Báo cáo khoa học: D-strand perturbation and amyloid propensity in beta-2 microglobulin ppt

D-strand perturbation and amyloid propensity in beta-2 microglobulin Stavros Azinas 1,2 , Matteo Colombo 1 , Alberto Barbiroli 3 , Carlo Santambrogio 4 , Sofia Giorgetti 5,6 , Sara Raimondi 5,6 , Francesco Bonomi 3 , Rita Grandori 4 , Vittorio Bellotti 5,6 , Stefano Ricagno 1 and Martino Bolognesi 1 1 Dipartimento di Scienze Biomolecolari e Biotecnologie and CIMAINA, Universita ` degli Studi di Milano, Milan, Italy 2 Department of Biochemical Sciences, University of Surrey, Guildford, UK 3 Dipartimento di Scienze Molecolari Agroalimentari, Universita ` degli Studi di Milano, Milan, Italy 4 Dipartimento di Biotecnologie e Bioscienze, Universita ` di Milano-Bicocca, Milan, Italy 5 Dipartimento di Biochimica, Universita ` di Pavia, Pavia, Italy 6 Laboratori di Biotecnologie, IRCCS Fondazione Policlinico San Matteo, Pavia, Italy Keywords amyloidosis; beta-2 microglobulin; beta- buldge; dialysis related amyloidosis; MHC I; proline Correspondence M. Bolognesi, Dipartimento di Scienze Biomolecolari e Biotecnologie and CIMAINA, Universita ` degli Studi di Milano, Via Celoria 26, 20133 Milano, Italy Fax: 00390250314895 Tel: 00390250314893 E-mail: martino.bolognesi@unimi.it (Received 21 March 2011, revised 29 April 2011, accepted 4 May 2011) doi:10.1111/j.1742-4658.2011.08157.x Proteins hosting main b-sheets adopt specific strategies to avoid intermolec- ular interactions leading to aggregation and amyloid deposition. Human beta-2 microglobulin (b2m) displays a typical immunoglobulin fold and is known to be amyloidogenic in vivo. Upon severe kidney deficiency, b2m accumulates in the bloodstream, triggering, over the years, pathological deposition of large amyloid aggregates in joints and bones. A b-bulge observed on the edge D b-strand of some b2m crystal structures has been suggested to be crucial in protecting the protein from amyloid aggregation. Conversely, a straight D-strand, observed in different crystal structures of monomeric b2m, could promote amyloid aggregation. More recently, the different conformations observed for the b2m D-strand have been inter- preted as the result of intrinsic flexibility, rather than being assigned to a functional protective role against aggregation. To shed light on such con- trasting picture, the mutation Asp53 fi Pro was engineered in b2m, aiming to impair the formation of a regular ⁄ straight D-strand. Such a mutant was characterized structurally and biophysically by CD, X-ray crystallography and MS, in addition to an assessment of its amyloid aggregation trends in vitro. The results reported in the present study highlight the conforma- tional plasticity of the edge D-strand, and show that even perturbing the D-strand structure through a Pro residue has only marginal effects on protecting b2m from amyloid aggregation in vitro. Database Atomic coordinates and structure factors have been deposited in the Protein Data Bank under the accession number 3NA4. Structured digital abstract l Beta-2-microglo bulin bi nds to Bet a-2-micro globulin by flu orescence technology (View interaction) l Beta-2-microglobulin binds to Beta-2-microglobulin by mass spectrometry studies of com- plexes (View Interaction 1, 2, 3) l Beta-2-microglo bulin bi nds to Bet a-2-micro globulin by el ectron microscopy (View interactio n) Abbreviations b2m, beta-2 microglobulin; C m , melting concentration; D53P, beta-2 microglobulin Asp53 fi Pro mutant; DRA, dialysis-related amyloidosis; GdHCl, guanidine hydrochloride; MHC-I, class I major histocompatibility complex; TFE, trifluoroethanol; T m, melting temperature. FEBS Journal 278 (2011) 2349–2358 ª 2011 The Authors Journal compilation ª 2011 FEBS 2349 Introduction Intermolecular cross-b interactions are at the basis of protein amyloid aggregation. In the cross-b structure, b-strands belonging to different protein chains associ- ate, giving rise to extended intermolecular b-sheets. Because many known protein folds present solvent- exposed b-strands at the edges of constitutive b-sheets, the formation of an extended intermolecular b-sheet structure resulting from cross-b aggregation of protein chains might turn into a likely event. Fortunately, such a threatening aggregation process is only sporadic in vivo. It has been proposed that proteins adopt dif- ferent strategies to prevent intermolecular b-b interac- tions. Among these, the b-sheet edge strands tend to be irregular, generally short or host-charged residues that make them unsuitable for cross-b interactions, thus promoting the monomeric state over aggregation [1]. Therefore, introducing a b-bulge in an otherwise linear edge b-strand may impair the amyloid aggrega- tion of proteins hosting b-sheets, improving their solu- bility [1]. Beta-2-microglobulin (b2m) is a 99-residue b-sand- wich protein that is noncovalently associated as the light chain of the major histocompatibility complex class I (MHC I). b2m provides an example of how the molecular protection strategies described above appear to be applied; indeed, despite being a fully b-protein, it is stable as a monomer in solution