Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"
... models to study HCV. Int. J. Med. Sci. 2006, 3 30Figure 1. Life cycle of HCV. The steps of the viral life cycle are depicted schematically. The topology of HCV structural and nonstructural proteins ... recently, recombinant infectious HCV could be produced in cell culture, rendering all steps of the viral life cycle, including entry and release of viral particles, amenable to syst...
Ngày tải lên: 02/11/2012, 10:00
... Hermoso,J.,Pignol,D.,Kerfelec,B.,Crenon,I.,Chapus ,C. & Fontecilla-Camps, J .C. (1996) Lipase activation by nonionic detergents. The crystal structure of the porcine lipase-colipase- tetraethylene glycol monooctyl ether ... after coexpression of S132T and WWW mutants. Schematic dimeric structures of LPL in head-to-tail configuration after cotransfec- tion of inactive LPL mutants an...
Ngày tải lên: 21/02/2014, 15:20
... (CCG CTCGAGCCTAACGG TGTGGAATAC, which hybridizes at positions 715–732 in the tps1 + ORF and shows an internal XhoIsite),andthe3¢ oligonucleotide TAF-3 (CTACG GCGGCCGCCCGAGC TAGAATTCATCGA, which hybridizes at the 3¢ end of tps1 + ORF ... oligonucleotide TAG-3 (CTAC G GCGGCCGCCATTTTTATGAATGGAAA, which hybridizes at the 3¢ end of ntp1 + ORF and incorporates a NotI site placed immediately ups...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: Molecular cloning of columbamine O-methyltransferase from cultured Coptis japonica cells pot
... isolation of CoOMT from C. japonica ESTs, the expression of functionally active recombinant enzyme, and its characterization. Characteri- zation of its specificity showed that Coptis CoOMT could methylate ... [20,21]. Construction and sequencing of cDNA library of C. japonica Poly(A) + RNA was isolated, and a cDNA library was constructed as described elsewhere [14]. The cDNA Fig. 1...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Molecular characterization of MRG19 of Saccharomyces cerevisiae Implication in the regulation of galactose and nonfermentable carbon source utilization pdf
... plasmid was named pYCfCTA 1::lacZ. A portion of MRG19 was amplified by PCR using primers PJB102 (5¢-GACCGTAGGTACCATGTTGGCT TCAG-3¢) and PJB103 (5¢-CGGGCCCCTC GAGGCCCA TCATCTAA-3¢) carrying KpnIandXhoI ... Broach, J.R. & Rowe, L.B. (1978) Regulation of galactose pathway in Saccharomyces cerevisiae: Induction of uridyl transferase mRNA and dependency on GAL4 gene func- tion. Proc. Natl...
Ngày tải lên: 31/03/2014, 08:20
Tài liệu Báo cáo Y học: Re-oxygenation of hypoxic simian virus 40 (SV40)-infected CV1 cells causes distinct changes of SV40 minichromosome-associated replication proteins doc
... (1994) Phosphorylation of the p34 subunit of human single-stranded- DNA-binding protein in cyclin A-activated G1 extracts is catalyzed by cdk-cyclin A complex and DNA-dependent protein kinase. Proc. Natl Acad. ... j,signalintensityofsuper- coiled DNA (sc). H, hypoxic. Fig. 5. Dissociation of minichromosome-bound RPA-34 by excess competitor single-stranded DNA. Minichromosomes of hypox...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo Y học: Functional epitope of common c chain for interleukin-4 binding ppt
... receptors are members of the type I cytokine receptor superfamily, w hich is charac terized by the presence of at least one cytokine-binding homology r egion (CHR) composed of two fibronectin type ... cytokine receptors, except for hgp130 [51] and granulocyte colony-stimulating factor receptor [54]. There- fore, c c CHR, the short form of the c c ectodomain, may be Table 2. Double...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo Y học: Transient activation of the c-Jun N-terminal kinase (JNK) activity by ligation of the tetraspan CD53 antigen in different cell types pptx
... JNK activity, the cells were incubated for 6 h in th e presence of MEM53 antibody. The luciferase activity was cor- rected for the efficiency of transfection by determining the ac tivity of plasmid ... tetraspanin superfamily: molecular facilitators. FASEB J. 11 , 428–442. 2. Horejsi, V. & Vlcek, C. (1991) Novel structurally distinct family of leucocyte surface glyco proteins inclu...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
... G, Casciani CU. Hepatitis C virus infection in Italian kidney graft recipients. Changing risk factors and hepatitis C virus genotypes. Ital J Gastroenterology Hepatology 1997; 29:448-55. 67. Cheung ... Non-A Non-B Hepatitis Research Group. Effect of screening for hepatitis C virus antibody and hepatitis B core antibody on incidence of post-transfusion hepatitis. Lan...
Ngày tải lên: 02/11/2012, 09:56
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"
... hepatitis C, liver fibrosis, cirrhosis, hepatocellular carcinoma, HCV, HCC 1. Introduction Chronic hepatitis C is the most common cause of chronic liver disease and cirrhosis, and the most common ... rate of chronic HCV infection than Caucasians and Hispanic whites. In prospective surveys among inner-city Baltimore (Maryland, U.S.) injection drug users, the prevalence of chronic...
Ngày tải lên: 02/11/2012, 09:56