of strawberry cultivars Euphytica 134 (2), 209–215, http://dx.doi.org/10.1023/B:EUPH 0000003884.19248.33 Kunihisa, M., Fukino, N., Matsumoto, S., 2005 CAPS markers improved by cluster-specific amplification for identification of octoploid strawberry (Fragaria × ananassa Duch.) cultivars, and their disomic inheritance Theor Appl Genet 110 (8), 1410–1418, http://dx.doi.org/10.1007/s00122-005-1956-1 Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., Higgins, D.G., 2007 Clustal W and Clustal X Version 2.0 Bioinformatics 23, 2947–2948, http://dx.doi.org/10.1093/bioinformatics/btm404 Levin, H.L., Moran, J.V., 2011 Dynamic interactions between transposable elements and their hosts Nat Rev Genet 12 (9), 615–627, http://dx.doi.org/ 10.1038/nrg3030 Lou, Q., Chen, J., 2007 Ty1-copia retrotransposon-based SSAP marker development and its potential in the genetic study of cucurbits Genome 810, 802–810, http://dx.doi.org/10.1139/G07-067 Mano, J., Yanaka, Y., Ikezu, Y., Onishi, M., Futo, S., Minegishi, Y., Ninomiya, K., Yotsuyanagi, Y., Spiegelhalter, F., Akiyama, H., Teshima, R., Hino, A., Naito, S., Koiwa, T., Takabatake, R., Furui, S., Kitta, K., 2011 Practicable group testing method to evaluate weight/weight GMO content in maize grains J Agric Food Chem 59 (13), 6856–6863, http://dx.doi.org/10.1021/jf200212v Markoulatos, P., Siafakas, N., Moncany, M., 2002 Multiplex polymerase chain reaction: a practical approach J Clin Lab Anal 16, 47–51, http://dx.doi.org/ 10.1002/jcla.2058 Melnikova, N.V., Kudryavtseva, A.V., Speranskaya, A.S., Krinitsina, A.A., Dmitriev, A.A., Belenikin, M.S., Upelniek, V.P., Batrack, E.R., Kovaleva, I.S., Kudryavtsev, A.M., 2012 The FaRE1 LTR-retrotransposon based SSAP markers reveal genetic polymorphism of strawberry (Fragaria × ananassa) cultivars J Agric Sci (11), 111–118, http://dx.doi.org/10.5539/jas.v4n11p111 Monden, Y., Yamamoto, A., Shindo, A., Tahara, M., 2014 Efficient DNA fingerprinting based on the targeted sequencing of active retrotransposon insertion sites using a bench-top high-throughput sequencing platform DNA Res., http://dx.doi.org/10.1093/dnares/dsu015 Nasri, S., Abdollahi Mandoulakani, B., Darvishzadeh, R., Bernousi, I., 2013 Retrotransposon insertional polymorphism in Iranian bread wheat cultivars and breeding lines revealed by IRAP and REMAP markers Biochem Genet 51 (11–12), 927–943, http://dx.doi.org/10.1007/s10528-013-9618-5 Nehra, N.S., Kartha, K.K., Stushnoff, C., 1991 Isozymes as markers for identification of tissue culture and greenhouse-grown strawberry cultivars Can J Plant Sci 71 (4), 1195–1201, http://dx.doi.org/10.4141/cjps91-167 Nielsen, J.A., Lovell, P.H., 2000 Value of morphological characters for cultivar identification in strawberry (Fragaria × ananassa) N Z J Crop Hortic Sci 28 (2), 89–96, http://dx.doi.org/10.1080/01140671.2000.9514128 Paterson, A.H., Bowers, J.E., Bruggmann, R., Dubchak, I., Grimwood, J., Gundlach, H., Harberer, G., Hellsten, U., Mitros, T., Poliakov, A., et al., 2009 The sorghum bicolor genome and the diversification of grasses Nature 457 (7229), 551–556, http://dx.doi.org/10.1038/nature07723 