up to millimolar concentrations [2,3]. In vivo, and under normal condi- tions, b2m is degraded in the kidneys after dissociation from MHC-I; however, patients suffering from kidney failure and undergoing long-term hemodialysis accu- mulate free b2m in their serum to concentrations that are ten- to 50-fold higher than physiological concentra- tions [4]. Such stress conditions result in dialysis- related amyloidosis (DRA), a pathological state whereby hundreds of grams of b2m amyloid fibrils are deposited in the skeletal joints and bones, hampering their functionality [5]. Several factors appear to trigger the formation of b2m amyloid fibrils in vivo, with par- ticular attention being focussed on the role played by glycosaminoglycans and fibrillar collagen (type I) [6,7]. Conversely, in vitro, b2m amyloid aggregation can be achieved using a variety of conditions, such as partial acid denaturation, proteolytic treatment and the addi- tion of various chemicals (e.g. SDS and trifluoroetha- nol) [8]. b2m displays a typical immunoglobulin fold, where two facing b-sheets (composed of strands ABED and CFG, respectively) are linked by a disulfide bridge buried in the protein core [9]. The D-strand (residues 50–57), which is one of the two edge strands in the ABED b-sheet, shows a high level of conformational variability in known b2m 3D structures. To date, b2m presents a bulged D-strand in all MHC-I crystal struc- tures. Asp53 comprises the b-bulge residue at the cen- tre of the D-strand, being involved in two hydrogen bonds to Arg35 of the MHC-I heavy chain [10]. Con- versely, in the first reported crystal structure of iso- lated monomeric wild-type b2m, the D-strand is straight, and thus devoid of any b-bulge [11]. It was proposed that such a regular edge strand is a structural feature promoting fibril formation [11]. Several other crystal structures of isolated monomeric b2m have been determined subsequently and, in every case, the D-strand b-bulge turns out to be absent, regardless of the amyloidogenic propensity tested on each given var- iant [12–16]. Conversely, the hexameric structure of the b2m H13F mutant, which is suggested to resemble clo- sely the early amyloidogenic intermediate, presents the Asp53 b-bulge. Moreover, NMR studies indicate that the b2m D-strand is very flexible in solution [3,17]. Taking all these data together, it was suggested that the variety of conformations observed for the D-strand provide evidence of a high level of structural adapt- ability at this edge strand, and that the straight D-strand conformation trapped in the crystal of mono- meric b2m is not an obligate step in the amyloid for- mation [16]. Despite several recent reports on b2m amyloid fine structure, the location of residue 53 in mature fibrils remains unclear. Recent evidence obtained by solid- state NMR suggests that the structural b2m core is conserved in the mature fibrils, whereas some parts of the molecule are reorganized [18,19]. However, some- what constrasting evidence on the role of residue 53 is available: Asp53 is predicted to map at the center of a long b-strand [20] and to be involved in intermolecular interactions [19]. On the other hand, the side chain of Asp53 was shown to be highly flexible and likely located in a solvent-exposed region [21]. In this context, additional information on the role played by b2m Asp53 bulge during amyloid formation appears mandatory. In the present study, we report the structural and biophysical characterization of the b2m D53P mutant, which was engineered with the aim of determing the role played by the conformational properties of the D-strand in protecting b2m from amyloid aggregation. Because Pro residues are known b-breakers, the Asp fi 53Pro mutation was chosen to code for a constitutive perturbation of the D-strand b-structure. Our structural and biophysical results show that the D-strand region structure is perturbed by the mutation, yielding a b2m molecular variant that is more stable than the wild-type protein. We also Amyloid propensity in b2m D53P S. Azinas et al. 2350 FEBS Journal 278 (2011) 2349–2358 ª 2011 The Authors Journal compilation ª 2011 FEBS show that such a region is highly adjustable and that a shorter and conformationally less regular edge D-strand does not prevent amyloid fibril formation, although it does show partly altered aggregation kinet- ics under specific in vitro conditions. Results D53P fold stability To assess the conformational stability of the b2m D53P mutant, both chemical and thermal protein unfolding processes were monitored by CD. Chemical unfolding at equilibrium was followed by CD in the far-UV region, acquiring spectra at increasing guanidine hydrochloride (GdHCl) concentrations. The data indicate that the D53P mutant is slightly more stable than wild-type b2m [melting concentration (C m ) D53P = 2.3 m GdHCl versus C m wild-type = 2.1 m GdHCl] (Fig. 1A); the cal- culated free energies are: DG  ðH 2 OÞD53P = 22.9 kJÆmol )1 (m = 9.8 kJÆmol )1 Æm )1 ) and DG  ðH 2 OÞwild-type = 28.0 kJÆmol )1 (m = 13.2 kJÆmol )1 Æm )1 ). Temperature ramps monitored by CD in the near- and far-UV regions con- firm