A comparative study of insults in vietnamese and american english
A comparative study of insults in vietnamese and american english
... 1 MINISTRY OF EDUCATION AND TRAININGMINISTRY OF EDUCATION AND TRAININGMINISTRY OF EDUCATION AND TRAININGMINISTRY OF EDUCATION AND TRAINING UNIVERSITY OF DANANG NGUYỄN XUÂN QUANG ... The Comparative Study of Insults in Vietnamese and American English aimed at providing Vietnamese users of English and American users of Vietnamese with some knowledge about social factors influencing ... First, all the Vietnamese data and the American data were tabulated separately. Second, the trends in each group of data for each social factor of age, as well as social status and distance...
- 26
- 1,460
- 1
A comparative study of lexical cohesion in english and vietnamese newspaper articles
... example, one cannot say “an animal is a cat .” By contrast, it is accurate to say that a cat is an animal . ” That is, the meaning of animal“ ” is included in the meaning of “cat , ” as in ... reiteration mentioned in later parts of the study. Among content words, adjectives and adverbs, particularly the later, are repeated in a very limited rate. Almost all of adjectives and adverbs in ... sentences are adverb phrases, each composed by several single words. Most of these adverbials involve actual facts of the event being mentioned such as place (in Afghanistan, in China, in Chile, in...
- 73
- 1,661
- 4
A comparative study of criticism between american and vietnamese online newspapers
... shocked at the American direct way of communicating in general and criticizing in particular. In addition, with the popularity of Internet and online magazines in English language, people have ... realize. Latins and Arabs are generally inclined to display their emotions more openly than Americans do and to view Americans as unemotional and cold. Meanwhile, it is believed that Americans ... virtual “space”. That means all the journalism and media criticism that print makes possible is now available to anyone who can access a computer, vastly expanding choice and creating all kinds...
- 37
- 756
- 6
A STUDY ON HYPERBOLE IN SHORT STORIES OF SOME TYPICAL VIETNAMESE AND AMERICAN WRITERS
... Overview of hyperbole in American and Vietnamese short stories. Firstly, hyperbole in American and Vietnamese also happens popular both in the speaking language and writing language by many different ... rolled mass of bills as large as a teacup, and laid it on the table‖. (In ―The poet and the peasant‖ - O. Henry) That means the mass of bills have a lot and are dense. ―He was as neat and well-groomed ... burglar. ―If all the snakes I’ve used the oil of was strung out in a row they’d reach eight times as far as Saturn, and the rattles could be heard at Valparaiso, Indiana, and back.‖ (In the ―Make...
- 62
- 675
- 1
Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata pot
... Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fishspeciesSeriola quinqueradiataTamotsu ... yellowtail, and found that theone-sided accumulation of arachidonic acid into PtdIns isattained in the presence of large amounts of docosahexa-enoic acid and that several acyltransferase activities ... that phosphatidylinositol (PtdIns) containsabundant arachidonate and is composed mainly of 1-stea-royl-2-arachidonoyl species in mammals. We investigated ifthis characteristic of PtdIns applies...
- 8
- 619
- 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... ATATATCATATGTCCGGTGTCGCAAAGR-TryX ATATAGGATCCTTACTCGTCTCTCCACGGF-TryP1 ATATATCATATGTCCTGCGGTAACGCCR-TryP1 ATATAGGATCCTTACTGCTTGCTGAAGTATCF-TDPX1 Cys35Ala CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCGR-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold.Cloned protein or mutation primer (5’- to 3’)F-TDPX1 TATATCATATGTCTATCTACGACTTCAAGGTCR-TDPX1 ATATAGGATCCTCACGATTGAGTGCTTGGF-TryX ATATATCATATGTCCGGTGTCGCAAAGR-TryX ... CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTGF-TDPX1 Cys64Ala GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTCR-TDPX1 Cys64Ala GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACCF-TDPX1 Cys83Ala AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAGR-TDPX1...
- 16
- 483
- 0
Từ khóa: summary a comparative study on invitations in english and vietnamese in terms of crosscultural perspectivea comparative study of british and vietnamese funeral ritualsa comparative study of criticism between american and vietnamese online newspapersa case study of the rai lepcha and brahmin chhetri in sikkim and kalimpong west bengal indiaa comparative study of parameter estimation methodsa comparative study of parameter estimation methods for statistical natural language processingconnotation meanings of colours in vietnamese and englisha comparative study of social network modelsthe effect of motivation in teaching and learning english languagelist of words different in british and american englishlist of differences between british and american english spellingwords different in british and american english spellinga guide to the differences between british and american english pdfb a thesis a comparative study on making requests in vietnamese and english in terms of politenessa contrastive study of grammatical and semantic features of words and idiom denoting unhappiness in english and vietnameseNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