Shaking a box of sand II – at the jamming limit, when shape matters

Shaking a box of sand II – at the jamming limit, when shape matters

Shaking a box of sand II – at the jamming limit, when shape matters

... 8 Shaking a box of sand II – at the jamming limit, when shape matters! In this chapter we extend the model of the previous chapter in two different direc- tions; the first and most important aim ... notation of wasted space from a as in the previous chapter to  here, we have in mind that, unlike the way in which we envisaged a as the aspect ra...

Ngày tải lên: 01/11/2013, 08:20

11 392 0
Shaking a box of sand I – a simple lattice model

Shaking a box of sand I – a simple lattice model

... one of the two orientations on stability grounds. In a spirit of generalisation, we say therefore that when grains are very asymmetrically shaped, and there is a strong preferred orientation, the ... situated at a depth comparable to (t); the length ξ dyn therefore determines the length to which order has propagated in the granular material in the ‘glassy’ regime. G...

Ngày tải lên: 01/11/2013, 08:20

10 471 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

... GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG Vps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATC YEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGG YEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG IRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG IRA ... Table 2. Primers used for mutagenesis. Primer Sequence (5¢-to3¢) Vps4 Upstr F CGCTGCAGTAAGAGCAGTAAACCCG Vps4 SalIR GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAA...

Ngày tải lên: 23/03/2014, 09:20

14 362 0
Compaction of disordered grains in the jamming limit - sand on random graphs

Compaction of disordered grains in the jamming limit - sand on random graphs

... of at least this aspect of granular media – the creation and filling of gaps by particles does not cause the appearance of further gaps in this model, in the way spins flips can trigger a cascade. We ... 6.4), indicating that the fluctuations in the the power spectrum are correlated over a wide range of frequencies. Qualitatively, this indicates that the density fl...

Ngày tải lên: 01/11/2013, 08:20

15 437 0
Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3

Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3

... grammar and vocabulary of the language. The last one is the lack of adequate training. HCC teachers may not have been adequately trained in the teaching of culture and, therefore, they do not have ... in the real classroom settings. The observation aims at enabling the author to get what she watches, follows, and records all the activities as they are the most rel...

Ngày tải lên: 07/11/2012, 15:06

40 645 1
Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx

Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx

... Much of the appeal of these montages is the impossible task they attempt: all of film history in four minutes! Like the pre-cinematic appeal of miniaturization-based attractions, such as the ... that caricatures typical classical Hollywood narrative structure. At the same time, the montage emphasizes the sheer variety, quantity, and accumulation of images, which...

Ngày tải lên: 07/03/2014, 15:20

10 612 0
Designing an esp syllabus for the second-year students of library study at the national teachers training college

Designing an esp syllabus for the second-year students of library study at the national teachers training college

... is an implicit statement of view on the nature of what is taken to be the most important aspect of language learning. A syllabus then tells the teacher and the student not only what to be learned ... textbooks and learning time. Apart from its practical benefits, a syllabus gives more support to the teachers and learners in that it makes the language-learning tasks ap...

Ngày tải lên: 07/11/2012, 14:36

76 738 4
An english-vietnamese cross-cultural study of keeping face at the first encounter

An english-vietnamese cross-cultural study of keeping face at the first encounter

... that English has been an international language in the world. In Vietnam, for the past few decades, we have witnessed a dramatic change in English teaching and learning. Communicative approach ... plays a key role in that big change. That is to say, language in use is paid more attention and becomes a core in language teaching and learning for learners’ benefit. Language is part...

Ngày tải lên: 07/11/2012, 14:54

51 1,3K 12
Từ khóa:
w