that the mutant is also thermally more stable than wild-type b2m. The secondary structure of the D53P mutant unfolds at a melting temperature approximately 6 °C higher than wild-type b2m [melting temperature (T m ) D53P = 67.4 °C, T m wild-type = 61.4 °C] (Fig. 1B). Similarly, the near-UV spectra revealed a more stable tertiary structure for the mutant relative to wild-type b2m (T m D53P = 65.6 °C versus T m wild-type = 62.8 °C) (Fig. 1C). Crystal structure of D53P The structure of the D53P mutant was solved at a 1.9 A ˚ resolution, with an R work value of 21.4% and an R free value of 26.9% (Table 1); 98 out of 100 amino acids are traced in the electron density and clear elec- tron density is visible for Pro53 and the surrounding region. The absence of extensive intermolecular con- tacts in the crystal lattice confirms that the D53P mutant was crystallized as a monomeric species, in agreement with size-exclusion chromatography results acquired during the mutant purification procedure (data not shown). The 3D structure of the D53P mutant matches closely the structure of wild-type b2m, as observed in the MHC-I (Protein Data Bank code: 2BSS rmsd of 0.74 A ˚ for 93 ⁄ 98 Ca) and displays a rmsd of 0.85 A ˚ for 90 ⁄ 98 Ca atoms relative to mono- meric wild-type b2m (Protein Data Bank code: 1LDS). The latter rmsd value reflects a shift of the AB loop, which, in the D53P mutant, is tightly packed on the rest of the protein, as in MHC I (Fig. 2A), instead of protruding towards the solvent as in most monomeric b2m structures (e.g. the wild-type b2m mutants at resi- due 60) [11,13–16]. Fig. 1. (A) Unfolding titration curves (monitored by CD in the far- UV region) of wild-type (WT) b2m (h) and D53P b2m mutant ( )as a function of GdHCl concentration. (B, C) Thermal unfolding moni- tored by CD in the far-UV (B) and near-UV (C) regions for wild-type b2m (black) and D53P b2m mutant (gray). S. Azinas et al. Amyloid propensity in b2m D53P FEBS Journal 278 (2011) 2349–2358 ª 2011 The Authors Journal compilation ª 2011 FEBS 2351 The most notable structural adaptations of the D53P mutant structure are not only found in the D-strand, as expected, but also in the neighboring loops. By contrast to the previously known b2m crys- tal structures, where secondary structures are conserved, the introduction of Pro53 disrupts the N-terminal part of the D-strand, resulting in a CD loop that is four residues longer than in wild-type b2m (residues 43–53 ⁄ 43–49, D53P ⁄ wild-type, respectively) (Fig. 2); the CD loop is also more exposed than in the wild-type b2m (Fig. 2). The resulting D-strand starts only after Pro53 but gains one additional residue at its C-terminus compared to the wild-type protein (residues 54–57 ⁄ 50–56, D53P ⁄ wild-type, respectively). As shown in Fig. 2B, the DE loop is composed of only three resi- dues (residues 58–60 ⁄ 57–60, D53P ⁄ wild-type, respec- tively) and, as a consequence, displays an overall conformation clearly different from wild-type b2m. All such readjustments affecting the D-strand region result in the translation of the whole 53–57 segment one resi- due ‘upstream’, such that residue ‘n’ of the D53P mutant matches the site of residue ‘n ) 1’ in the wild- type b2m structure (e.g. residue 56 on 55; Fig. 2C). Notably, the region around the mutation site is not involved in intermolecular contacts to any neighboring molecule, indicating that the conformation of the D-strand observed for the b2m D53P mutant is not constrained by crystal contacts. D53P amyloidogenesis in vitro The propensity of the D53P mutant to form amyloid fibrils in vitro was tested with two standard protocols: one at pH 7.4 with 20% trifluoroethanol (TFE) and one at pH 2.5. As shown in Fig. 3A,B, the mutant gives rise to amyloid aggregates both at neutral and acidic pH. However, at neutral pH, amyloid formation is delayed by 24 h, although the D53P mutant reaches eventually the same level of aggregation as the wild- type protein; at low pH, the amyloidogenic processes for the two proteins are indistinguishable (Fig. 3A). Oligomerization of natively-folded D53P Similar to a recent report for wild-type b2m and three distinct DE-loop mutants [22], the D53P mutant was analyzed by means of nano-ESI-MS under nondenatu- rating conditions. The formation of soluble oligomers was monitored under mild desolvation conditions, aim- ing to favor the detection of noncovalent complexes (Fig. 3C). The charge state distribution of the mutant is narrow and consistent with a compact protein confor- mation. Spectra deconvolution yields a molecular mass of 11842 ± 0.5 Da for the D53P mutant, in keeping with the theoretical mass of the engineered protein. As also previously observed, the spectra display con- centration dependence in the explored range (up to 60 lm) [22]. As the protein concentration increases, the spectra of the D53P mutant reveal oligomer-specific peaks corresponding to dimers, trimers and tetramers. Such concentrations fall below the threshold (100 lm) generally observed for unspecific protein aggregation under electrospray conditions [23]. The nano-ESI-MS data indicate that the Asp fi 53Pro mutation