Shaking a box of sand II – at the jamming limit, when shape matters
Shaking a box of sand II – at the jamming limit, when shape matters
... 8
Shaking a box of sand II – at the jamming limit,
when shape matters!
In this chapter we extend the model of the previous chapter in two different direc-
tions; the first and most important aim ... notation of wasted space from a as in the previous chapter to here,
we have in mind that, unlike the way in which we envisaged a as the aspect ra...
Shaking a box of sand I – a simple lattice model
... one of the
two orientations on stability grounds. In a spirit of generalisation, we say therefore
that when grains are very asymmetrically shaped, and there is a strong preferred
orientation, the ... situated at a depth comparable to (t); the length ξ
dyn
therefore
determines the length to which order has propagated in the granular material in the
‘glassy’ regime.
G...
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc
... GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG
Vps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATC
YEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGG
YEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG
IRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG
IRA ... Table 2. Primers used for mutagenesis.
Primer
Sequence
(5¢-to3¢)
Vps4 Upstr F CGCTGCAGTAAGAGCAGTAAACCCG
Vps4 SalIR GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAA...
Compaction of disordered grains in the jamming limit - sand on random graphs
... of at least this aspect of granular media – the
creation and filling of gaps by particles does not cause the appearance of further
gaps in this model, in the way spins flips can trigger a cascade.
We ... 6.4),
indicating that the fluctuations in the the power spectrum are correlated over a wide
range of frequencies. Qualitatively, this indicates that the density fl...
Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3
... grammar and vocabulary of the language.
The last one is the lack of adequate training. HCC teachers may not have been
adequately trained in the teaching of culture and, therefore, they do not have ... in the real classroom
settings. The observation aims at enabling the author to get what she watches, follows, and
records all the activities as they are the most rel...
Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx
... Much of the appeal of these montages is the impossible task they attempt: all
of film history in four minutes! Like the pre-cinematic appeal of miniaturization-based
attractions, such as the ... that caricatures typical classical Hollywood narrative structure.
At the same time, the montage emphasizes the sheer variety, quantity, and
accumulation of images, which...
Designing an esp syllabus for the second-year students of library study at the national teachers training college
... is an implicit statement of view
on the nature of what is taken to be the most important aspect of language learning. A
syllabus then tells the teacher and the student not only what to be learned ... textbooks and learning time. Apart from its
practical benefits, a syllabus gives more support to the teachers and learners in that it makes
the language-learning tasks ap...
An english-vietnamese cross-cultural study of keeping face at the first encounter
... that English has been an international language in the world. In
Vietnam, for the past few decades, we have witnessed a dramatic change in English teaching
and learning. Communicative approach ... plays a key role in that big change. That is to say,
language in use is paid more attention and becomes a core in language teaching and learning
for learners’ benefit. Language is part...
Từ khóa:
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- Báo cáo quy trình mua hàng CT CP Công Nghệ NPV
- chuyên đề điện xoay chiều theo dạng
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- chuong 1 tong quan quan tri rui ro
- Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật