Reiteration as a cohesive device in news in brief on iraq war in english press = phép lặp làm phương tiện liên kết trong tin vắn về chiến tranh i rắc trên báo chí tiếng anh

... involving Reiteration in discourse so far. Reiteration as a cohesive device in news -in- brief on Iraq war in English press 1 (29) Authorities initially said several suspected terrorists were killed in the ... principal findings are summarized and some practical applications as well as some suggestions for further researches are provided. Reiteration a...

Ngày tải lên: 21/12/2013, 13:00

... more aware of different text relation in term of linguistic and society that translators should consider in translation. In looking at special aspects in translating cohesive devices in International ... Handling Cohesive Devices in Translating International Trade Contracts Structure 3: The Daisy Chain The Daisy Chain is a string of condition often attached to a main...

Ngày tải lên: 18/12/2013, 20:21

. CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢). activities. Construction of strains with modulated expression of pyk Strains with increased PK activity were obtained by intro- ducing an additional copy of

Ngày tải lên: 19/02/2014, 17:20

... Amersham. Protein concentration was assayed with the bicinchonic acid reagent (BCA) (Bio-Rad) using bovine serum albumin as standard. Arachidonic acid was dissolved in ethanol and stored as a ... contaminant [15]. The identity of S10 0A8 was further ascertained by amino-acid sequencing, using Edman degra- dation. As S10 0A9 has a blocked N-terminal amino acid, analysis of the prot...

Ngày tải lên: 18/03/2014, 01:20

... private capacity I am interested in sexuality and disability, and specifically in the ways in which disabled adults can establish meaningful relationships with other people (disabled or on- disabled). ... inevitable thatindividuals who are confronted with the issues depicted in the programme have been provoked into feelings of discord. I found, as I was watching, that it was...

Ngày tải lên: 02/04/2014, 17:58

... intravenously, its bioavailability is 100%. When the standard consists of intravenously administered drug, this is known as relative bioavailability (BA R ). e BA R of PA/EPI after administra- tion was ... performed in compliance with the Institutional Animal Care and Use Committee (IACUC) guidelines. Synthesis and characterization of PA PA was synthesized according to the method d...

Ngày tải lên: 23/04/2013, 21:38

... on to investigate motivation as an influencing factor in L2 acquisition. Before examining the effect of motivation on second language learning it is first important to realise that it is one ... alters. For example, in a formal setting intelligence and aptitude play a dominant role in learning, while exerting a weaker influence in an informal setting. The variables of...

Ngày tải lên: 06/09/2013, 10:10

... cross-protection, long lasting, vaccine-preventable, etc. c. Initialisms and Acronyms Initialism is a word-formation process during which only initial letters of words or sometimes initial syllables are ... widely spread in news items on bird flu in particular and in news media in general. The use of abbreviation in NIBF is summarized as follow: Table 4.4. Abbreviation...

Ngày tải lên: 26/11/2013, 12:41

... two languages share the same positions: initial, medial, and final. They are usually used in initial position when conveying information and make up a smallest percentage in final position. In ... part as compared with those of probability, proclamation, insertion, and assimilation. It is interesting to find that hearsay in English makes up the smallest percentage while ass...

Ngày tải lên: 26/11/2013, 13:24

... upgraders in strategies and situations The social distance significantly affects the distribution of this internal modifier. It is clear that difference of distribution appears in situations where ... the social distance is relatively familiar (=D) such as situation 1 (attending summer holiday), situation 4 (doing important task) and situation 16 ( business plan). 21 4.6. DIS...

Ngày tải lên: 26/11/2013, 13:31