does not prevent the formation of b2m soluble oligomers. Indeed, comparison of the spectra shown in Fig. 3C with those of wild-type b2m and the mutated variants previously reported [22] shows that the aggregation propensity of the mutant under nondenaturing conditions is somewhat decreased, although not abolished. The effect of the mutation is similar to that observed in the previously tested W60G b2m DE-loop mutant [22]. This result is consistent with the structural rearrangements in the DE loop as a result of the Trp60 fi Gly mutation, and with the notion that the DE loop plays an impor- tant role mediating protein–protein interactions [22]. These data and other considerations indicate that, under the in vitro conditions tested, the substitution of Table 1. Data collection and refinement statistics for the crystal structure of D53P mutant. b2m D53P mutant Beam line ESRF ID14-2 Space group P2 1 2 1 2 Unit cell edges (A ˚ , degrees) a = 29.1 b = 50.7 c = 71.2 Resolution (A ˚ ) 26.91–1.9 R merge (%) 10.6 (56.9) I ⁄ r 8.4 (2.4) Completeness 99.2 (99.0) Redundancy 4.2 Unique reflections 8702 Refinement R work (%) 21.4 R free (%) 26.9 Number of atoms Protein 820 Water 50 Ramachandran plot Most favored region (%) 100 Allowed region (%) 0 Outliers (%) 0 Values in parentheses are for the highest resolution shell. R merge = R |I ) <I>| ⁄ R |I| where I is the observed intensity and <I> is the average intensity. R work = R hkl ||F o | ) |F c || ⁄ R hkl |F o | for all data, except 5%, which were used for R free calculation. Amyloid propensity in b2m D53P S. Azinas et al. 2352 FEBS Journal 278 (2011) 2349–2358 ª 2011 The Authors Journal compilation ª 2011 FEBS residue 53 with proline and the perturbation of the b-structure in the D-strand may play only a very mar- ginal role, if any, in protecting b2m from oligomeriza- tion of natively-folded molecules. Discussion The present study reports the design and characteriza- tion of the D53P b2m mutant, where a Pro residue was engineered at the center of the D-strand. The aim was to mimic and stabilize the b-bulge at residue 53, as observed in the b2m crystal structures where the protein is in a nonmonomeric state. Because the inser- tion of a proline breaks the regularity of a b-strand as a result of restrictions of the / and w angles, the resulting (partial) loss of secondary structure was addi- tionally expected to affect the overall b2m stability. Nevertheless, the D53P mutant, whose crystal structure indeed shows a shorter D-strand, starting just at Pro53, turned out to be chemically and thermally more stable than wild-type b2m (Fig. 1). A possible explana- tion for such unexpected increased stability of the Fig. 2. (A) Left: cartoon representation of wild-type b2m structure in MHC-I complex (Protein Data Bank code: 2BSS). The b-bulge on resi- due 53 breaks the D-strand into two halves. Middle: cartoon representation of the D53P mutant with a shorter D-strand and an extended and protruding CD loop. Right: monomeric wild-type b2m displays a regular D-strand. Residues 53 and 56 are shown as magenta sticks. (B) b2m sequence with secondary structures relative to the structure of monomeric wild-type b2m (MON), D53P mutant (D53P), wild-type b2m complexed in MHC I (MHC) and the secondary structures of fibrillar b2m (AMY) predicted by Debelouchina et al. [19]. b-strands C, D and E are labeled as ssC, ssD, and ssE, respectively. The CD and DE loops are marked as lCD and lDE; B, b-bulge. Residue 53 is marked as X. (C) Stereo representation of strands D and E and the loop inbetween. The structures of wild-type b2m in MHC-I (yellow) and the D53P mutant (green) are superimposed. S. Azinas et al. Amyloid propensity in b2m D53P FEBS Journal 278 (2011) 2349–2358 ª 2011 The Authors Journal compilation ª 2011 FEBS 2353 Fibrillogenesis pH 7.4, 20% TFE 60 25 Fibrillogenesis pH 2.5 40 50 15 20 20 30 10 0 10 WT D53P 0 5 0 50 100 150 200 WT D53P Time (h) 0 50 100 150 200 Time (h) ThT fluorescence (a.u.) ThT fluorescence (a.u.) 100 5 µM 40 µM 60 µM 15 µM 90 80 70 60 50 40 Intensity (%) 30 20 10 0 100 90 80 70 60 50 40 Intensity (%) m/z 30 20 10 0 1000 1500 2000 2500 3000 3500 100 90 80 70 60 50 40 30 20 10 0 1000 1500 8+ 11+ 14+ 17+ 2000 2500 3000 3500 1000 1500 2000 2500 3000 3500 100 90 80 70 60 50 40 m/z 30 20 10 0 1000 1500 2000 2500 3000 3500 A B C Fig. 3. (A) Fibrillogenesis of D53P mutant. Left: kinetics of fibril formation monitored by thioflavin T fluorescence for wild-type (WT) b2m and D53P in 20% TFE at pH 7.4. Right: kinetics of fibril formation at pH 2.5. (B) Transmission electron microscopy images of amyloid fibrils grown in 20% TFE of the D53P mutant (left) and wild-type b2m (right). (C) D53P mutant oligomerization under native conditions monitored by nano-ESI-MS. The most intense peak of the monomer (d), dimer ( ¤), trimer ( ) and tetramer ( ) is labeled by the corresponding symbol and by the charge state in the final panel. Amyloid propensity in b2m D53P S. Azinas et al. 2354 FEBS Journal 278 (2011) 2349–2358 ª 2011 The Authors Journal compilation ª 2011 FEBS mutant may relate to the high regularity of the D53P mutant structure (all residues of