Petit, M., Guidat, C., Daniel, J., Denis, E., Montoriol, E., Bui, Q.T., Lim, K.Y., Kovarik, A., Leitch, A.R., Grandbastien, M., Mhiri, C., 2010 Mobilization of retrotransposons in synthetic allotetraploid tobacco New Phytol 186, 135–147, http://dx.doi.org/10.1111/j.1469-8137.2009.03140.x Poczai, P., Varga, I., Laos, M., Cseh, A., Bell, N., Valkonen, J.P., Hyvönen, J., 2013 Advances in plant gene-targeted and functional markers: a review Plant Methods (1), 6, http://dx.doi.org/10.1186/1746-4811-9-6 Schnable, P.S., Ware, D., Fulton, R.S., Stein, J.C., Wei, F., Pasternak, S., Liang, C., Zhang, J., Fulton, L., Graves, T.A., et al., 2009 The B73 maize genome: complexity, diversity, and dynamics Science 326 (5956), 1112–1115, http://dx.doi.org/ 10.1126/science.1178534 ´ P., Baˇcová-Kerteszová, N., Kalendar, R., Corander, J., Schulman, A.H., Smykal, Pavelek, M., 2011 Genetic diversity of cultivated flax (Linum usitatissimum L.) germplasm assessed by retrotransposon-based markers Theor Appl Genet 122 (7), 1385–1397, http://dx.doi.org/10.1007/s00122-011-1539-2 Syed, N.H., Sureshsundar, S., Wilkinson, M.J., Bhau, B.S., Cavalcanti, J.J.V., Flavell, A.J., 2005 Ty1-copia retrotransposon-based SSAP marker development in cashew (Anacardium occidentale L.) Theor Appl Genet 110 (7), 1195–1202, http://dx.doi.org/10.1007/s00122-005-1948-1 Takai, T., Tahara, M., 2011 Discovery of the retrotransposon showing genome insertion polymorphisms among wheat cultivars DNA Polymorph 20, 80–90 (in Japanese) Tenaillon, M.I., Hollister, J.D., Gaut, B.S., 2010 A triptych of the evolution of plant transposable elements Trends Plant Sci 15 (8), 1–8, http://dx.doi.org/10.1016/ j.tplants.2010.05.003 Tyrka, M., Dziadczyk, P., Horty, J.A., 2002 Simplified AFLP procedure as a tool for identification of strawberry cultivars and advanced breeding lines Euphytica 125 (2), 273–280, http://dx.doi.org/10.1023/A:1015892313900 Waugh, R., McLean, K., Flavell, A.J., Pearce, S.R., Kumar, A., Thomas, B.B., Powell, W., 1997 Genetic distribution of Bare-1-like retrotransposable elements in the barley genome revealed by sequence-specific amplification polymorphisms (S-SAP) Mol Gen Genet 253, 687–694, Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9079879 Wessler, S.R., 2006 Transposable elements and the evolution of eukaryotic genomes Proc Natl Acad Sci U.S.A 103 (47), 17600–17601, http://dx.doi.org/ 10.1073/pnas.0607612103  ... CTAGGGAATGACGGCAGGATAG CGCACGTATACATATGGAGTCAGC CTTAATTTCCAAATCATATCAACGAGCCAAAACAC CCTGGTTGGCAACATGATGTAAC CACCAAAACCAACAACTCATACC CAACTTCCACTCTTCGATCCAG CAATGAGGACCTTGCAATGTAAGC GACCATGTCAAAATGACCGTTCAG... [Biotin]-TGGCTCGTACACCAGCATACTAG [Biotin]-CTTAATTTCCAAATCATATCAACGAGCCAAAACAC [A2 ]-[Spacer]-CCTGGTTGGCAACATGATGTAAC [A3 ]-[Spacer]-CACCAAAACCAACAACTCATACC [A3 ]-[Spacer]-CAACTTCCACTCTTCGATCCAG [A4 ]-[Spacer]-CAATGAGGACCTTGCAATGTAAGC... [A4 ]-[Spacer]-CAATGAGGACCTTGCAATGTAAGC [A2 ]-[Spacer]-GACCATGTCAAAATGACCGTTCAG [A4 ]-[Spacer]-GGTGGAGTCCTGTCCAAATAG [A4 ]-[Spacer]-GTATTCCTCCAGTTCCGACCA [A3 ]-[Spacer]-CACATGAGGCACTGGACTTAACG [A1 ], [A2 ], [A3 ] and