Báo cáo y học: "Cell Cycle Arrest by a Natural Product via G2/M Checkpoint"
Báo cáo y học: "Cell Cycle Arrest by a Natural Product via G2/M Checkpoint"
Ngày tải lên: 02/11/2012, 11:12
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
Ngày tải lên: 25/10/2012, 10:51
Tài liệu Báo cáo Y học: Oxidation of phenols by laccase and laccase-mediator systems doc
... that can specifically interact with target func- tional groups, through reaction pathways that are different from those directly accessible to laccase. A foreseeable strategy for any laccase-catalysed ... in a 10-mm quartz cuvette. Spectra were recorded in the 220–320 nm range, and the absorbance at 280 nm was plotted against concentration. Oxidations catalysed by laccase and laccase/med...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo y học: "Emergency intraosseous access in a helicopter emergency medical service: a retrospective study"
Ngày tải lên: 25/10/2012, 10:02
Báo cáo y học: "Primary lower limb lymphedema: a focus on its functional, social and emotional impac"
Ngày tải lên: 25/10/2012, 11:40
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
Ngày tải lên: 02/11/2012, 11:12
Tài liệu Báo cáo Y học: Tissue factor pathway inhibitor A possible mechanism of action doc
... Veronica I. Zarnitsina and Fazoil I. Ataullakhanov National Research Center for Hematology, Russian Academy of Medical Sciences, Moscow, Russia We have analyzed several mathematical models that describe inhibition ... VIIa–TF- dependent factor X activation by TFPI. We have compared experimental data obtained by Baugh et al. [8] with several mathematical models of the process and have show...
Ngày tải lên: 22/02/2014, 04:20
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... primer 5¢-d(TATTTGCATGGCC AGCCCAATCTATTTGAG)-3¢; Gly262 to Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper ... primer 5¢-d(TAATGCATCCGCTTTAATTTCTGAAATTA ATG)-3¢, lower primer 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢. The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAG CA...
Ngày tải lên: 22/02/2014, 04:20