the refined protein structure fall in the most favorite regions of the Rama- chandran plot). Additionally, because Pro residues are known to decrease the entropy of the protein-unfolded state, an entropic contribution of Pro53 to the folding equilibrium, and thus to mutant stability, may also be considered [24,25]. The amyloid aggregation propensity observed for the D53P mutant was also rather unexpected. The D53P variant, displays the same kinetics of fibril for- mation at low pH compared to the wild-type protein, whereas, in 20% TFE at neutrality, fibril formation is partly delayed, although, on completion of the aggre- gation process, the amount of fibrils is similar (Fig. 3A,B). Consistent with these data, under native conditions and in a concentration-dependent manner, the D53P mutant spontaneously generates oligomers, analogously to the wild-type protein (Fig. 3C). In gen- eral, a Pro residue can contribute to inhibit fibrillogen- esis, as reported for the Alzheimer Ab peptide [26], islet amyloid polypeptide [27] and mouse apolipopro- tein A-II [28]. By contrast, Pro53 appears to be well tolerated for b2m fibrillogenesis, which takes place to the same extent under the in vitro conditions tested but with somewhat delayed kinetics at 20% TFE (pH 7.4). Thus, the results for fibrillogenesis in the present study indicate that a constitutive b-bulge-like structure in the b2m 50–55 region (a b-sheet edge strand) has a mar- ginal effect in protecting against aggregation (native or fibrillar), posing some basic questions on the necessity of achieving a regular D-strand as a requirement for the aggregation process. To date, two contrasting hypotheses have been pro- posed about the regularity of the D-strand in mono- meric b2m in relation to fibril formation. Trinh et al. [11] observed a regular D-strand in the crystal struc- ture of isolated monomeric b2m, and suggested that the removal of the Asp53 b-bulge is a necessary step towards aggregation. More recently, Ricagno et al. proposed that occurrence of a regular D-strand is simply evidence of the flexibility and plasticity of such a strand, and not directly related to amyloid for- mation [16]. Indeed, recent structural studies have shown that, regardless of the amyloid propensity of the mutant considered, several b2m structures display a straight D-strand, which is regularly hydrogen- bonded to the neighboring E strand [13–16]. Further- more, two b2m structures showing residue Pro32 in trans conformation, are held to resemble the b2m amy- loidogenic intermediate [12,29], present different con- formations of the D-strand: a regular D-strand (in the P32A mutant) [12] and a bulged D-strand (in the hexa- meric structure of the H13F mutant) [29]. Within the MHC-I complex, the b-bulge centred on b2m Asp53 is favored by hydrogen bonds between Asp53 and resi- due Arg35 of the MHC-I heavy chain [10]. Intrigu- ingly, NMR data for monomeric b2m in solution show that the stretch of residues corresponding to the D-strand displays poor b-character, and the D-strand region is highly flexible [3,17]. In summary, the b 2m D-strand folds as a bulged strand upon interaction with the MHC-I heavy chain, it is flexible in solution and is a regular b-strand when b2m is crystallized as a monomer (Fig. 2b). Hence, our D53P mutant crystal structure, together with previously reported structural evidence including the b2m solution NMR structure [3,17], strongly suggests that the D-strand and the neighboring b2m loops are highly flexible ⁄ adjustable, and adopt different conformations depending on the structural context. Richardson & Richardson [1] suggested a number of strategies that proteins hosting extended b-structures may adopt to minimize the formation of unspecific intermolecular b-sheets by association of edge b-strands. Such strategies can be grouped into two main classes: (a) geometrical irregularities, such as b-bulges, on edge b-strands, hampering intermolecular backbone interac- tions, and (b) inward-pointing charged side chains that become trapped in the hydrophobic core of the fibril upon aggregation. Lysines are particularly suitable for such purpose as a result of their charged long and flex- ible side chain; however, other bulky charged residues have been observed in such role. Richardson & Rich- ardson [1] show that inward-pointing charged residues in b-sandwich proteins are often used against amyloid formation. In this respect, the locations of Lys91 and His51 within the b2m structure are interesting. Lys91 is positioned on the edge G-strand, facing the inner side of the b-sandwich. Even though no supporting experimental evidence is available, Lys91 is well posi- tioned to play a protective role against intermolecular cross-b interactions in the native protein. On the other hand, the location of His51in the D-strand is intrigu- ing: in native b2m, the His51 side chain points out- wards, although, in the structures of both the P32A mutant and the hexameric H13F mutant, His51 is flipped and points inwards [12,29], a conformation that appears perfectly suited to prevent edge-to-edge aggregation. In conclusion, the crystal structure, fibrillogenesis and biophysical data reported in the present study, when considered in light of the extensive structural literature on b2m, show that the D-strand, at the edge of the b2m ABED b-sheet, is endowed with wide structural flexibility and plasticity. As a result, the S. Azinas et al. Amyloid propensity in b2m D53P FEBS Journal 278 (2011) 2349–2358 ª 2011 The Authors Journal compilation ª 2011 FEBS 2355 different conformations observed in different crystal structures may simply highlight some of the conforma- tions that can be accessed by the D-strand and stabi- lized by a specific structural environment. Thus, straight or bulged D-strands would represent just two of the possible conformations that are not necessarily more amyloidogenic or less, respectively, relative to many others. Indeed, we show that the engineering of a Pro residue at the center of the D-strand (a ‘brute force’ approach introducing evident D-strand struc- tural perturbations) has no (protective) effects relative to the end products of fibrillogenesis, although it dis- plays some kinetic effects under specific in vitro condi- tions. Indeed, plasticity of the edge D-strand, facilitating conformational adaptations to the fibril structural environment, may be one of the leading fac- tors promoting b2m amyloid aggregation. Because D53P mutant ability to form fibrils is com- parable to that of the wild-type protein, it is unlikely that residue 53 in mature fibrils is located within a long b-strand [19]. Rather, we propose that, in mature b2m amyloid fibrils, residue 53 is located in a loop or at the end of a strand, where (when mutated to Pro) it would not interfere with intermolecular association interactions. Such a consideration would be in keeping with the results reported by Ladner et al. [21], who suggested that residue 53 may fall in a loop region of the mature amyloid fibrils. Experimental procedures Mutagenesis The expression and purification of wild-type and mutant b2m species was carried out as described previously [30]. Mutagenesis of Asp53 to Pro was performed by using the QuikChangeÔ site-directed mutagenesis kit supplied by Stratagene (La Jolla, CA, USA) as described previously [13]. The primers used were: forward, 5¢-GAAAAAGTGGAGC ATTCACCGTTGTCTTTC AGCAAGGA C-3¢; reverse, 5¢-G T CCTTGCTGAAAGACAACGGTGAATGCTCCACTTTT TC-3¢. CD spectroscopy CD experiments were performed on a Jasco J-810 spectro- polarimeter (Jasco Inc., Easton, MD, USA) equipped with a Peltier device for temperature control. Protein was dis- solved in 50 mm sodium phosphate (pH 7.4). The protein concentration was 1.4 mgÆ mL )1 (1 cm cell path) or 0.1 mgÆmL )1 (0.1 cm cell path) for CD measurements in the near- and far-UV regions, respectively. Temperature ramps were carried out by increasing the temperature from 20 °C to 95 °Cat50°CÆh )1 (0.83 °CÆmin )1 ). T m was calculated as the first-derivatives minimum of the traces recorded in the near- (293 nm) and far-UV (202 nm) regions. Chemical unfolding experiments were carried out recording spectra at increasing concentration of GdHCl at 298 K. CD signals at 212 nm (i.e. the lowest readable wavelength in the presence of GdHCl) were plotted versus the GdHCl concentration and then fitted with a logistic equation (originlab, version 8.0; OriginLab Corporation, Northampton, MA, USA). The unfolding curves were analyzed using a two-state mechanism. Initially, unfolding curves for the NMU transi- tion were normalized to the apparent fraction of the unfolded form, F U , using the equation: F U ¼ðY À Y N Þ=ðY U À Y N Þð1Þ where Y is the observed variable parameter, and Y N and Y U are the corresponding values for the native and fully unfolded conformations, respectively. The difference in free energy between the folded and the unfolded state, DG, was calculated by the equation: DG  ¼ÀRT ln K¼ÀRTln½F U =ð1 À F U Þ ð2Þ where K is the equilibrium constant, R is the gas constant, and T is the absolute temperature. The data were analyzed assuming that the free energy of unfolding or refolding, DG°, was linearly dependent on the GdHCl concentration [31] (denoted by C): DG  ¼DG  ðH 2 OÞ À mC¼mðC m À CÞð3Þ where DG  ðH 2 OÞ and DG° represent the free energy of unfolding or refolding in the absence and presence of GdHCl, respectively; C m is the midpoint GdHCl con- centration required for unfolding or refolding; and m stands for the slope of the unfolding or refolding curve at C m . A least-squares curve fitting analysis was used to calculate the values of DG  ðH 2 OÞ , m and C m . Crystallization and structure determination The D53P b2m mutant was crystalized using the hanging- drop vapor diffusion method. The crystallization reservoir was composed of 26% poly(ethylene glycol) 4000, 20% glyc- erol, 0.2 m ammonium acetate and 0.1 m sodium acetate (pH 5.6). The crystal-growth droplet was composed of 1.2 lLof the mother liquor and 1.2 lL of protein solution (8 mgÆmL )1 ). Crystallization experiments were performed at 294 K. Thin needle-crystals grown from a single nucleation site (bushes) were obtained and were flash frozen using mother liquor as cryoprotectant. X-ray diffraction data col- lection was performed at 100 K on beamline ID14-2 (ESRF, Grenoble, France). The D53P crystals diffracted up to 1.9 A ˚ resolution and diffraction data were processed using mosflm Amyloid propensity in b2m D53P S. Azinas et al. 2356 FEBS Journal 278 (2011) 2349–2358 ª 2011 The Authors Journal compilation ª 2011 FEBS and scala [32,33]. Phases were determined by molecular replacement, using molrep [34] and the b2m W60G mutant [13] (Protein Data Bank code: 2Z9T) as the search model. The structure was then refined with refmac5 [35]. Model building and analysis was performed with coot [36]. Amyloid fibril formation Two different protocols were followed for b2m amyloid aggregation. The first protocol was carried out at pH 7.4 by incubation of 100 lm b2m in 50 mm phosphate buffer, 100 mm NaCl (pH 7.4) in the presence of 20% TFE at 37 °C. The second was carried out at pH 2.5 by incubating 100 ll b2m in 50 mm sodium citrate, 100 mm NaCl (pH 2.5). In both cases, 20 lgÆmL )1 of b2m fibril seeds were added to start the fibrillogenesis. Measurements were con- ducted in triplicate. MS Nano-ESI-MS was performed on a hybrid quadrupole- time-of-flight instrument (QSTAR Elite; Applied Biosys- tems, Foster City, CA, USA) equipped with a nano-ESI source. Metal-coated borosilicate capillaries with a med- ium-length emitter tip of 1 lm internal diameter (Proxeon, Odense, Denmark) were used to infuse the samples. The instrumental parameters applied were: declustering potential 80 V; ion spray voltage 1.1–1.2 kV; curtain gas 20 PSI. The interface heater was turned off. In the oligomerization experiments, lyophilized b2m was dissolved in Milli-Q water (Millipore, Billerica, MA, USA) (at room tempera- ture) at different final protein concentrations and spectra were acquired within a few minutes. Transmission electron microscopy A10lL aliquot of suspended b 2m amyloids was adsorbed on 200 mesh formvar ⁄ carbon copper grids; after 5 min, the grids were washed with distilled water to remove buffer salts and then negatively stained with 2% uranyl acetate. Sample observation was carried over on a EFTEM Leo912 ab (Zeiss, Oberkochen, Germany) transmission electron microscope at 80 kV, and digital images were recorded by a Proscan 1K slow scan charge-coupled device (Proscan, Lagerlechfeld, Germany). Acknowledgements This work was supported by Fondazione Cariplo, Milano, Italy (NOBEL project Transcriptomics and Proteomics Approaches to Diseases of High Sociomedi- cal Impact: a Technology Integrated Network), by the Italian MIUR (FIRB contract RBLA03B3KC_005), by the EU grant EURAMY and by FAR (Fondo Ateneo per la Ricerca) to R.G. We thank Ms Nadia Santo (Cen- tro Interdipartimentale di Microscopia Avanzata, Uni- versity of Milano, Milan, Italy) for technical support. References 1 Richardson JS & Richardson DC (2002) Natural beta- sheet proteins use negative design to avoid edge-to-edge aggregation. Proc Natl Acad Sci USA 99, 2754–2759. 2 Morgan CJ, Gelfand M, Atreya C & Miranker AD (2001) Kidney dialysis-associated amyloidosis: a molec- ular role for copper in fiber formation. J Mol Biol 309, 339–345. 3 Okon M, Bray P & Vucelic D (1992) 1H NMR assign- ments and secondary structure of human beta 2-micro- globulin in solution. Biochemistry 31, 8906–8915. 4 Floege J & Ketteler M (2001) beta2-microglobulin- derived amyloidosis: an update. Kidney Int Suppl 78, S164–S171. 5 Gejyo F, Yamada T, Odani S, Nakagawa Y, Arakawa M, Kunitomo T, Kataoka H, Suzuki M, Hirasawa Y, Shirahama T et al. (1985) A new form of amyloid pro- tein associated with chronic hemodialysis was identified as beta 2-microglobulin. Biochem Biophys Res Commun 129, 701–706. 6 Relini A, Canale C, De Stefano S, Rolandi R, Giorgetti S, Stoppini M, Rossi A, Fogolari F, Corazza A, Esposi- to G et al. (2006) Collagen plays an active role in the aggregation of beta2-microglobulin under physiopatho- logical conditions of dialysis-related amyloidosis. J Biol Chem 281, 16521–16529. 7 Yamamoto S, Yamaguchi I, Hasegawa K, Tsutsumi S, Goto Y, Gejyo F & Naiki H (2004) Glycosaminogly- cans enhance the trifluoroethanol-induced extension of beta 2-microglobulin-related amyloid fibrils at a neutral pH. J Am Soc Nephrol 15, 126–133. 8 Platt GW & Radford SE (2009) Glimpses of the molec- ular mechanisms of beta2-microglobulin fibril formation in vitro: aggregation on a complex energy landscape. FEBS Lett 583, 2623–2629. 9 Becker JW & Reeke GN Jr (1985) Three-dimensional structure of beta 2-microglobulin. Proc Natl Acad Sci USA 82, 4225–4229. 10 Shields MJ, Assefi N, Hodgson W, Kim EJ & Ribaudo RK (1998) Characterization of the interactions between MHC class I subunits: a systematic approach for the engineering of higher affinity variants of beta 2-micro- globulin. J Immunol 160, 2297–2307. 11 Trinh CH, Smith DP, Kalverda AP, Phillips SE & Radford SE (2002) Crystal structure of monomeric human beta-2-microglobulin reveals clues to its amyloidogenic properties. Proc Natl Acad Sci USA 99, 9771–9776. S. Azinas et al. Amyloid propensity in b2m D53P FEBS Journal 278 (2011) 2349–2358 ª 2011 The Authors Journal compilation ª 2011 FEBS 2357 12 Eakin CM, Berman AJ & Miranker AD (2006) A native to amyloidogenic transition regulated by a back- bone trigger. Nat Struct Mol Biol 13, 202–208. 13 Esposito G, Ricagno S, Corazza A, Rennella E, Gumral D, Mimmi MC, Betto E, Pucillo CE, Fogolari F, Vigli- no P et al. (2008) The controlling roles of Trp60 and Trp95 in beta2-microglobulin function, folding and amyloid aggregation properties. J Mol Biol 378, 885–895. 14 Iwata K, Matsuura T, Sakurai K, Nakagawa A & Goto Y (2007) High-resolution crystal structure of {beta}2- microglobulin formed at pH 7.0. J Biochem (Tokyo) 142, 413–419. 15 Ricagno S, Colombo M, de Rosa M, Sangiovanni E, Giorgetti S, Raimondi S, Bellotti V & Bolognesi M (2008) DE loop mutations affect beta-2 microglobulin stability and amyloid aggregation. Biochem Biophys Res Commun 377, 146–150. 16 Ricagno S, Raimondi S, Giorgetti S, Bellotti V & Bo- lognesi M (2009) Human beta-2 microglobulin W60V mutant structure: implications for stability and amyloid aggregation. Biochem Biophys Res Commun 380, 543– 547. 17 Verdone G, Corazza A, Viglino P, Pettirossi F, Giorg- etti S, Mangione P, Andreola A, Stoppini M, Bellotti V & Esposito G (2002) The solution structure of human beta2-microglobulin reveals the prodromes of its amy- loid transition. Protein Sci 11, 487–499. 18 Barbet-Massin E, Ricagno S, Lewandowski JR, Giorg- etti S, Bellotti V, Bolognesi M, Emsley L & Pintacuda G (2010) Fibrillar vs crystalline full-length beta-2-micro- globulin studied by high-resolution solid-state NMR spectroscopy. J Am Chem Soc 132, 5556–5557. 19 Debelouchina GT, Platt GW, Bayro MJ, Radford SE & Griffin RG (2010) Intermolecular alignment in beta(2)- microglobulin amyloid fibrils. J Am Chem Soc 132, 17077–17079. 20 Debelouchina GT, Platt GW, Bayro MJ, Radford SE & Griffin RG (2010) Magic angle spinning NMR analysis of beta2-microglobulin amyloid fibrils in two distinct morphologies. J Am Chem Soc 132, 10414–10423. 21 Ladner CL, Chen M, Smith DP, Platt GW, Radford SE & Langen R (2010) Stacked sets of parallel, in-regis- ter beta-strands of beta2-microglobulin in amyloid fibrils revealed by site-directed spin labeling and chemi- cal labeling. J Biol Chem 285, 17137–17147. 22 Santambrogio C, Ricagno S, Colombo M, Barbiroli A, Bonomi F, Bellotti V, Bolognesi M & Grandori R (2010) DE-loop mutations affect beta2 microglobulin stability, oligomerization, and the low-pH unfolded form. Protein Sci 19, 1386–1394. 23 Invernizzi G & Grandori R (2007) Detection of the equilibrium folding intermediate of beta-lactoglobulin in the presence of trifluoroethanol by mass spectrometry. Rapid Commun Mass Spectrom 21, 1049–1052. 24 MacArthur MW & Thornton JM (1991) Influence of proline residues on protein conformation. J Mol Biol 218, 397–412. 25 Matthews BW, Nicholson H & Becktel WJ (1987) Enhanced protein thermostability from site-directed mutations that decrease the entropy of unfolding. Proc Natl Acad Sci USA 84, 6663–6667. 26 Wood SJ, Wetzel R, Martin JD & Hurle MR (1995) Prolines and amyloidogenicity in fragments of the Alzheimer’s peptide beta ⁄ A4 . Biochemistry 34, 724–730. 27 Abedini A & Raleigh DP (2006) Destabilization of human IAPP amyloid fibrils by proline mutations out- side of the putative amyloidogenic domain: is there a critical amyloidogenic domain in human IAPP? J Mol Biol 355, 274–281. 28 Kunisada T, Higuchi K, Aota S, Takeda T & Yamagi- shi H (1986) Molecular cloning and nucleotide sequence of cDNA for murine senile amyloid protein: nucleotide substitutions found in apolipoprotein A-II cDNA of senescence accelerated mouse (SAM). Nucleic Acids Res 14, 5729–5740. 29 Calabrese MF, Eakin CM, Wang JM & Miranker AD (2008) A regulatable switch mediates self-association in an immunoglobulin fold. Nat Struct Mol Biol 15, 965–971. 30 Esposito G, Michelutti R, Verdone G, Viglino P, Hernandez H, Robinson CV, Amoresano A, Dal PiazF, Monti M, Pucci P et al. (2000) Removal of the N-terminal hexapeptide from human beta2-microglobu- lin facilitates protein aggregation and fibril formation. Protein Sci 9, 831–845. 31 Pace CN (1990) Measuring and increasing protein sta- bility. Trends Biotechnol 8, 93–98. 32 CCP4 (1994) The CCP4 suite: programs for protein crystallography. Acta Crystallogr A 50, 760–763. 33 Leslie AGW (1992) Recent changes to the MOSFLM package for processing film and image plate data. Joint CCP4 + ESF-EACMB Newsletter on Protein Crystal- lography. 34 Vagin AA & Teplyakov A (1997) MOLREP: an auto- mated program for molecular replacement. J Appl Crystallogr 30, 1022–1025. 35 Murshudov GN, Vagin AA & Dodson EJ (1997) Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr A 53, 240–255. 36 Emsley P & Cowtan K (2004) Coot: model-building tools for molecular graphics. Acta Crystallogr A 60, 2126–2132. Amyloid propensity in b2m D53P S. Azinas et al. 2358 FEBS Journal 278 (2011) 2349–2358 ª 2011 The Authors Journal compilation ª 2011 FEBS . intermolecular cross-b interactions in the native protein. On the other hand, the location of His5 1in the D-strand is intrigu- ing: in native b2m, the His51 side chain points. D-strand perturbation and amyloid propensity in beta-2 microglobulin Stavros Azinas 1,2 , Matteo Colombo 1 , Alberto